ID: 1118597458

View in Genome Browser
Species Human (GRCh38)
Location 14:67446928-67446950
Sequence GCTTTTACGCTGCAGTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118597454_1118597458 4 Left 1118597454 14:67446901-67446923 CCATTTGTTTGTAGGCTCTCTAT No data
Right 1118597458 14:67446928-67446950 GCTTTTACGCTGCAGTGGCAGGG No data
1118597453_1118597458 10 Left 1118597453 14:67446895-67446917 CCACGTCCATTTGTTTGTAGGCT No data
Right 1118597458 14:67446928-67446950 GCTTTTACGCTGCAGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118597458 Original CRISPR GCTTTTACGCTGCAGTGGCA GGG Intergenic
No off target data available for this crispr