ID: 1118602212

View in Genome Browser
Species Human (GRCh38)
Location 14:67478737-67478759
Sequence GACCCAGCTCCTCCTCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 356}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118602203_1118602212 8 Left 1118602203 14:67478706-67478728 CCCCACCCAGGGCCGGTGAACCC 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG 0: 1
1: 0
2: 5
3: 51
4: 356
1118602202_1118602212 14 Left 1118602202 14:67478700-67478722 CCTGGGCCCCACCCAGGGCCGGT 0: 1
1: 0
2: 1
3: 53
4: 430
Right 1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG 0: 1
1: 0
2: 5
3: 51
4: 356
1118602206_1118602212 3 Left 1118602206 14:67478711-67478733 CCCAGGGCCGGTGAACCCTCCTT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG 0: 1
1: 0
2: 5
3: 51
4: 356
1118602207_1118602212 2 Left 1118602207 14:67478712-67478734 CCAGGGCCGGTGAACCCTCCTTT 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG 0: 1
1: 0
2: 5
3: 51
4: 356
1118602204_1118602212 7 Left 1118602204 14:67478707-67478729 CCCACCCAGGGCCGGTGAACCCT 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG 0: 1
1: 0
2: 5
3: 51
4: 356
1118602208_1118602212 -4 Left 1118602208 14:67478718-67478740 CCGGTGAACCCTCCTTTAAGACC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG 0: 1
1: 0
2: 5
3: 51
4: 356
1118602205_1118602212 6 Left 1118602205 14:67478708-67478730 CCACCCAGGGCCGGTGAACCCTC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG 0: 1
1: 0
2: 5
3: 51
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118602212 Original CRISPR GACCCAGCTCCTCCTCTGTG AGG Intronic
900196774 1:1380676-1380698 GACACAGCAGCTGCTCTGTGTGG + Intergenic
900322888 1:2093755-2093777 TACACAGCACGTCCTCTGTGAGG - Intronic
900427587 1:2587547-2587569 GACTCAGCCCCTCTTCTGAGGGG + Intronic
900570452 1:3355693-3355715 GCCCCAGTTTCTCATCTGTGTGG - Intronic
900691374 1:3982536-3982558 GGCCAAGTTCCTCCTCTGTCTGG + Intergenic
900914182 1:5623140-5623162 GGACCAGCTCCTGCACTGTGGGG - Intergenic
901467905 1:9434665-9434687 GACCCAGTTCCTCCTCTTTACGG + Intergenic
901849221 1:12004836-12004858 GACCCAGTCCTTCCTCTATGTGG - Exonic
902075615 1:13782495-13782517 AACCAAGCTCCTCCTCTTTAAGG + Exonic
902510293 1:16963258-16963280 TACCCATCACCTCCTCAGTGAGG - Intronic
903034958 1:20486986-20487008 GAGCCCGCTCCTCCTCTCAGAGG - Intergenic
903192727 1:21665977-21665999 GGCCCAGCTCCAGCTCTGGGAGG - Intronic
903360972 1:22776928-22776950 GACCCAGCACCACCTCTCAGGGG + Intronic
903478719 1:23637982-23638004 CACCCAGCTCTGTCTCTGTGGGG + Intronic
904466940 1:30713896-30713918 GGCCCAGCCCCACCTCTGAGTGG + Intronic
904616275 1:31751886-31751908 GACCCAGCTACTACTTTGTTAGG + Intronic
904633822 1:31864189-31864211 GACCCTGGTGCTTCTCTGTGTGG - Intergenic
905183032 1:36178241-36178263 AAGCCAGCTTCTCCTGTGTGGGG + Intronic
905397206 1:37674372-37674394 GGCCCATTTCCTCCTCTGTCAGG - Intergenic
905687523 1:39919319-39919341 ATCCCATCTCATCCTCTGTGTGG - Intergenic
906498163 1:46320278-46320300 GACCCCGCTGCTGCTATGTGTGG + Intergenic
906511720 1:46413840-46413862 GAAACAGCTCCTCGTCTGTGTGG + Exonic
906732144 1:48091983-48092005 GACACAGCTACCCCTCTGTGGGG + Intergenic
907316957 1:53578321-53578343 GACCTAGGTCCTAGTCTGTGTGG - Intronic
907433684 1:54430289-54430311 GCCCCAGCACCTCCTGAGTGTGG + Intergenic
907552070 1:55313063-55313085 AACCCCCCTCCTCCTCTGTTGGG + Intergenic
908946068 1:69498974-69498996 GCCCCAGTTCATCCACTGTGTGG - Intergenic
911234107 1:95391403-95391425 GAACCAGCCTCTCCCCTGTGTGG + Intergenic
913292081 1:117283251-117283273 CACCCATCTTCTCCTCTGTGAGG - Intergenic
915491359 1:156251688-156251710 CTCCCAGCTCCTCCCCTGAGAGG - Intronic
915635946 1:157186619-157186641 TAGCCAGCACCTCCTCTGGGAGG + Intergenic
915648129 1:157288439-157288461 TAGCCAGCACCTCCTCTGGGAGG - Intergenic
915862567 1:159461704-159461726 GGCCCAGCTCCTCCCCTGCTGGG - Intergenic
918107967 1:181429411-181429433 GACTCAGAGCCTCCACTGTGTGG - Intronic
920171259 1:204073643-204073665 GCTCCTGCTCCTCCTCCGTGCGG - Exonic
922734140 1:227970592-227970614 GGCCCAGCTCTTCCTCTCGGCGG + Intergenic
922959947 1:229637823-229637845 GGCCCAGCTTCTGCTCTTTGAGG - Exonic
924778660 1:247128513-247128535 CATCCAGCTGCTCCTCTGAGAGG - Intronic
924782994 1:247169906-247169928 CATCCAGCTGCTCCTCTGAGAGG + Intronic
1062937717 10:1400639-1400661 GCCCGTGCTCCTCCTCTGGGTGG + Intronic
1064465464 10:15575512-15575534 GTCCAACCTCCTCCTCTTTGTGG + Exonic
1064906088 10:20347574-20347596 GACCCAGGTGCTTCCCTGTGTGG + Intergenic
1065322173 10:24520058-24520080 GCCCCTCCTCTTCCTCTGTGAGG + Intronic
1065458947 10:25935043-25935065 GACCCAGCGCCACCTGTGGGCGG - Intronic
1066663045 10:37755235-37755257 GACCCAGTTCCTGCACTGTAGGG + Intergenic
1067661136 10:48237051-48237073 GACCCAGCTATCCCCCTGTGGGG + Intronic
1068927918 10:62559175-62559197 GTGCCATCTCCTCCTCTTTGTGG + Intronic
1070373953 10:75810980-75811002 GACCCAGCTCCTCCACTTGGTGG - Intronic
1070681457 10:78452039-78452061 GACCCAGCTCCATCTCTGAGTGG + Intergenic
1070729719 10:78818152-78818174 GGCCCAGCTCCACCACTGAGTGG + Intergenic
1070832182 10:79424857-79424879 ATCCAAGCTCCTCCTCTCTGAGG + Intronic
1070959919 10:80491445-80491467 CACCCAGTTGCTCCTCTCTGTGG + Intronic
1071460599 10:85890643-85890665 GAACCAGCTCTTCCACGGTGAGG + Intronic
1071832874 10:89389826-89389848 GACCCACTTCCTGTTCTGTGAGG - Intronic
1072443060 10:95474248-95474270 GAACCAGCACCACCACTGTGTGG + Intronic
1074693889 10:116030424-116030446 GACCCAGCCCCTGCAATGTGAGG - Intergenic
1075584685 10:123649000-123649022 GAGCCAGTTGCTCCTCTGTAAGG + Intergenic
1075798230 10:125135891-125135913 GACCCTGCTCCCAGTCTGTGGGG + Intronic
1076536943 10:131184779-131184801 GGCCCACAGCCTCCTCTGTGAGG - Intronic
1076919494 10:133444391-133444413 GGCCCATCTCCTCACCTGTGAGG + Intergenic
1077177977 11:1199200-1199222 GACCCTGCCCTTCCTCTTTGTGG - Intronic
1077231992 11:1461900-1461922 GAAGCAGCTCCACCTCTGGGGGG + Intronic
1078222375 11:9362637-9362659 GGCCCAGGTCCTCTTCTGTGTGG - Intergenic
1078457126 11:11484015-11484037 GACACAGCACCTACTCTGTGCGG + Intronic
1079149041 11:17881642-17881664 GTCCCAGGTCCTCCTCTTTCTGG + Intronic
1080459532 11:32441052-32441074 GAGCCAGTGCCTCCTCTGGGTGG - Intergenic
1082789275 11:57335883-57335905 TAGCCAGCTCATCCTCTCTGTGG - Intergenic
1083249232 11:61454634-61454656 GTCCCTGCTCCACCACTGTGTGG + Intronic
1083354137 11:62053133-62053155 GACCTAGCTTCTCCTGTGTTAGG + Intergenic
1083571928 11:63765687-63765709 GGCACTGCTCCTCCTCTGGGTGG - Intronic
1084148862 11:67278831-67278853 GGCCCTGCGCCTGCTCTGTGAGG - Intronic
1087401275 11:97669380-97669402 GACCCAGCTCTTCCACTCTTGGG + Intergenic
1088340722 11:108763101-108763123 CACCCAGCTTCCCCTCTGTGGGG - Intronic
1089670430 11:120053045-120053067 GACCAAGCTCCTTCCCTTTGGGG + Intergenic
1090036551 11:123254447-123254469 GACCCAGCTACTCCTGAGTCTGG - Intergenic
1090363999 11:126191285-126191307 CACACAGCTTCTCCTCGGTGTGG - Intergenic
1091631948 12:2168712-2168734 GGCCCACCTCCACCTCTCTGAGG - Intronic
1091644888 12:2265801-2265823 CACCCAGCTCTCCCTCTCTGTGG - Intronic
1091992120 12:4963920-4963942 GCCCCACCTCCTCCTCCATGTGG - Intergenic
1093971914 12:25383560-25383582 GACCCAGTTCCTCCTCTGTAAGG - Intergenic
1093996317 12:25646520-25646542 GACCCAGCTGCCCCTCTAAGGGG - Intronic
1095632882 12:44398612-44398634 GAGCCAGCTCCTCCTGTGTGGGG - Intergenic
1096154297 12:49333248-49333270 GAACCTGCTCATGCTCTGTGTGG + Intronic
1102617026 12:114163646-114163668 GACCCAGCTCCTCCTCTTCCAGG - Intergenic
1102952208 12:117038378-117038400 GAAGCAGCTCCTGCCCTGTGTGG - Intergenic
1103829525 12:123767801-123767823 GACCCAGCACTTTCTCTTTGTGG - Intronic
1103855340 12:123965026-123965048 GACCCAGCAGCTCATCCGTGGGG - Intronic
1103927204 12:124429606-124429628 GACTCACCTCCTGCTCTGAGAGG + Exonic
1106196831 13:27501351-27501373 GACCCAGCTCCTAATCTGCAGGG + Intergenic
1110219867 13:73060516-73060538 TACCCAGCGCCTACTCCGTGGGG + Intronic
1111935120 13:94549930-94549952 GACCCAGCTCCTGGACCGTGCGG - Intergenic
1111995141 13:95158256-95158278 TGCCCAGATCCTCATCTGTGTGG - Intronic
1113388529 13:109873558-109873580 CACCCTGCTCCTCTCCTGTGTGG + Intergenic
1113466652 13:110518064-110518086 GACCCCGCTTCTCCTCTGGGTGG + Intergenic
1113969672 13:114179281-114179303 GCCCCAGCTGCTCCTCTGTCTGG + Intergenic
1114596552 14:23917234-23917256 GGCCCAGCTCCTCTCCTGTCTGG - Intergenic
1114648560 14:24269149-24269171 GCACCAGCTCCAGCTCTGTGGGG + Exonic
1117714040 14:58562750-58562772 CCCCCAGCTGCTCCTCTCTGAGG - Intergenic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1118693071 14:68359024-68359046 GTGGCAGCTGCTCCTCTGTGGGG - Intronic
1118735005 14:68694917-68694939 AGCCCAGCGCCTCCTGTGTGGGG - Intronic
1119067927 14:71549371-71549393 GGGACAGCTCCTTCTCTGTGAGG - Intronic
1121448212 14:93991741-93991763 ATCCCAGCTCCTCCTCAGAGTGG - Intergenic
1122612770 14:102997095-102997117 GACACAGCCCCTCCTGTGTGGGG - Intronic
1122904736 14:104796396-104796418 GACACCGCTCCTCCTCTGTCTGG - Intergenic
1123507636 15:20960738-20960760 GATCCAGATCCTCCTTTTTGTGG + Intergenic
1123508436 15:20970106-20970128 GACCAAGATCCTCCTCTTTGTGG - Intergenic
1123564858 15:21534481-21534503 GATCCAGATCCTCCTTTTTGTGG + Intergenic
1123565658 15:21543855-21543877 GACCAAGATCCTCCTCTTTGTGG - Intergenic
1123601116 15:21971772-21971794 GATCCAGATCCTCCTTTTTGTGG + Intergenic
1123601921 15:21981142-21981164 GACCAAGATCCTCCTCTTTGTGG - Intergenic
1123697598 15:22890482-22890504 GACCGGGCCTCTCCTCTGTGGGG - Intronic
1124604766 15:31161925-31161947 GACCCACCACCTCCTCTGGGAGG + Intergenic
1125554798 15:40575178-40575200 GACCCAGCAATTCCACTGTGAGG - Intergenic
1128075154 15:64821226-64821248 GATCCAGCTCATCATCTGTGGGG - Exonic
1128455599 15:67829738-67829760 CCCCCAACCCCTCCTCTGTGAGG - Intronic
1128576370 15:68778023-68778045 GACCCACCTCACCCTCTGGGTGG - Intergenic
1128676853 15:69615971-69615993 CACCCAGCTCCTCCTAGGTCTGG - Intergenic
1129193877 15:73952976-73952998 GACCCACCTGCTTCCCTGTGGGG + Intergenic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1129266415 15:74395801-74395823 GACTCAGCTCTGCCTCTGTGAGG - Intergenic
1129769626 15:78194712-78194734 TCCACAGCGCCTCCTCTGTGGGG + Exonic
1130144504 15:81263630-81263652 CACCCAGCTCCACTTGTGTGGGG - Intronic
1130293366 15:82624246-82624268 TACCCAGCCCCTCCCATGTGTGG - Intronic
1130460420 15:84155572-84155594 GTCCCAGCTCCAGCTCTGGGAGG - Intergenic
1130620126 15:85453582-85453604 GATCCTGCTCCTCCTCACTGGGG - Intronic
1131664341 15:94554700-94554722 GACCCTTCTCCTCCCCTGTGGGG + Intergenic
1132386993 15:101407740-101407762 GAACCCGCTGCTTCTCTGTGTGG + Intronic
1132393836 15:101458027-101458049 GACCCAGCTCCACCTCTGGAGGG - Intronic
1132409612 15:101566977-101566999 GGTCCAGCTCCTCCAGTGTGGGG - Intergenic
1202973224 15_KI270727v1_random:261591-261613 GATCCAGATCCTCCTTTTTGTGG + Intergenic
1202974029 15_KI270727v1_random:270948-270970 GACCAAGATCCTCCTCTTTGTGG - Intergenic
1132533809 16:467415-467437 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533823 16:467459-467481 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533852 16:467547-467569 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533867 16:467591-467613 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533882 16:467635-467657 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533934 16:467789-467811 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533949 16:467833-467855 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533956 16:467855-467877 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132540431 16:505907-505929 CAGTCAGTTCCTCCTCTGTGTGG - Intronic
1132696063 16:1202470-1202492 GTCCCACCGCCTCCTCCGTGGGG - Intronic
1132744265 16:1430247-1430269 GCCCCAGCTGGTCCACTGTGGGG - Intergenic
1132973912 16:2702129-2702151 GGGCGAGCTCTTCCTCTGTGAGG - Intronic
1133071487 16:3249526-3249548 GGTCCAGCTGCTCTTCTGTGAGG - Exonic
1134367841 16:13595736-13595758 GACCCAACTTCACCGCTGTGGGG + Intergenic
1135633058 16:24051174-24051196 GACCCTGCTGCTTCCCTGTGTGG - Intronic
1137406363 16:48192597-48192619 CGCCCTGCTCCTCATCTGTGTGG - Exonic
1137878537 16:52021569-52021591 GAGCCAGCTCCTACTCTCTCTGG - Intronic
1138549721 16:57740758-57740780 GCACAGGCTCCTCCTCTGTGTGG + Intronic
1139253668 16:65520589-65520611 GCACGGGCTCCTCCTCTGTGGGG + Intergenic
1141388351 16:83643899-83643921 TACCCAGCTCTTCCTCTAAGTGG + Intronic
1142801423 17:2348384-2348406 GAACCCGCTCCTCCTTTTTGTGG - Intronic
1143213976 17:5210321-5210343 CACCCACCTCCTGCACTGTGAGG - Exonic
1143287430 17:5800723-5800745 CAGACAGCTCCTCCACTGTGTGG - Intronic
1143538677 17:7557212-7557234 GCCCCAGCTCCGCCTCTGCCAGG + Exonic
1143636144 17:8164584-8164606 GACGCGGCTGCTCCTCTGAGGGG - Intergenic
1143706393 17:8700559-8700581 GACACAGCTCCTCTTCTGGAAGG - Intergenic
1143733532 17:8894717-8894739 TCCCCAGCCCCTGCTCTGTGAGG - Intronic
1143764763 17:9130285-9130307 GTCCCTGCTCCTCCGCTGTCAGG + Intronic
1144667504 17:17112008-17112030 TACCCAACACCTGCTCTGTGGGG - Intronic
1146536099 17:33653535-33653557 GACCTAGCTTCTGTTCTGTGAGG - Intronic
1146575925 17:33991497-33991519 GGCCCAGCACCTCCTCTGCATGG + Intronic
1146674578 17:34764473-34764495 GAGCCAGCGCTTCCTCAGTGTGG + Intergenic
1147140069 17:38455700-38455722 GCCCCTGCTCCTCCCCAGTGTGG - Intronic
1148347868 17:46915719-46915741 GACCCACCTCTTGATCTGTGTGG + Intergenic
1148716168 17:49717665-49717687 GCCCCAGCTCCTCCCCAGAGTGG - Exonic
1152162555 17:78677914-78677936 GGACCAGCTCCACCTCTGTGGGG + Intronic
1152445167 17:80338272-80338294 GACCAACCTCCTTCTCAGTGCGG - Intronic
1152565323 17:81097748-81097770 GAGCCAGCTTCTCCTCTGCCAGG - Intronic
1152631944 17:81414387-81414409 GCCCGAGCTCCGCCTCTGTGGGG - Intronic
1152892391 17:82890027-82890049 GAGCCAGCTCCTGCTCTGTGTGG - Intronic
1153160125 18:2195162-2195184 GAGGTAGCTCCACCTCTGTGAGG - Intergenic
1153216516 18:2825827-2825849 GCCCAAGCTGCTCCTCTGTGTGG - Intergenic
1153960809 18:10138523-10138545 GATCCTCCTCCTCCTCTGGGAGG + Intergenic
1154016173 18:10619899-10619921 GACCGAGCTCCTCCTCACAGGGG - Intergenic
1154189341 18:12215750-12215772 GACCGAGCTCCTCCTCACAGGGG + Intergenic
1157606981 18:48932006-48932028 GCCCCATCTCCTGCTCAGTGGGG - Intronic
1159881165 18:73859735-73859757 GCCCCACCTCCTCCACTATGAGG + Intergenic
1160266324 18:77342950-77342972 GAACCAGCACCTGCCCTGTGAGG + Intergenic
1160266335 18:77342993-77343015 GAACCAGCACCAGCTCTGTGAGG + Intergenic
1160535849 18:79590974-79590996 GTCCCAGCTGCTCCTCAGCGTGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160837929 19:1133249-1133271 GCCACGGCTCCTCCTCTGTGAGG + Intronic
1160974644 19:1786884-1786906 CATCCAGCTCCTCCTGTGTGTGG - Intronic
1161073213 19:2272612-2272634 GGCCCAGATCGTCCTCTGGGTGG - Intronic
1161487425 19:4543633-4543655 GGCCCACCTCCTCCCCTATGGGG - Exonic
1161591486 19:5131179-5131201 GCCACAGCGCCTCCTCTGAGGGG - Exonic
1161706444 19:5824333-5824355 GTGTAAGCTCCTCCTCTGTGTGG + Exonic
1162130839 19:8525464-8525486 GACGCAGCTCCTCACCTCTGGGG + Exonic
1162164597 19:8743712-8743734 GACCCAGCTCCTCCACTTTCTGG + Intergenic
1162165669 19:8751180-8751202 GACCCAGCTCCTCCACTTTCTGG + Intergenic
1162166734 19:8758636-8758658 GACCCAGCTCCTCCACTTTCTGG + Intergenic
1162167800 19:8766092-8766114 GACCCAGCTCCTCCACTTTCTGG + Intergenic
1162168739 19:8772390-8772412 GACCCAGCTCCTCCACTTTCTGG + Intergenic
1162170485 19:8785154-8785176 GACCCAGCTCCTCCACTTTCTGG + Intergenic
1162328151 19:10010675-10010697 GACCCTTCTCCTCCACAGTGGGG - Intergenic
1162520352 19:11175898-11175920 GTACCAGCTCCCGCTCTGTGAGG + Exonic
1162592198 19:11599224-11599246 CACCCAGCTCCTCCACTAAGAGG - Intronic
1163186017 19:15640318-15640340 GACCCAGGTAATCCTCAGTGGGG + Intronic
1163510825 19:17734020-17734042 GACGGAGCTCCTCCTCTGCAAGG - Intronic
1163514990 19:17757380-17757402 GACCCAGATGCTGCTCTGGGCGG + Intronic
1164054820 19:21613832-21613854 CATCCAGCTGCTCCTCTGAGAGG + Intergenic
1164208435 19:23076614-23076636 CACCCAGTTGCTCCTCTGAGAGG - Intronic
1164769855 19:30800240-30800262 AACCTAGCTCCTCCGATGTGAGG + Intergenic
1165035506 19:33030849-33030871 GACCGAGCCCCTACTCTGTGGGG - Intronic
1165195545 19:34099913-34099935 GACCCAGCTCCTCTTCCAAGAGG + Intergenic
1165326309 19:35116352-35116374 GCCCCAGCTGCTCACCTGTGTGG - Exonic
1165832960 19:38738236-38738258 GTCCCAGCTCTGCCTCTGGGAGG - Intronic
1167415164 19:49366276-49366298 GACCCTCTTACTCCTCTGTGTGG + Intronic
1167596909 19:50432716-50432738 GCCCCAGCCCCTCCTCCCTGGGG + Intergenic
925805990 2:7648710-7648732 CACCCATGTCCCCCTCTGTGGGG + Intergenic
926050115 2:9739413-9739435 GACCCAGCTCATCCTGTTTCCGG + Intergenic
926216444 2:10908499-10908521 GACACAAATCCTGCTCTGTGAGG - Intergenic
926296627 2:11573647-11573669 GACCCAGCTGCTCTTCTGTGAGG - Intronic
926395709 2:12440288-12440310 GATGCAGCCTCTCCTCTGTGTGG - Intergenic
927290242 2:21397893-21397915 GATCCAGGCCCTCCTCTCTGAGG - Intergenic
927640263 2:24841411-24841433 GCTCCAGCCCCTCCTCAGTGAGG + Intronic
927883750 2:26706294-26706316 TCTCCAGCTCCTCCTCTGGGGGG - Intronic
928196176 2:29218245-29218267 GGCCCCGCTTTTCCTCTGTGTGG - Intronic
929928269 2:46232862-46232884 GCACCAGCTCCTCCTCAGTCAGG + Intergenic
930774584 2:55159422-55159444 GAGCCACCTCTTCCTCTCTGAGG - Intergenic
932139704 2:69264465-69264487 GACCCAGATCCTCATCCCTGTGG - Intergenic
933658354 2:84906756-84906778 GACCCACCTCCTCCCCTTTGCGG - Intronic
934204059 2:89910663-89910685 GCCCCAGCTCCTGCTCTGCCTGG + Intergenic
936164100 2:110105229-110105251 GGCCCAGCCCCTACTCTGGGAGG - Intronic
936270330 2:111043974-111043996 GAGCCTGCCCCTCCTATGTGGGG + Intronic
936480329 2:112879706-112879728 GAGCCAGATCAGCCTCTGTGAGG - Intergenic
936574526 2:113642118-113642140 GCCCCAGCCCCTCAGCTGTGGGG - Exonic
936942863 2:117903588-117903610 GACCAAGTTCCTGCTCAGTGGGG - Intergenic
938194062 2:129310493-129310515 CACCCGGTTCCTCCTCTTTGCGG - Intergenic
943653182 2:190478983-190479005 TACCCAGCCCTTCCTCTTTGGGG + Intronic
945060964 2:205908576-205908598 GAGCCAGCTACCCCTCTGTTAGG + Intergenic
946089473 2:217207977-217207999 GACTCAGCTGCTTCTGTGTGCGG + Intergenic
946133889 2:217629514-217629536 AGCCCAGCTCCTGCTCTGTGGGG - Intronic
946464853 2:219902799-219902821 CCCCTAGCTCCTCCCCTGTGGGG - Intergenic
946788459 2:223273699-223273721 GCCCCAGCTGCTGCCCTGTGGGG - Intergenic
948199369 2:236119053-236119075 GACCCTGCTACACATCTGTGGGG - Intronic
949027525 2:241773554-241773576 GCCCCAGCTCCTTGCCTGTGGGG - Intergenic
1168969157 20:1918990-1919012 GTCCCAACTCCTGGTCTGTGAGG - Intronic
1168980780 20:2002077-2002099 GACCCAGTTCCTGCCCTCTGGGG + Intergenic
1169544803 20:6639304-6639326 GACAGAGCTCCTTCTCTTTGGGG - Intergenic
1172183172 20:33015923-33015945 GACAAAGCCCCTCCTCCGTGGGG + Intronic
1173085967 20:39918054-39918076 GACCCAACCACTCCTCTGAGGGG + Intergenic
1173907898 20:46642092-46642114 GACCCTGCTGCTCCCCTGTGTGG + Intronic
1174264386 20:49320656-49320678 GACCCAGCTCCTCCACTGGCTGG - Intergenic
1174867065 20:54147781-54147803 ATCCCAGCTCCTCTGCTGTGTGG - Intergenic
1175920139 20:62446782-62446804 GACTCAGCCCTTCATCTGTGGGG + Intergenic
1176083804 20:63286787-63286809 GCGCCAGCTCCTCCTACGTGGGG - Intronic
1176084000 20:63287716-63287738 GTCCGAGCTCCTCCTCTCGGTGG - Exonic
1176211785 20:63927416-63927438 ATCCCAGCTACTCCTGTGTGAGG + Intronic
1177450563 21:21259540-21259562 GAACCAGCTCATCCTCTGGTAGG - Intronic
1178790290 21:35693413-35693435 GGCCGAGCCTCTCCTCTGTGGGG - Intronic
1179970562 21:44834945-44834967 GACCCAGCAGGTCCTCGGTGGGG + Intergenic
1180141792 21:45897697-45897719 GCCCCAGCAGCTCCTGTGTGTGG + Intronic
1180645134 22:17332601-17332623 CACCCAGTCCCGCCTCTGTGGGG - Intergenic
1180698585 22:17769702-17769724 GACCCAGCTGCCTCTGTGTGTGG - Intronic
1180743371 22:18069420-18069442 CACCCAGCACCTTCTCTTTGAGG + Intergenic
1182359363 22:29737749-29737771 GTCCCTGGTCCTCCTCTTTGAGG - Intronic
1182666577 22:31964579-31964601 GATTCAGCTCCTCCTGTGTATGG + Intergenic
1183225900 22:36549655-36549677 GCCCCAGCTCTGCCCCTGTGTGG + Intergenic
1183317303 22:37143725-37143747 TACCCACCTCCTCCTCTGGCAGG - Intronic
1183652923 22:39169311-39169333 GACCCACCTCCACCTCTATGTGG + Intergenic
1183787500 22:40038655-40038677 GCCCCTCCTCCTCCTCTGAGGGG - Exonic
1184060523 22:42078563-42078585 GACCCAGCTCTTCCTGAGAGGGG + Exonic
1185059467 22:48598749-48598771 GACCGAGCCCTTCCTCGGTGGGG - Intronic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
1185425644 22:50768765-50768787 GCCCCAGCCCCTCAGCTGTGGGG + Exonic
949573430 3:5315284-5315306 GGCCCAACTCCTCTTCTGGGAGG + Intergenic
950262576 3:11553566-11553588 CACCGAGCTCATCCTCAGTGCGG - Intronic
952780794 3:37095757-37095779 GTCCCAGCTACTCCTCAGTCTGG - Intronic
953764863 3:45731019-45731041 GACCCAGCCCCTCCTCAGAGTGG - Intronic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
954440083 3:50516963-50516985 GAGCCAGCTCAGCCTCTGTGGGG + Intergenic
954674419 3:52307889-52307911 GGCCCTGCTCCGTCTCTGTGTGG + Intergenic
954879452 3:53823666-53823688 GGCCCCGCTGCACCTCTGTGTGG + Exonic
955529350 3:59857094-59857116 GACACAGCACTTCCTCTGAGGGG + Intronic
961032888 3:123622048-123622070 GACCCAGCTCTTCCCATGGGAGG + Intronic
961522039 3:127472602-127472624 AGCCCAGCTCTTCCTCAGTGGGG - Intergenic
962743248 3:138378517-138378539 GTCCCTGCTTCTCCACTGTGGGG + Intronic
963615339 3:147529691-147529713 GACCCAGCTACCCCTCTGCAGGG + Intergenic
964479758 3:157129324-157129346 GACTCTACTCCTCATCTGTGTGG + Intergenic
964812212 3:160677820-160677842 GGGCCAGCCCCTCCCCTGTGAGG - Exonic
965897968 3:173601126-173601148 GACGAAGCTCGTCCTATGTGTGG + Intronic
967115090 3:186330072-186330094 CACCCAGTTCCTCCTCTATAGGG - Intronic
967174499 3:186851098-186851120 GACAAACCTACTCCTCTGTGAGG - Intronic
967668691 3:192205974-192205996 GACACAGCTCCTTCTCTGAGAGG + Intronic
967892547 3:194373207-194373229 GACCCAGCCTCCCCTCGGTGGGG + Intergenic
968800935 4:2742908-2742930 TACTCTGCACCTCCTCTGTGGGG + Intronic
968882558 4:3309001-3309023 GTCCCAGCTCCTCCCCTGCCCGG - Intronic
968882646 4:3309372-3309394 GTCCCAGCTCCTCCCCTGCACGG - Intronic
968882662 4:3309425-3309447 GTCCCAGCTCCTCCCCTGCACGG - Intronic
968882737 4:3309691-3309713 GTCCCAGCTCCTCCCCTGCACGG - Intronic
968882787 4:3309900-3309922 GTCCCAGCTCCTCCCCTGCACGG - Intronic
968882803 4:3309953-3309975 GTCCCAGCTCCTCCCCTGCACGG - Intronic
970501684 4:16683840-16683862 GACCCAGCTCTTCCTTCCTGTGG + Intronic
971198342 4:24490420-24490442 GACCCAGCTACCTTTCTGTGAGG + Intergenic
977937809 4:102826919-102826941 GCCCCGGCTCCTCCTCTGCTGGG - Intronic
979259303 4:118633492-118633514 GGCCCAGCTCTTCCTCTCGGCGG + Intergenic
979329045 4:119407071-119407093 GGCCCAGCTCTTCCTCTCGGCGG - Intergenic
981761725 4:148202206-148202228 GCCCCAGCACCACCTCTCTGTGG - Intronic
982065692 4:151652686-151652708 GTCCATGCCCCTCCTCTGTGAGG - Intronic
982066005 4:151654968-151654990 TACCCTGTTCCTCCCCTGTGTGG + Intronic
984709568 4:182873880-182873902 GCCCCATCTCCTCCACGGTGAGG - Intergenic
985111740 4:186553954-186553976 GCCCCAGTTTCTCCTCTGTAAGG + Intronic
985693499 5:1326651-1326673 CATCCAGCTCCTCCTCTACGGGG + Intronic
985693506 5:1326680-1326702 CATCCAGCTCCTCCTCTACGGGG + Intronic
985693513 5:1326709-1326731 CATCCAGCTCCTCCTCTACGGGG + Intronic
985693567 5:1327028-1327050 CACCCAGCTCCTCCTCTACAGGG + Intronic
985693684 5:1327753-1327775 CACCCAGCTCCTCCTCTACAGGG + Intronic
987744466 5:21951979-21952001 TACCTAGCTACTCCTCTTTGTGG - Intronic
990279086 5:54230639-54230661 GGACCCTCTCCTCCTCTGTGAGG + Intronic
991764676 5:69962103-69962125 TACCTAGCTACTCCTCTTTGTGG - Intergenic
991782648 5:70156050-70156072 TACCTAGCTACTCCTCTTTGTGG + Intergenic
991843908 5:70837174-70837196 TACCTAGCTACTCCTCTTTGTGG - Intergenic
991875091 5:71156364-71156386 TACCTAGCTACTCCTCTTTGTGG + Intergenic
993049787 5:82912946-82912968 GCCCTACCTCCTGCTCTGTGAGG - Intergenic
995625392 5:114070561-114070583 GAACCAGCTCCCGCTCTGTGAGG - Intergenic
995991549 5:118246129-118246151 TACGCATCTCCTCCACTGTGAGG + Intergenic
996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG + Intergenic
996555690 5:124776929-124776951 GTCACAGCTCCTTCTCTGTCAGG + Intergenic
997415028 5:133721029-133721051 AAACCAGCTTCTCCTCTCTGTGG + Intergenic
997424144 5:133791766-133791788 TCCCCTCCTCCTCCTCTGTGAGG + Intergenic
997609991 5:135209197-135209219 GCCTCATCTCCTCCTCAGTGAGG + Intronic
998659192 5:144217130-144217152 GATCCAGCTCATTCTCTGTTTGG - Intronic
999610543 5:153364554-153364576 CAAACAGCACCTCCTCTGTGAGG - Intergenic
1000992055 5:167921476-167921498 GACCTAGATTCTCCTCTCTGTGG - Intronic
1002073356 5:176693863-176693885 GAGCCAGCTCCTTCTTGGTGCGG + Intergenic
1002160755 5:177312650-177312672 GGCCCCCCTCCTCTTCTGTGAGG + Intronic
1002317574 5:178353616-178353638 GACGCAGCTTCTCCTCTCTTAGG + Intronic
1002552145 5:180002511-180002533 GTGTCAGCTCCTTCTCTGTGGGG + Intronic
1003521110 6:6859310-6859332 TTCTCAGCTCCTCCTCTGAGTGG + Intergenic
1003831535 6:10017427-10017449 TAACCAGCTCCTCCTCAGAGGGG + Intronic
1004925804 6:20413947-20413969 GGCCAAGCTTCTCCTCTGTCTGG + Intronic
1005301835 6:24478672-24478694 CTCCCAGCTCCCCTTCTGTGGGG + Intronic
1006136014 6:31897087-31897109 GGCCTACCTCTTCCTCTGTGGGG + Intronic
1006334568 6:33413805-33413827 GAGCAAGCCCCTCCTCTATGGGG + Exonic
1007344835 6:41221761-41221783 GCCCCAGCTCCTTTTCTCTGGGG - Intergenic
1007396217 6:41579209-41579231 TGCCCAGCTCCTCCCCTTTGAGG - Intronic
1007765763 6:44158919-44158941 GACACAGCTCCTCCCCTGGGGGG - Intronic
1008213870 6:48760548-48760570 GACTCAACTCCTCCTATGTCTGG + Intergenic
1010161103 6:72856882-72856904 GACCCTGCCCCTCCCCCGTGGGG + Intronic
1011173564 6:84534573-84534595 GACCCAGTCACTACTCTGTGAGG - Intergenic
1011700710 6:89951694-89951716 GACCCAGCTCCTGAACAGTGAGG - Exonic
1013916678 6:115347645-115347667 GCTCCAGCTGCTCCTATGTGGGG - Intergenic
1015225316 6:130850831-130850853 TACCCAGCACCTCTTGTGTGGGG + Intronic
1015989534 6:138922679-138922701 GGCCCAGCTCCTTCTATGAGGGG + Intronic
1017161592 6:151370748-151370770 CAACCAGCACCTCCTCTGTGGGG - Intronic
1018891193 6:167984296-167984318 GAGCCCGCTCCCACTCTGTGGGG - Intergenic
1019213454 6:170424383-170424405 GACACAGGTCCTGCTCTGGGTGG - Intergenic
1019664995 7:2247372-2247394 GACTCAGACCCTCCTCTGTGGGG + Intronic
1020115227 7:5472458-5472480 GACCCAGCTGCCACGCTGTGAGG + Intronic
1020637948 7:10719039-10719061 GACCTTGCTCCTCTTCTGTTAGG - Intergenic
1021846768 7:24770530-24770552 GACTCAGCTCTTCACCTGTGGGG + Intergenic
1022024264 7:26431110-26431132 AACCCACCTCCTGCTGTGTGAGG + Intergenic
1023367112 7:39475183-39475205 CACCCAAATCCTCATCTGTGGGG + Intronic
1024307127 7:47938383-47938405 TACCCAGGTCCTGCTCTGGGAGG - Intronic
1024544567 7:50506241-50506263 ACCCCAGCATCTCCTCTGTGGGG - Intronic
1025004914 7:55345670-55345692 GAGCACGCTCCTCGTCTGTGGGG + Intergenic
1025053201 7:55744990-55745012 GGCCCAGCTCTTCCTCTCGGCGG - Intergenic
1026206080 7:68258669-68258691 GACCCAGCTCCTGGGCTTTGCGG - Intergenic
1029243545 7:99181969-99181991 GATCCAGCTCGTCCACTCTGGGG - Exonic
1031024162 7:116662334-116662356 GACCCAGCTCCGCATTTGCGTGG - Intergenic
1031542333 7:123009419-123009441 GCCCCATCTCCTCCCCTGGGTGG + Intergenic
1031996544 7:128235689-128235711 CAACCAGCTCCCCCTCTGGGCGG - Intergenic
1033724973 7:144105864-144105886 GACCCTGCTTCACCTCTGGGAGG + Intergenic
1034346195 7:150386755-150386777 GACTCATCTCCTCCTCGCTGGGG - Intronic
1034438423 7:151074709-151074731 GACCCAGCCCCTCTTTTCTGGGG - Exonic
1035169677 7:157010517-157010539 GTCCCGGCGCCTCCTCCGTGCGG + Exonic
1035458383 7:159024021-159024043 GACCCAGCACCCTCTCTCTGCGG + Intergenic
1036407538 8:8468503-8468525 GTCCCCTCTCCTCCTTTGTGGGG + Intergenic
1036454600 8:8895472-8895494 AGCCCATTTCCTCCTCTGTGGGG - Intergenic
1037048401 8:14338221-14338243 GACCCAGCTCCTCCTTTCTTAGG - Intronic
1037236122 8:16721322-16721344 GACCCAGTTTCTCTTCTCTGAGG - Intergenic
1040881798 8:52213418-52213440 GCCACAGCTTTTCCTCTGTGAGG + Intronic
1041260791 8:56019147-56019169 TTCCCACCCCCTCCTCTGTGGGG - Intergenic
1042018042 8:64338933-64338955 TATCCATCTCCTCCTCTGTTTGG - Intergenic
1042589504 8:70383268-70383290 GGTCCAGCTCCTCCTTGGTGAGG - Intronic
1046276432 8:111966484-111966506 CACCCAGCTCCTTACCTGTGTGG - Intergenic
1046455420 8:114453612-114453634 CACCCAGCTCCTAGTCTCTGTGG + Intergenic
1049209016 8:141376774-141376796 GACTCAGGCCCTTCTCTGTGGGG + Intergenic
1049230590 8:141479380-141479402 GACCCGGCTCCTCCCCTGGCAGG + Intergenic
1049290567 8:141799606-141799628 GCCGCAGGTCCTCCTCTGTGGGG - Intergenic
1049662013 8:143823731-143823753 GGCCCAGCTCCACCTCTGAGAGG + Intronic
1052886049 9:33649136-33649158 CTCCCTGCTCCTCTTCTGTGTGG + Intergenic
1053422338 9:37987537-37987559 GTCCCAGCTCCAGCTCTGTCCGG + Intronic
1056583821 9:87915085-87915107 GACCCAGCCTCTTCTGTGTGGGG + Intergenic
1056584313 9:87918554-87918576 GACCCAGCCTCTTCTGTGTGGGG + Intergenic
1056612556 9:88134368-88134390 GACCCAGCCTCTTCTGTGTGGGG - Intergenic
1056613048 9:88137836-88137858 GACCCAGCCTCTTCTGTGTGGGG - Intergenic
1057301931 9:93891518-93891540 CACCCACCACCTCCTCTCTGGGG - Intergenic
1057406072 9:94771801-94771823 CACCCAGCTCCTCCAATATGAGG + Intronic
1058835370 9:108855117-108855139 GGCCCAGCTCCTCCTCGGGCAGG + Exonic
1059620260 9:115997053-115997075 GACCAAGCTCCTTCTGTGCGTGG - Intergenic
1060010709 9:120040806-120040828 TAGCCAGCTCCTCCTCTCAGGGG + Intergenic
1061060227 9:128246549-128246571 TACCCAGCTTCTACTCAGTGAGG - Intronic
1061300235 9:129700284-129700306 GGTCCAGCTCTTCCTCAGTGGGG + Intronic
1061477243 9:130876295-130876317 GAAACAGTTCCTCATCTGTGTGG + Intronic
1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG + Intronic
1061901281 9:133673396-133673418 GAATCAGCTCCTCCGCTGTCTGG - Intronic
1187228071 X:17393544-17393566 GCTTCAGCTCTTCCTCTGTGAGG + Intronic
1187507433 X:19888267-19888289 GTGCCACCGCCTCCTCTGTGCGG - Intergenic
1189268088 X:39731512-39731534 CACCCAGCTCCTCCCTGGTGGGG - Intergenic
1190929033 X:54933075-54933097 GACCCAGCTCTGCTGCTGTGAGG - Exonic
1191044440 X:56120731-56120753 GCCCCACCTCCTCCCCTTTGAGG + Intergenic
1191716955 X:64200316-64200338 GACCCAGCTGCTCCTCTGTAGGG - Intronic
1192201105 X:69067310-69067332 CACCCAGCTCAACCTCAGTGGGG + Intergenic
1195747929 X:108137354-108137376 GGCCTTGCTCCTCCTCAGTGAGG + Intronic
1196506372 X:116448915-116448937 GACCCAACTCCTTCTTTTTGGGG + Intronic
1197854752 X:130902922-130902944 CACCCAGCTCCACCTCTGCAGGG - Intronic
1198206327 X:134468497-134468519 GTCCCAGCTACTGCTTTGTGAGG + Intronic
1202378832 Y:24259608-24259630 GTCCCAGCTCCAGCTCTGGGAGG + Intergenic
1202491950 Y:25410513-25410535 GTCCCAGCTCCAGCTCTGGGAGG - Intergenic