ID: 1118595699

View in Genome Browser
Species Human (GRCh38)
Location 14:67433643-67433665
Sequence TGGGGGAAAAAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118595689_1118595699 30 Left 1118595689 14:67433590-67433612 CCCATTAAAACTCATCGGGAGTA No data
Right 1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG No data
1118595690_1118595699 29 Left 1118595690 14:67433591-67433613 CCATTAAAACTCATCGGGAGTAT No data
Right 1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118595699 Original CRISPR TGGGGGAAAAAGAAGGAGGA GGG Intergenic
No off target data available for this crispr