ID: 1118595690

View in Genome Browser
Species Human (GRCh38)
Location 14:67433591-67433613
Sequence ATACTCCCGATGAGTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118595690_1118595692 9 Left 1118595690 14:67433591-67433613 CCATTAAAACTCATCGGGAGTAT No data
Right 1118595692 14:67433623-67433645 AAATATCAAAAAAATTTTTGTGG No data
1118595690_1118595693 10 Left 1118595690 14:67433591-67433613 CCATTAAAACTCATCGGGAGTAT No data
Right 1118595693 14:67433624-67433646 AATATCAAAAAAATTTTTGTGGG No data
1118595690_1118595696 22 Left 1118595690 14:67433591-67433613 CCATTAAAACTCATCGGGAGTAT No data
Right 1118595696 14:67433636-67433658 ATTTTTGTGGGGGAAAAAGAAGG No data
1118595690_1118595695 12 Left 1118595690 14:67433591-67433613 CCATTAAAACTCATCGGGAGTAT No data
Right 1118595695 14:67433626-67433648 TATCAAAAAAATTTTTGTGGGGG No data
1118595690_1118595698 28 Left 1118595690 14:67433591-67433613 CCATTAAAACTCATCGGGAGTAT No data
Right 1118595698 14:67433642-67433664 GTGGGGGAAAAAGAAGGAGGAGG No data
1118595690_1118595697 25 Left 1118595690 14:67433591-67433613 CCATTAAAACTCATCGGGAGTAT No data
Right 1118595697 14:67433639-67433661 TTTGTGGGGGAAAAAGAAGGAGG No data
1118595690_1118595694 11 Left 1118595690 14:67433591-67433613 CCATTAAAACTCATCGGGAGTAT No data
Right 1118595694 14:67433625-67433647 ATATCAAAAAAATTTTTGTGGGG No data
1118595690_1118595699 29 Left 1118595690 14:67433591-67433613 CCATTAAAACTCATCGGGAGTAT No data
Right 1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118595690 Original CRISPR ATACTCCCGATGAGTTTTAA TGG (reversed) Intergenic
No off target data available for this crispr