ID: 1118594991

View in Genome Browser
Species Human (GRCh38)
Location 14:67428356-67428378
Sequence TCTATCCTGCTCCCCAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118594986_1118594991 15 Left 1118594986 14:67428318-67428340 CCACATGCAAGGACGCCCTCGGT No data
Right 1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG No data
1118594988_1118594991 -1 Left 1118594988 14:67428334-67428356 CCTCGGTGCACTAGCCCAAAGCT No data
Right 1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG No data
1118594987_1118594991 0 Left 1118594987 14:67428333-67428355 CCCTCGGTGCACTAGCCCAAAGC No data
Right 1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG No data
1118594984_1118594991 16 Left 1118594984 14:67428317-67428339 CCCACATGCAAGGACGCCCTCGG No data
Right 1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG No data
1118594982_1118594991 22 Left 1118594982 14:67428311-67428333 CCCACACCCACATGCAAGGACGC No data
Right 1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG No data
1118594981_1118594991 25 Left 1118594981 14:67428308-67428330 CCACCCACACCCACATGCAAGGA No data
Right 1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG No data
1118594979_1118594991 26 Left 1118594979 14:67428307-67428329 CCCACCCACACCCACATGCAAGG No data
Right 1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG No data
1118594983_1118594991 21 Left 1118594983 14:67428312-67428334 CCACACCCACATGCAAGGACGCC No data
Right 1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118594991 Original CRISPR TCTATCCTGCTCCCCAAGAT TGG Intergenic
No off target data available for this crispr