ID: 1118596005

View in Genome Browser
Species Human (GRCh38)
Location 14:67436237-67436259
Sequence CGCCTACTGGCCTGGCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118596005_1118596011 -9 Left 1118596005 14:67436237-67436259 CCAGGATGCCAGGCCAGTAGGCG No data
Right 1118596011 14:67436251-67436273 CAGTAGGCGCCTGTGTGGGAGGG No data
1118596005_1118596016 23 Left 1118596005 14:67436237-67436259 CCAGGATGCCAGGCCAGTAGGCG No data
Right 1118596016 14:67436283-67436305 CTCTATACCATGGAGTAGCTGGG No data
1118596005_1118596015 22 Left 1118596005 14:67436237-67436259 CCAGGATGCCAGGCCAGTAGGCG No data
Right 1118596015 14:67436282-67436304 ACTCTATACCATGGAGTAGCTGG No data
1118596005_1118596014 13 Left 1118596005 14:67436237-67436259 CCAGGATGCCAGGCCAGTAGGCG No data
Right 1118596014 14:67436273-67436295 GGAGAGTTCACTCTATACCATGG No data
1118596005_1118596018 25 Left 1118596005 14:67436237-67436259 CCAGGATGCCAGGCCAGTAGGCG No data
Right 1118596018 14:67436285-67436307 CTATACCATGGAGTAGCTGGGGG No data
1118596005_1118596010 -10 Left 1118596005 14:67436237-67436259 CCAGGATGCCAGGCCAGTAGGCG No data
Right 1118596010 14:67436250-67436272 CCAGTAGGCGCCTGTGTGGGAGG No data
1118596005_1118596012 -8 Left 1118596005 14:67436237-67436259 CCAGGATGCCAGGCCAGTAGGCG No data
Right 1118596012 14:67436252-67436274 AGTAGGCGCCTGTGTGGGAGGGG No data
1118596005_1118596017 24 Left 1118596005 14:67436237-67436259 CCAGGATGCCAGGCCAGTAGGCG No data
Right 1118596017 14:67436284-67436306 TCTATACCATGGAGTAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118596005 Original CRISPR CGCCTACTGGCCTGGCATCC TGG (reversed) Intergenic
No off target data available for this crispr