ID: 1118600637

View in Genome Browser
Species Human (GRCh38)
Location 14:67469605-67469627
Sequence CCTTCCAGGAAGAGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 324}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118600637_1118600648 2 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600648 14:67469630-67469652 GAAAGTGGGCAGCGGCCTGGTGG 0: 1
1: 0
2: 0
3: 29
4: 263
1118600637_1118600652 14 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600652 14:67469642-67469664 CGGCCTGGTGGTGGTGGTGGTGG 0: 1
1: 4
2: 86
3: 427
4: 4732
1118600637_1118600658 27 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600658 14:67469655-67469677 GTGGTGGTGGTGGTGGTGGGAGG 0: 33
1: 183
2: 552
3: 1459
4: 4996
1118600637_1118600657 24 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600657 14:67469652-67469674 GTGGTGGTGGTGGTGGTGGTGGG 0: 70
1: 218
2: 584
3: 1509
4: 4077
1118600637_1118600646 -6 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600646 14:67469622-67469644 GGAAGGAGGAAAGTGGGCAGCGG 0: 1
1: 0
2: 9
3: 174
4: 1395
1118600637_1118600655 20 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600655 14:67469648-67469670 GGTGGTGGTGGTGGTGGTGGTGG 0: 1863
1: 3563
2: 7475
3: 11582
4: 18916
1118600637_1118600654 17 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600654 14:67469645-67469667 CCTGGTGGTGGTGGTGGTGGTGG 0: 9
1: 116
2: 2836
3: 5864
4: 12264
1118600637_1118600649 5 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600649 14:67469633-67469655 AGTGGGCAGCGGCCTGGTGGTGG 0: 1
1: 0
2: 4
3: 48
4: 448
1118600637_1118600647 -1 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600647 14:67469627-67469649 GAGGAAAGTGGGCAGCGGCCTGG 0: 1
1: 0
2: 2
3: 41
4: 379
1118600637_1118600650 8 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600650 14:67469636-67469658 GGGCAGCGGCCTGGTGGTGGTGG 0: 1
1: 0
2: 4
3: 70
4: 644
1118600637_1118600656 23 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600656 14:67469651-67469673 GGTGGTGGTGGTGGTGGTGGTGG 0: 1863
1: 3563
2: 7475
3: 11582
4: 18916
1118600637_1118600651 11 Left 1118600637 14:67469605-67469627 CCCTCCATCCTCTTCCTGGAAGG 0: 1
1: 0
2: 2
3: 39
4: 324
Right 1118600651 14:67469639-67469661 CAGCGGCCTGGTGGTGGTGGTGG 0: 1
1: 0
2: 9
3: 100
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118600637 Original CRISPR CCTTCCAGGAAGAGGATGGA GGG (reversed) Intronic
900489945 1:2942827-2942849 CCTGACAGGAAGAGGCTGGTCGG + Intergenic
900773771 1:4566133-4566155 CCTTCCAGGGAGATCATAGATGG + Intergenic
900778515 1:4601907-4601929 CCTGGCAGGAATATGATGGATGG - Intergenic
900940153 1:5793366-5793388 CCCTCCAGGTAGCGCATGGAAGG + Intergenic
901325715 1:8364101-8364123 CCGTCAAGGAAGAGGATGATGGG - Exonic
901787567 1:11634853-11634875 CCCTCCAGGAGGAGGGAGGAGGG + Intergenic
901940301 1:12656764-12656786 CATACCAGGCAGTGGATGGATGG - Intronic
902823831 1:18959205-18959227 CCTTCCTGGAAGAGGTTGCAGGG - Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
904562893 1:31410684-31410706 ATTTCCGGGAAGGGGATGGACGG + Intronic
904578562 1:31522773-31522795 CCTTCCAGAAAGACGAGAGAAGG - Intergenic
910041971 1:82863474-82863496 TCTTCAGGGAGGAGGATGGAAGG - Intergenic
910343253 1:86211706-86211728 CATTTCAGGAAGAGGAAGCAAGG - Intergenic
910654414 1:89605415-89605437 CCTACCATGAAGAGGAGGGACGG + Intergenic
912386277 1:109272689-109272711 CCTTCCAGGAACAGGCTGCCTGG - Exonic
913321874 1:117594360-117594382 CTGCCCTGGAAGAGGATGGAGGG - Intergenic
913971821 1:143422405-143422427 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914066200 1:144248018-144248040 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914112953 1:144718336-144718358 ACTTCCAGGCAGGGGAAGGACGG + Intergenic
914321099 1:146561093-146561115 GCTTCTAGGTGGAGGATGGAGGG - Intergenic
914839523 1:151236715-151236737 CCATCCAGGGAGAGGCTCGACGG + Exonic
915040382 1:152963324-152963346 TCTTCCTGGAAGAAGATGGTTGG - Intergenic
915116848 1:153606726-153606748 CCTTTATGGAGGAGGATGGAGGG + Intergenic
915836818 1:159183473-159183495 CCAGCCAGAAAGAGGGTGGATGG + Intronic
916194579 1:162211384-162211406 CCTTCCAATAAGAGGAGGGGAGG - Intronic
916891144 1:169113674-169113696 TCTTTTAGGAAGGGGATGGAAGG - Intronic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
918378465 1:183932465-183932487 CCTCCCGGGAGGAGGTTGGAGGG - Intronic
918525178 1:185456873-185456895 CCTTCCAGGCAGAGGGAGCAGGG - Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920977621 1:210800759-210800781 CCTTCAAGGAAGAGCAAGGATGG - Intronic
921580670 1:216892542-216892564 GCTTCCATAAAGAGGATAGAAGG - Intronic
923573519 1:235137800-235137822 CCTTCCAGGAAAAGCCTGGAAGG + Intronic
1065746091 10:28843839-28843861 TCTACCAAGAAGAGGATGAAAGG + Intergenic
1067459416 10:46446388-46446410 CATTCCATGGAGAGGTTGGAGGG + Intergenic
1067627778 10:47938242-47938264 CATTCCATGGAGAGGTTGGAGGG - Intergenic
1069583899 10:69584197-69584219 CCTTACAGTAGGAGGATGCAGGG + Intergenic
1070686696 10:78490096-78490118 CCTTCCAGGAGAAGGAAGGAGGG + Intergenic
1072290491 10:93960437-93960459 CCATCCAGGGAGAGGCTCGACGG - Intergenic
1072460390 10:95612959-95612981 CTTTCCAGTCAAAGGATGGAAGG + Intronic
1072641677 10:97215772-97215794 CCTTCCGGGAAGAGGATAAATGG - Intronic
1072799567 10:98383854-98383876 CCTTCCAGGAGGAGGTGTGATGG - Exonic
1073116713 10:101095553-101095575 ACTTCCAGGTAAAGGCTGGAAGG - Intronic
1073146478 10:101284989-101285011 CTTTGCAGGAAGAGGAAGGGAGG + Intergenic
1073185050 10:101610899-101610921 CCTTCCAGGAAGGGGCAGAAAGG + Exonic
1073465158 10:103690944-103690966 CACGCCAGGAAAAGGATGGATGG - Intronic
1074462186 10:113647885-113647907 CCTTTCTGGGAGTGGATGGATGG - Intronic
1074822259 10:117189355-117189377 TCTTCCAGTAAAAGGAAGGAGGG + Intergenic
1075088781 10:119431284-119431306 CCTCCCAGGTAGAGAATGGATGG - Intronic
1075282940 10:121156304-121156326 CCTCCCAGGTAGAAGATGGGAGG + Intergenic
1075594214 10:123716207-123716229 CTGTCCAGGAAGCAGATGGATGG + Intronic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1077260932 11:1619935-1619957 CCTTCTGGGAACAGGTTGGATGG - Intergenic
1077476429 11:2792521-2792543 CCTTTCAAGAAGAGGTTGCAGGG + Intronic
1077704791 11:4474743-4474765 CCTTCTAGGAAGAGTATCCAGGG - Intergenic
1078910333 11:15725129-15725151 CCTTATAGGAAGAGGATGTTAGG - Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079240769 11:18720983-18721005 CCTTCGAGGAAAGGGAGGGATGG - Intronic
1079276016 11:19038411-19038433 CTTTCTAGGAAGAGGCTGTAGGG - Intergenic
1080796163 11:35565586-35565608 CCTTCCCTGAAGATGATGGGAGG + Intergenic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1084799165 11:71530506-71530528 CCTTCTGGGAACAGGTTGGATGG + Intronic
1084936921 11:72591805-72591827 CCTGCCATGGTGAGGATGGACGG + Intronic
1085336418 11:75700177-75700199 CCTTCCAGAAAGTAGATGGCTGG - Intergenic
1086862731 11:91944162-91944184 CCTTGCAGAGAGAGGATGTAGGG - Intergenic
1088261458 11:107948072-107948094 CCTCCCAGGAAGATGGTGAAGGG + Intronic
1088715163 11:112542721-112542743 CCCACCAGGAAGAGGGAGGAAGG + Intergenic
1089052914 11:115561559-115561581 CCCTTCAGGAAAAGGAGGGATGG - Intergenic
1089603586 11:119629038-119629060 CCTTCCAGGAAGGGCAAGAAGGG + Intronic
1090154510 11:124423644-124423666 CCTACCAAGAAAAGAATGGAAGG + Intergenic
1090248711 11:125236345-125236367 CTTTCCTGGAACAGGATGGAGGG - Intronic
1091098960 11:132851998-132852020 GCTTCCAGGAAGAAAAGGGAAGG - Intronic
1091137486 11:133205102-133205124 CCTCCCAGGAAGAAGAGGGTGGG - Intronic
1091138264 11:133212417-133212439 CTTTCCAGGAAGTGGAAGCAGGG - Intronic
1092705840 12:11283476-11283498 CTTTCCATGAAAAGGATGAAAGG - Intergenic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1093342001 12:17988373-17988395 CCTTCCAGGAAGAATATTAAAGG + Intergenic
1093550096 12:20399462-20399484 GCTTACAGGAAGAGAATGAAAGG + Intronic
1094499373 12:31008644-31008666 CCTCCCAGGAGGATGGTGGAGGG - Intergenic
1094698109 12:32841701-32841723 CCTCCCAGTAAGAGCAGGGAAGG + Intronic
1096179417 12:49542459-49542481 GCTTCCAGGAAGAGGAGGTTTGG - Intronic
1097175904 12:57142851-57142873 CCTGCCAGGAAGAGTTGGGATGG - Intronic
1097279094 12:57833474-57833496 CCAGCCTGGAAAAGGATGGAGGG - Intronic
1097306735 12:58077429-58077451 CCCTCCAGAGAGAGGAAGGAAGG + Intergenic
1099167772 12:79327834-79327856 GCTTCCAAGAAGAGGAAGCAGGG + Intronic
1101881673 12:108630048-108630070 CCTTCCAGGAAGAGGAGAGGTGG - Intronic
1102477409 12:113197474-113197496 CCTTCTAGGAATGGGATGAATGG - Intronic
1102871919 12:116420386-116420408 CCTGGGAGGACGAGGATGGATGG + Intergenic
1102899682 12:116626589-116626611 ACTTACAGAAAGAGGATGGAGGG + Intergenic
1103692954 12:122790705-122790727 ACCTCCAGGAAGGGGAGGGAGGG - Intronic
1104433053 12:128732461-128732483 CCTCCCAGGAAGTAGAGGGAGGG - Intergenic
1104572021 12:129933965-129933987 GCTTCCTGGAAGAGGAAGCAAGG + Intergenic
1104585345 12:130044283-130044305 GCTTCCTGGAAGAGGAAGCAAGG - Intergenic
1104692992 12:130840345-130840367 CCTTCCAGGAGGAGAAGGCAAGG + Intergenic
1105058411 12:133125725-133125747 TCTGCCATGAAGAGGATAGAAGG + Intronic
1105428881 13:20319072-20319094 CTTTCCCAGAAGAGGATGCAAGG - Intergenic
1107423243 13:40269150-40269172 GCTTCCAGGAAGCTTATGGATGG - Intergenic
1107430007 13:40332106-40332128 CCTTCCTGGAAGAGGAGAGGTGG - Intergenic
1110987577 13:81990635-81990657 CCTTTCAGAAAGAGTATGTAGGG + Intergenic
1112065039 13:95783932-95783954 CCATCCAGGAAGAGGAGGGAGGG + Intronic
1113028200 13:105964481-105964503 ACTTCCAGGTAGAGAATGGAAGG - Intergenic
1113255394 13:108499888-108499910 ACTTCCATGAAGTGGAGGGAGGG - Intergenic
1114547857 14:23515409-23515431 CCTTCCAGAAAGACTATGCAAGG + Intergenic
1118321342 14:64754997-64755019 CCTTTCAGCAAGAGGTAGGAAGG + Intronic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1122115779 14:99526586-99526608 CCCTCCAGGAAGAGGAAGTGGGG + Intronic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1124475051 15:30025914-30025936 CCTTTCAGGCAGAGGAAAGATGG + Intergenic
1125892345 15:43276050-43276072 GCCTGCAGGCAGAGGATGGAGGG - Intergenic
1128670337 15:69570039-69570061 AATTTCAGGAAGGGGATGGAAGG - Intergenic
1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG + Intergenic
1129227460 15:74178454-74178476 TGTTCCAAGAAGAGGAAGGAAGG - Intergenic
1129233522 15:74209719-74209741 CCCTCTAGGAAGGGGAGGGAGGG - Intronic
1129241873 15:74256753-74256775 CCTTCCCAGAAGAGGGTAGAAGG + Intronic
1130662269 15:85840161-85840183 CCCTCCACGAAGAAGCTGGAAGG + Intergenic
1131388185 15:92025061-92025083 CATGCCATTAAGAGGATGGAAGG - Intronic
1131694344 15:94859095-94859117 ACTGCCAGGTAGAGGGTGGAGGG - Intergenic
1132101847 15:99029257-99029279 CCTCCCAGGAAAAGGATGAGAGG + Intergenic
1132583350 16:695126-695148 ACTCCCAGGAAGACGAGGGATGG - Intronic
1132647795 16:1007097-1007119 CCTTCCCGGAGCAGGATGGAGGG + Intergenic
1134182771 16:12061139-12061161 CATTCCAGGAAGGTCATGGAAGG - Intronic
1134639411 16:15817914-15817936 CCTACCAGGGTCAGGATGGATGG - Intronic
1135336937 16:21609654-21609676 CCTTCCAGAAAAAAGAAGGAAGG + Intronic
1136069844 16:27781189-27781211 CCTTCCACCAAAAGGAGGGAGGG - Intergenic
1136748740 16:32614614-32614636 CCCTACAGGACGAGGAGGGAGGG + Intergenic
1136866387 16:33759864-33759886 CCTTCCAGTAAGAGCCAGGAAGG - Intergenic
1137389084 16:48066624-48066646 GCTTCCAGGAAGAGGAGGCCTGG + Intergenic
1137446838 16:48537072-48537094 CCTTCAAGGAAAAGAATTGAGGG - Intergenic
1138589827 16:57993688-57993710 CCTCCCAGGAAGAGGATGCCCGG - Intergenic
1138910820 16:61396728-61396750 CTTTCCAGGCATAGGATAGATGG + Intergenic
1139493739 16:67301382-67301404 CGTGCCTGGAAGAGGAAGGATGG + Intronic
1140455989 16:75105898-75105920 CCTTCCTGCAAGAGGCGGGAGGG - Intronic
1142422373 16:89979786-89979808 CATTACAGGAAGAGGCTGGTAGG + Intergenic
1203050874 16_KI270728v1_random:873828-873850 CCCTACAGGACGAGGAGGGAGGG + Intergenic
1203105772 16_KI270728v1_random:1356336-1356358 CCTTCCAGTAAGAGCCAGGAAGG + Intergenic
1203127742 16_KI270728v1_random:1606032-1606054 CCTTCCAGTAAGAGCCAGGAAGG - Intergenic
1142546694 17:708975-708997 TCTTCCAGGATGATGAGGGAAGG - Intronic
1142598283 17:1040098-1040120 CCTCCCAGGAAGATGATCGACGG - Intronic
1142957076 17:3529563-3529585 CCTTCCTGGAGGAGGCTAGAGGG - Intronic
1142969416 17:3601204-3601226 GCTCCCAGGTAGAGGAGGGATGG - Intergenic
1143632750 17:8148180-8148202 TCTTCCAGGATGTGGATGAAAGG - Exonic
1144769065 17:17749102-17749124 CCGTCCAGAAAGAGGCTGAATGG + Intronic
1145103175 17:20093665-20093687 CCTTCCTGCAAGTGGACGGAGGG + Intronic
1145986350 17:29049528-29049550 CCTCCCAGTATGAAGATGGATGG - Intronic
1146617233 17:34366686-34366708 CCATCCAGGAGGAGGAAAGAGGG - Intergenic
1146939378 17:36833583-36833605 CATTCCAGCAGGAGGATGCAGGG + Intergenic
1147240318 17:39086461-39086483 CCTCCAAGGAAGAGGAAGCAGGG + Intronic
1147372758 17:40004771-40004793 CCTTCCAGGAAGGGTGTGGTGGG + Intergenic
1147928627 17:43961944-43961966 ACTTCCAGGCAGGGGATTGAGGG - Intronic
1148744909 17:49912731-49912753 GCGTCGAGGAAGAGGAGGGAGGG - Intergenic
1149544934 17:57496416-57496438 CCTTCCAGGAGGCTGATGAACGG + Intronic
1151670968 17:75571560-75571582 CCCTCCTGGGAGAGGCTGGAAGG - Intronic
1152044657 17:77928032-77928054 CATTCCAAGAAGAGGATCCATGG + Intergenic
1153160200 18:2196232-2196254 CTTTCCAGGAAGAAGAAGGCTGG + Intergenic
1154493409 18:14938491-14938513 CCTACCAGGTAGAGGACTGAGGG - Intergenic
1155235435 18:23813912-23813934 ACTTCCAGGCACAGAATGGATGG + Intronic
1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG + Intronic
1157394210 18:47328152-47328174 ACTTCTAGGAAGAGAAAGGAAGG + Intergenic
1157511145 18:48275716-48275738 TCTTCCAGGAAGAGGGTAAAGGG + Intronic
1157532260 18:48430802-48430824 CCTTCCAAGAGGAAGATGGCAGG + Intergenic
1159512712 18:69416666-69416688 ACTTCCAGGATGAGGATGATAGG - Intronic
1160106658 18:75984140-75984162 CCTGCCAGGAGGAGGATGACAGG - Intergenic
1160231310 18:77051703-77051725 CCTTCCAGGGAGAAGAAGAAAGG + Intronic
1160737070 19:667774-667796 CCTGCCAGGATGAGGGTGGAGGG - Intergenic
1160798556 19:956742-956764 CCTTCCGGGAAGGGGCTGGGGGG - Intronic
1162362515 19:10228570-10228592 CCTCCCAGAAAGAGGAAGCAGGG + Intronic
1163187905 19:15652680-15652702 CATTCCAGGAACAGGGTGGGTGG + Intronic
1163364586 19:16868927-16868949 CCTTCCGGGTAGTAGATGGAGGG + Intronic
1164477158 19:28584775-28584797 CCCACGAGGAAGGGGATGGAAGG - Intergenic
1164751388 19:30657586-30657608 CCTTCCAGGAAGAGAGTGCAGGG - Intronic
1166217001 19:41342298-41342320 CCCTGGAGGAAGAGGAAGGAAGG + Intronic
1166423243 19:42654279-42654301 CCTTCCTGGGAGAGGACGGGAGG + Intronic
1166690969 19:44821045-44821067 CCTTGCCGGCAGAGGAAGGAAGG - Exonic
1166709529 19:44927773-44927795 CCTGCCAGGAAGATGAGGCAGGG - Intergenic
1168242873 19:55096067-55096089 CCATCCAGGACGAGGATGAGGGG - Exonic
1168716583 19:58532029-58532051 GCTTCCAGGGAAAGGAAGGAGGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925321338 2:2971777-2971799 CATTCCAGGAAGAAATTGGAGGG - Intergenic
925897648 2:8485394-8485416 CCTTCCAGTACGAGGACGGATGG - Intergenic
927850093 2:26493457-26493479 CCCTCCAGGAAAGGGATGGCAGG + Intronic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
928638316 2:33270621-33270643 CCTGCCTGGCAAAGGATGGAAGG + Intronic
929417864 2:41761888-41761910 CTTTCCAGGAACAGGCTGTATGG - Intergenic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
930627049 2:53709463-53709485 CATACCAGAAAGAGGAGGGAAGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932012613 2:67993470-67993492 CCATCCAGCAAGAGGATAAAGGG - Intergenic
932909125 2:75787236-75787258 TCTCCAAGGAAGAGGATGCAAGG + Intergenic
933314838 2:80703680-80703702 TCTTCCAGGAAAGGCATGGAAGG - Intergenic
934176511 2:89583337-89583359 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934286821 2:91657698-91657720 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934522737 2:95030197-95030219 CCTCACAGGAAGAGGAAGGCAGG + Intronic
934635078 2:95978440-95978462 CCTTCCAGTAAGAGCCAGGAAGG - Intronic
934798550 2:97126794-97126816 CCTTCCAGTAAGAGCCAGGAAGG + Intronic
934834879 2:97576697-97576719 CCTTCCAGTAAGAGCCAGGAAGG - Intronic
934972498 2:98774608-98774630 TCTTGCAGGAAGTGGATGAAGGG - Intergenic
935074545 2:99728166-99728188 CCTTACAGAATGAGGATGCATGG - Intronic
935349540 2:102141888-102141910 CCTTGCAGGGAGAGGAGGGGAGG - Intronic
935925591 2:108065185-108065207 CTTTCCAGGAAGCAGCTGGATGG + Intergenic
938074294 2:128323503-128323525 CCTTCCTGGAGGATGATGGCCGG + Intergenic
938278452 2:130048674-130048696 CCATCCAGGGATATGATGGATGG - Intergenic
938329427 2:130439533-130439555 CCATCCAGGGATATGATGGATGG - Intergenic
938348662 2:130583147-130583169 GGTTTCAGGAGGAGGATGGAGGG - Intronic
938360521 2:130681970-130681992 CCATCCAGGGATATGATGGATGG + Intergenic
938436924 2:131288678-131288700 CCATCCAGGGATATGATGGATGG + Intronic
938809740 2:134842345-134842367 CTTTCCAGGAAAGGGAGGGAGGG + Intronic
939156246 2:138527824-138527846 CATTCAAGGAAGAGGATGCTGGG - Intronic
939976529 2:148723019-148723041 CCTTCAGGGTGGAGGATGGAAGG + Intronic
942141125 2:172978365-172978387 TCTCCCAGGAAGAGCAGGGAAGG - Intronic
942191340 2:173473555-173473577 CCTTCAAGGAAGAAAATGAAAGG - Intergenic
942247283 2:174019416-174019438 CCCTCAAGGAAGAGTGTGGAGGG - Intergenic
944157900 2:196627257-196627279 CTTTCCAGGAAGAGAATGTTTGG + Intergenic
945920613 2:215751316-215751338 CCATCCAGGCAGCAGATGGATGG - Intergenic
946414501 2:219533024-219533046 CCCTCCAGGAAGAGATTGGGAGG - Intronic
947314459 2:228840702-228840724 TCTTCCAGGAAGAGGGTGTGAGG - Intergenic
948073884 2:235149964-235149986 CTTTGCAGGAAGAAGCTGGATGG + Intergenic
948208171 2:236173637-236173659 CCTTCCAGGACGAGGCAGGCGGG - Intergenic
948899672 2:240949927-240949949 CCCTCATGGAAGAGGCTGGAAGG + Intronic
1169310271 20:4532133-4532155 CTTGCAAAGAAGAGGATGGAAGG - Intergenic
1169701331 20:8450150-8450172 ACTTCCAGGAGTAGGATGGGAGG - Intronic
1169862492 20:10167249-10167271 ACCTCCTGGATGAGGATGGATGG + Intergenic
1173036939 20:39420880-39420902 CTGTCCAGGAAGAAAATGGATGG + Intergenic
1173340537 20:42149007-42149029 CATTTCAGGAAGAGGATGTTAGG - Intronic
1173648935 20:44651061-44651083 CCTGCCAGAAAGGGGAGGGAGGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174090322 20:48041778-48041800 CCTTCCAGGGTAAGCATGGAGGG + Intergenic
1174148184 20:48467208-48467230 CATTCTATGAAGAGCATGGAGGG + Intergenic
1174619689 20:51864604-51864626 CCTTCCAGGTAGAGCCTGGGTGG - Intergenic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1177894971 21:26846427-26846449 CCTGGTAGGAAGAGGAAGGAGGG - Intergenic
1179199604 21:39204189-39204211 CCACCTAGGAAGGGGATGGAAGG + Intronic
1179639210 21:42736158-42736180 CTTTCCGGGAAGAGCATGGGGGG - Intronic
1180059059 21:45375424-45375446 CCTTCCATGAGGAAGATCGAGGG - Intergenic
1180082683 21:45493928-45493950 GCCCCCAGGAAGAGGCTGGAGGG - Intronic
1183289474 22:36990819-36990841 TCTTCTAGGAAGAGCATGTAGGG + Intergenic
1183600964 22:38840450-38840472 GCTGCCTGGAGGAGGATGGAGGG + Intronic
1183948683 22:41340716-41340738 CCTGCCAGGCAGAGGAAGCAGGG + Intronic
1184021944 22:41826808-41826830 CCTCCCAAGCAGAGGAGGGAAGG + Intergenic
1184249839 22:43253771-43253793 CTTCCCAGGAAGAGGATGGGTGG - Intronic
1184387706 22:44185824-44185846 CCTTCCGGGAAGTGGGTGGCAGG - Exonic
1184641972 22:45877649-45877671 TCGTCCAGGAAGAGGATGGAAGG + Intergenic
1185004491 22:48267774-48267796 CGTTCTAGGAAAAGGATGGCAGG - Intergenic
1185022795 22:48389868-48389890 CCTTCCATGATGAGGAGAGAGGG - Intergenic
949715208 3:6922008-6922030 TCTTCCAGGAACAGGTTGGAGGG + Intronic
949933758 3:9100916-9100938 AATTCCAGGAGGACGATGGAAGG + Intronic
950590991 3:13935650-13935672 CCTGCCAGGAAGAGGAGGGGAGG + Intergenic
950790877 3:15470795-15470817 CTTTCATGGAAGAGGAGGGAAGG + Intronic
951579474 3:24146768-24146790 ATTTACAGGAATAGGATGGATGG + Exonic
951845724 3:27082161-27082183 TCTTCCAGGATGAGGACAGAGGG - Intergenic
952848161 3:37705979-37706001 CCCACCAGGAAGAGAATGAATGG - Intronic
953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG + Intergenic
954391426 3:50269904-50269926 CCCCCCAGGAAGAGGAAGGCAGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
956075794 3:65503902-65503924 GCTTCCAGGAAAAGGATACATGG - Intronic
958777679 3:98505469-98505491 CCTTCCAGGAATGGGATTGAGGG + Intronic
963262867 3:143210524-143210546 CCTTCCAGGAAGAACAAGGATGG + Intergenic
964203228 3:154141263-154141285 CCTTTCAAAAATAGGATGGAAGG - Intronic
964490397 3:157229677-157229699 CTTTCCTGGAAGTGGATGGTAGG + Intergenic
964725858 3:159814021-159814043 CCCTCCTGGAAGCGGGTGGAGGG - Intronic
967116082 3:186340159-186340181 TCTTCGAGGAAGAGGATGGGAGG + Intronic
968434522 4:577507-577529 CCTCTCAGGAAGAGGCTGGAGGG - Intergenic
969910575 4:10441613-10441635 CCTTCCAGGTAGAGCACAGATGG - Exonic
972766902 4:42159634-42159656 CATTCCAAAGAGAGGATGGAGGG - Intergenic
974640717 4:64626270-64626292 TCTTCAAGACAGAGGATGGAGGG + Intergenic
976077557 4:81316777-81316799 CCTTTCAGGATGAGTATGAAGGG + Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982007121 4:151074318-151074340 CATAGCAGGAAGAGGAGGGAAGG + Intergenic
982096768 4:151930542-151930564 CCTAACAGGAAGGGGAAGGAAGG - Intergenic
983803813 4:171968472-171968494 CCTTACAGGAAGAGGAAGAAAGG - Intronic
985278994 4:188268793-188268815 ACTTGGAGGAAGAGGATGGAAGG + Intergenic
985635728 5:1034864-1034886 CCCTCCAGCAAGAGGAAGGAGGG + Exonic
988455229 5:31381634-31381656 CCATCCAGGCAGAGGAGGGATGG - Intergenic
996421530 5:123268055-123268077 TCTTCCTGGAAAAGGATGGATGG - Intergenic
996682240 5:126240022-126240044 AGTGCCAGGAAGAGGTTGGATGG + Intergenic
996946354 5:129074100-129074122 CTTTCCAGGAATATCATGGAAGG + Intergenic
997660536 5:135586196-135586218 CCTCCCAGGAGGAGGGTGGGGGG + Intergenic
1001197554 5:169687007-169687029 TCTTCCTGGGTGAGGATGGATGG + Intronic
1001695470 5:173666930-173666952 CCTTCCAGGCGTAGGATAGATGG - Intergenic
1002059667 5:176619120-176619142 TCTTCCAGCTAGAGGCTGGAGGG + Intergenic
1003395954 6:5752112-5752134 TCTTCCTGGAAGAGGAGGGTAGG - Intronic
1003992515 6:11499896-11499918 CCTTCAAGGAGGTGGAGGGATGG - Intergenic
1004039423 6:11961077-11961099 CATTCCAGGCAGAGGGTGCAGGG - Intergenic
1004971314 6:20913657-20913679 ACCTCCTGGAAGAAGATGGATGG - Intronic
1005115059 6:22327012-22327034 CCTCACAGGAGGTGGATGGAAGG - Intergenic
1005281266 6:24277224-24277246 GGTTCCAGGAAGAGGACTGATGG - Intronic
1006378221 6:33683509-33683531 ACTTCCAGGAAGGGGCTGGTTGG + Intronic
1007251738 6:40500015-40500037 CCTGCCACGGAGAGGATGGGAGG - Intronic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1008526150 6:52408977-52408999 CCTTCAAGGAAGAGGATGTGTGG + Intergenic
1012349225 6:98230972-98230994 CCTTCTAGGAAGTGGATTAAGGG - Intergenic
1013695039 6:112692112-112692134 GCTTCCATGAAGAGAATGGATGG + Intergenic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1015400705 6:132785208-132785230 CCTTCCCCTAAGGGGATGGAGGG + Intronic
1016004932 6:139079663-139079685 CCTTCCAGGAAGCAGATCTAGGG - Intergenic
1018321350 6:162612685-162612707 TCTTCCAGGATGATGATGAAAGG + Intronic
1018552296 6:165011628-165011650 GTTTCCAGGAATAGGGTGGAAGG - Intergenic
1019764119 7:2837098-2837120 TCTTCCAGGCAGAGAATGGGAGG - Intronic
1021263574 7:18490710-18490732 CCTCCAAGGAATAGGATGGAGGG - Intronic
1021927006 7:25543531-25543553 CTTTGCAGGAGGAAGATGGAAGG - Intergenic
1022037248 7:26546130-26546152 CCTTTCAGCCAGAAGATGGAAGG - Intergenic
1023411791 7:39895131-39895153 ACTTCCAGGGAAAGAATGGAGGG - Intergenic
1023473848 7:40555218-40555240 ACTTCCAGGAAATGGATGGGAGG + Intronic
1023803325 7:43853606-43853628 CCTTCTAGGTAGAGGAAGGTTGG - Intergenic
1024215659 7:47246162-47246184 CCTACCAAGGAGAGGAGGGATGG + Intergenic
1024257058 7:47547144-47547166 CCCTCCAGGGTGAGGAGGGAGGG + Intronic
1024324972 7:48102288-48102310 CCTGCCTGGAGCAGGATGGAAGG + Intronic
1025234281 7:57223372-57223394 CATTCTATGAAGAGCATGGAGGG - Intergenic
1027229601 7:76264559-76264581 ACTTCCAGGAGGAGGAAGGCCGG + Intronic
1027923705 7:84432536-84432558 ACTACCAGAAAGAGGAGGGAGGG - Intronic
1029404467 7:100366435-100366457 CCTCCCAGGAGGGGGCTGGATGG + Intronic
1030674211 7:112367708-112367730 CCTTCCAAGAAGAGGAAGAGAGG - Intergenic
1031077468 7:117226696-117226718 CCTTGCAGGTATGGGATGGAAGG + Intronic
1034073010 7:148205940-148205962 CTTACCAGGAAGAGAAGGGAAGG - Intronic
1034083626 7:148303262-148303284 TCTTCCAGGTAGAGAATGCAAGG + Intronic
1036383315 8:8254448-8254470 CCGCCCAGGAAGAAGATGGAAGG - Intergenic
1036664660 8:10730659-10730681 CCTGCCGGGAGGAGGACGGAGGG + Intronic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038034264 8:23673915-23673937 CATTCCAGGAAGAGGAGGCTTGG + Intergenic
1038466769 8:27772046-27772068 CCTTTCAGGAAGGGGTTGTAGGG - Intronic
1041715366 8:60927248-60927270 CCTTCCAGGAATGGGGAGGAGGG - Intergenic
1043214171 8:77564575-77564597 CCTTCCAGAAGGTGGAAGGAGGG + Intergenic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1045243300 8:100421400-100421422 CCCTACAGGAGGAGGATGAAGGG + Intergenic
1046321186 8:112578412-112578434 CCTTAATGGAAGAGGATGAAGGG + Intronic
1046468924 8:114642794-114642816 CCTGCGAGGCAGAGGTTGGAGGG - Intergenic
1047928104 8:129700856-129700878 CCTCCCAGGAAAAGAATGGGAGG - Intergenic
1048215724 8:132492885-132492907 CCCTCTAGGAAGATGATGGGGGG + Intergenic
1048375324 8:133818064-133818086 CTTTCCAGGAAGAGGAAACAGGG - Intergenic
1048791954 8:138112459-138112481 TTTTCCAGATAGAGGATGGAGGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049473052 8:142784735-142784757 CCTTCCAGGGTGGGGACGGACGG + Intergenic
1049625113 8:143616367-143616389 GCTTCCAGGAAGAGATGGGAGGG + Intronic
1050027883 9:1354665-1354687 AGTCCCAGGAAGAGGAAGGAGGG - Intergenic
1052891262 9:33702339-33702361 CCGTCTAGGAAGGAGATGGATGG + Intergenic
1053525343 9:38824601-38824623 ACTTCCAGGGAAAGGTTGGATGG - Intergenic
1054152975 9:61620096-61620118 CCTTGCAGCACGAGGGTGGAGGG + Intergenic
1054197573 9:62049029-62049051 ACTTCCAGGGAAAGGTTGGATGG - Intergenic
1054640837 9:67539673-67539695 ACTTCCAGGGAAAGGTTGGATGG + Intergenic
1054982536 9:71223160-71223182 CCTTCCCTCAAGAGGAAGGAAGG - Intronic
1055565044 9:77559797-77559819 CCTCCAAAGAAAAGGATGGAAGG - Intronic
1056134988 9:83622929-83622951 ACTTCCGGGAAGAGGAAAGAGGG + Intergenic
1057801903 9:98195914-98195936 CCCTCCAGAAAGAGCAGGGAAGG + Intergenic
1058465930 9:105227404-105227426 CCTTCCTGGAAAAAGATGAATGG - Intergenic
1059427490 9:114230333-114230355 CCTTCCTTGCAGAGGAAGGAAGG + Intronic
1060401665 9:123353246-123353268 CTTTCCAGGAAGCAGATGGAAGG + Intergenic
1060771831 9:126337595-126337617 CCTTCCAGGAATGGGACGGCTGG - Intronic
1061043738 9:128153484-128153506 CCTTCGAGGAAGGGGAGGGGCGG + Intergenic
1061393716 9:130331985-130332007 CCTTCCAGGAGAAGGGTGGGTGG - Intronic
1061973244 9:134055836-134055858 CCTCCAAGCATGAGGATGGACGG + Intronic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062186858 9:135222946-135222968 GCTTCCAATAAGCGGATGGATGG - Intergenic
1062220608 9:135413239-135413261 CCTTCTCGGAAGAGGAGGGGAGG - Intergenic
1186240341 X:7558734-7558756 CTTTCAAGGAAGAGCAGGGAGGG - Intergenic
1187011992 X:15289018-15289040 CTTGCCAGGAAGATGCTGGACGG - Intronic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189215235 X:39317363-39317385 CCTTCCAAGAGGTGGAGGGAAGG - Intergenic
1195546462 X:106117430-106117452 CCATCAAGGGACAGGATGGATGG - Intergenic
1195583090 X:106531142-106531164 CCCACTAGGAAAAGGATGGAAGG + Intergenic
1198314401 X:135451797-135451819 CCTCCCAGGAAGAGGATCAGAGG + Intergenic
1198957263 X:142146748-142146770 CCTACCAGGATGAGCATGGCTGG - Intergenic
1199973225 X:152875925-152875947 CCATCAAGGAAGAATATGGAAGG - Intergenic
1201038075 Y:9803029-9803051 CCTTCCAGGCCTAGGATGAAGGG + Intergenic
1202392715 Y:24387876-24387898 CCTTCCAGACAGAGACTGGAGGG + Intergenic
1202585599 Y:26422708-26422730 CCTTCCAGTAAGAGCCAGGAAGG + Intergenic