ID: 1118604445

View in Genome Browser
Species Human (GRCh38)
Location 14:67492460-67492482
Sequence ACTTTGCCAGTGAGGCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118604445_1118604454 26 Left 1118604445 14:67492460-67492482 CCTCACAGCCTCACTGGCAAAGT 0: 1
1: 1
2: 1
3: 27
4: 222
Right 1118604454 14:67492509-67492531 CACTACTGCCCATGTCCTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 95
1118604445_1118604449 -4 Left 1118604445 14:67492460-67492482 CCTCACAGCCTCACTGGCAAAGT 0: 1
1: 1
2: 1
3: 27
4: 222
Right 1118604449 14:67492479-67492501 AAGTGACCAGGATTTTATCTGGG 0: 1
1: 0
2: 1
3: 13
4: 198
1118604445_1118604448 -5 Left 1118604445 14:67492460-67492482 CCTCACAGCCTCACTGGCAAAGT 0: 1
1: 1
2: 1
3: 27
4: 222
Right 1118604448 14:67492478-67492500 AAAGTGACCAGGATTTTATCTGG 0: 1
1: 0
2: 1
3: 13
4: 210
1118604445_1118604453 25 Left 1118604445 14:67492460-67492482 CCTCACAGCCTCACTGGCAAAGT 0: 1
1: 1
2: 1
3: 27
4: 222
Right 1118604453 14:67492508-67492530 CCACTACTGCCCATGTCCTTAGG 0: 1
1: 0
2: 2
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118604445 Original CRISPR ACTTTGCCAGTGAGGCTGTG AGG (reversed) Intronic
900308713 1:2023366-2023388 ACTGTGCCAGACAGGCAGTGTGG + Intronic
900343339 1:2199039-2199061 ACCCCGCCACTGAGGCTGTGAGG - Intronic
901204787 1:7487969-7487991 GCTTTTCCTGAGAGGCTGTGTGG - Intronic
903290753 1:22312716-22312738 CCTTTTCCTGTGAGACTGTGGGG + Intergenic
905026450 1:34853385-34853407 ACGTTGCTGGTAAGGCTGTGAGG - Exonic
905058551 1:35120063-35120085 AATTTGCCCGTGAGTTTGTGGGG + Intergenic
905460716 1:38121219-38121241 ACTTTGTTAGGGAGGCAGTGGGG + Intergenic
905472780 1:38206080-38206102 TCACTGCCAGTGAGGCTGGGTGG - Intergenic
911357761 1:96843162-96843184 ACTTCAGCACTGAGGCTGTGGGG + Intergenic
912651647 1:111444963-111444985 CTTTTGCCAGTTAGGCTGTTTGG + Intronic
914941481 1:152026989-152027011 CCCTTGCCAGTCAGGCTGAGAGG + Intergenic
914963808 1:152233648-152233670 AATTTGGCAGTGAAGCTGTCTGG + Intergenic
914976450 1:152368077-152368099 AGTTTGCCTGTGAGGATGAGGGG - Intergenic
915052050 1:153085138-153085160 CCCTTGCTAGAGAGGCTGTGTGG - Intergenic
915334839 1:155135219-155135241 TCTCTGCTAGTGTGGCTGTGGGG - Intergenic
915659285 1:157388935-157388957 AACTTGCCAGTGAGACTGGGTGG - Intergenic
915977917 1:160402553-160402575 CTTTTGCAAGTGAGTCTGTGTGG + Intronic
917830598 1:178880869-178880891 ACTTAGCCAGTGAAGCCATGAGG + Intronic
918771194 1:188562534-188562556 ACCTTGTCAGTGTGGGTGTGAGG - Intergenic
920783536 1:209018672-209018694 AATGTGCTAGTGAGGCTGTGAGG - Intergenic
921544588 1:216459407-216459429 ACTTTGAAAGTGAGGATGTGGGG + Intergenic
922424182 1:225478486-225478508 GCTTTCCCAGGGAGGCTGAGAGG + Intergenic
923422348 1:233829200-233829222 AATTTGCCAGTGAAGCTATCAGG + Intergenic
1065960181 10:30727735-30727757 ACACTGCCAGTGAGGCCCTGAGG - Intergenic
1066366929 10:34786188-34786210 GCTTTGCCCATGAGGCTCTGTGG + Intronic
1067061196 10:43078735-43078757 GGGTGGCCAGTGAGGCTGTGGGG + Intronic
1067089642 10:43260045-43260067 ATTTTGCCAGTGAGCCTCTGGGG - Intronic
1067409651 10:46053244-46053266 ACTTTACCAGTGGGGCATTGAGG + Intergenic
1069609849 10:69765782-69765804 CCTTTGCCTGTGTGGATGTGTGG - Intergenic
1070771066 10:79082624-79082646 ACCAAGCCAGTGAGGCTGGGAGG - Intronic
1072041328 10:91609503-91609525 ACTTTGAGAGTGTGGGTGTGGGG - Intergenic
1072991422 10:100198595-100198617 ACTTTGTCAGAGAGTCTGTGAGG - Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1075157571 10:119990592-119990614 ACTCTCCCAGTGAGACTTTGGGG + Intergenic
1075658099 10:124174940-124174962 GCATTGACAGTGAGGCTGTGGGG - Intergenic
1076565444 10:131395487-131395509 TCTTTGCAAGTGAAGCAGTGAGG + Intergenic
1078092774 11:8277652-8277674 ACATTGCAAGTCAAGCTGTGTGG - Intergenic
1078993950 11:16677804-16677826 AATTTGCCAGTGAAGCTATCTGG + Intronic
1079119121 11:17667390-17667412 AATTTGCCAGTGAAGCTATCTGG - Intergenic
1079790182 11:24727664-24727686 ACTTTGCCAGTGAGACTGAATGG + Intronic
1080833125 11:35915074-35915096 ACTTTGCCAATGAGGCAGACTGG + Intergenic
1083329393 11:61890632-61890654 GCTTTGCCAGCCAGGCTGGGTGG - Intronic
1084297740 11:68224135-68224157 GCTCTGCCACTAAGGCTGTGTGG - Intergenic
1089357914 11:117867351-117867373 ACTTTGCCACAGATGCAGTGTGG - Intronic
1093206326 12:16255443-16255465 ACTTTGTTTGAGAGGCTGTGGGG + Intronic
1093696868 12:22170762-22170784 ACTCTGTTGGTGAGGCTGTGGGG + Intronic
1095262904 12:40118383-40118405 ACTTTGCCAGTGAAGTTGACTGG - Intergenic
1095359686 12:41321273-41321295 TCTGTGCCATTGAGGCAGTGTGG - Intronic
1097555338 12:61129316-61129338 AATTTGCAAGTGTGCCTGTGTGG - Intergenic
1097719129 12:63001532-63001554 ATTTTGCCTTTGAGGGTGTGTGG + Intergenic
1098569212 12:71969552-71969574 ACCTTCCCAGTAAGACTGTGAGG - Intronic
1102883288 12:116502718-116502740 AGTTTCCCAGGGAGGCAGTGAGG - Intergenic
1104295098 12:127504872-127504894 ACTTTGCCAGTGAGTGGGTTGGG - Intergenic
1104991067 12:132624181-132624203 ACTGCTCCTGTGAGGCTGTGGGG + Exonic
1106547633 13:30744296-30744318 ACTTCACCAGAGAGGCTTTGTGG + Intronic
1107718275 13:43221911-43221933 TCTATTCCAGTGAGGCTGAGAGG - Intronic
1108562221 13:51655762-51655784 ACTTTGCCAGTGAAGCCGTCTGG + Intronic
1110560907 13:76909859-76909881 ACTTTGCCACCCAGGCTGTAGGG - Intergenic
1110741215 13:78999753-78999775 TCTTTCCCAGTGATGATGTGGGG + Intergenic
1113078003 13:106487299-106487321 ACTTTACAGGTGAGGCTCTGAGG + Intergenic
1113088090 13:106588623-106588645 ACTTTGCCAGAGAGGCTGTGGGG - Intergenic
1113090493 13:106612903-106612925 ACATTGCCAGGGAGGATCTGAGG + Intergenic
1113679484 13:112233346-112233368 ACCTGGCCAGTGGGCCTGTGGGG - Intergenic
1114567608 14:23644223-23644245 ACTTTGTCTGTAAGGCTCTGAGG - Intronic
1114657776 14:24326259-24326281 TCTTTGCCAGTGGGGCTGTCTGG - Intronic
1114874921 14:26704386-26704408 ACTCTGCCAGAGAGGGTTTGGGG + Intergenic
1115367143 14:32570925-32570947 ACGGTGCCAGTGAGGCTTTCTGG + Intronic
1115445104 14:33480740-33480762 ACTTTGTCAATGTGGCAGTGAGG + Intronic
1118604445 14:67492460-67492482 ACTTTGCCAGTGAGGCTGTGAGG - Intronic
1118992201 14:70808005-70808027 CCTTTGACAGTGAGGCTGTTTGG - Intronic
1121145971 14:91582717-91582739 TCTTTGCCAGTGTGGCTGAGTGG - Intronic
1121837605 14:97106245-97106267 ACTCTGCCACTGTGGCTGGGAGG - Intergenic
1122070091 14:99200579-99200601 ACTTTGCCCATGAGGCAGCGAGG + Intronic
1122522471 14:102354725-102354747 ACTCTGCCACTGAGGCTGGATGG - Intronic
1123717219 15:23041194-23041216 ACTTGGCCAGAGGTGCTGTGGGG + Intergenic
1123717954 15:23043681-23043703 ACTTGGCCAGAGGTGCTGTGGGG + Intergenic
1123718161 15:23044387-23044409 ACTTGGCCAGAGGTGCTGTGGGG + Intergenic
1123719260 15:23048231-23048253 ACCTAGCCAGTGGTGCTGTGGGG + Intergenic
1128402387 15:67296809-67296831 ACTTTGCCAGTGAGGATAATTGG - Intronic
1130616269 15:85411050-85411072 ACTCTTTCAGTGAGTCTGTGAGG + Intronic
1132301860 15:100781098-100781120 ATTTAGCCAGTGATTCTGTGTGG + Intergenic
1132557929 16:580614-580636 CCTCTGCATGTGAGGCTGTGGGG + Intronic
1132626392 16:893654-893676 ACTTGGGCAGAGAGGCTGCGGGG + Intronic
1133281430 16:4667609-4667631 AATTTTCCAGTGAGGCTGGTGGG - Intronic
1134212825 16:12292138-12292160 ACCTTGCCAGTGAGACAGGGTGG + Intronic
1135509390 16:23069053-23069075 TCTTTGCGAGTGAGCCTGGGTGG + Exonic
1138544854 16:57711416-57711438 GCTTTGCCAGTGAGGATTCGTGG + Intronic
1141448226 16:84078062-84078084 ACTCTGTCAGTGAGGCTTTGGGG + Intronic
1141451728 16:84108026-84108048 ACTTGTCTAGTGAGTCTGTGGGG - Intronic
1141672161 16:85497858-85497880 ACCCTCCCAGGGAGGCTGTGGGG - Intergenic
1144780734 17:17807231-17807253 ACTCTGCCAGCCAGGCGGTGGGG + Intronic
1144847461 17:18227310-18227332 TCTGTGCCGGGGAGGCTGTGAGG + Intronic
1145181875 17:20760204-20760226 AATTTGCCAGTGAGGCCATCTGG + Intergenic
1145790333 17:27622669-27622691 ACTTTGCCAGGGTGGCAGGGTGG - Exonic
1145985492 17:29043183-29043205 CCTTTGCCTTTGAGGCTCTGTGG + Exonic
1146540085 17:33686353-33686375 ACTTTGCGGGTGAGGGTGTAAGG + Intronic
1146699365 17:34942372-34942394 ACTTTTTCAGAGAGTCTGTGAGG - Intronic
1147741921 17:42674863-42674885 CCTTGGCCAGGGAGGCAGTGTGG - Intronic
1148825940 17:50394297-50394319 ACTATGTCAGAGAGGCTGAGGGG + Intronic
1149841775 17:59971374-59971396 AATTTGCCAGTGAGGCCATCTGG + Intronic
1150327548 17:64268967-64268989 ACTTTGCCAATTAGCATGTGAGG + Intergenic
1150626080 17:66842040-66842062 ACTTTCCCAGTGAGGTTTAGGGG + Intronic
1151675234 17:75594220-75594242 CCTTTAGCAGTGAGGCCGTGGGG + Intergenic
1153052248 18:910175-910197 TCTTTCCCAGTGAGTCTCTGGGG + Exonic
1153429186 18:4996861-4996883 AATTTACCAGTGAAGCTATGTGG - Intergenic
1154340762 18:13500320-13500342 CCTCTGCCCGTGGGGCTGTGCGG + Intronic
1155532738 18:26783607-26783629 CCCTTGTCAGTGATGCTGTGAGG - Intergenic
1158329685 18:56347866-56347888 ACTTTGCCAGTGCCACTTTGAGG + Intergenic
1158725000 18:59963001-59963023 ACTTAGCCAGTCTGGCTGAGAGG + Intergenic
1158998573 18:62949569-62949591 AATTTTCCAGTGAGCCTGAGTGG + Intronic
1160436531 18:78856478-78856500 ACCTTGCCCGTGAGGCTTAGTGG - Intergenic
1160546102 18:79657074-79657096 GCTAGGCCAGGGAGGCTGTGAGG + Intergenic
1163627594 19:18399138-18399160 TCTGTGCCAGCCAGGCTGTGGGG + Intergenic
1167072540 19:47229086-47229108 ACTTTGACAGTTTGGATGTGTGG - Intronic
1168599186 19:57704634-57704656 TCCTTCCCTGTGAGGCTGTGAGG + Intronic
925017447 2:542075-542097 ACAGTGCTGGTGAGGCTGTGGGG + Intergenic
925625856 2:5841751-5841773 AATTTACCAGTGAGGCTCTGAGG + Intergenic
926414336 2:12634238-12634260 ACTTTGGCCCTGAGGCTTTGGGG - Intergenic
927228363 2:20793899-20793921 AATTCACCAGTGAAGCTGTGTGG - Intronic
927783654 2:25957825-25957847 CCTTGGCCTCTGAGGCTGTGTGG - Intronic
929573732 2:43039542-43039564 TCTCGGCCAGAGAGGCTGTGAGG - Intergenic
930105620 2:47637001-47637023 TCTCTGCCACTGAGGCTGTCAGG + Intergenic
935874843 2:107495064-107495086 GCTTTGGCAGGAAGGCTGTGAGG - Intergenic
937415413 2:121710695-121710717 TCTTTTCCAGTGAGGATTTGTGG + Intergenic
937598179 2:123695492-123695514 GCTTTGCCAGAGATTCTGTGTGG + Intergenic
937941680 2:127291100-127291122 AATTTGCCAGTCAGACTTTGAGG + Intronic
939189138 2:138895872-138895894 ACATTCCCAGTGAGAATGTGGGG + Intergenic
940448989 2:153814580-153814602 ACTTTGGCAATGAGGCTTTGTGG - Intergenic
940950915 2:159673358-159673380 ACTCTGTTGGTGAGGCTGTGAGG + Intergenic
941537084 2:166737646-166737668 AATTTGGCAGTGAAGCTGTCAGG + Intergenic
946278681 2:218650280-218650302 ACCCTGCCATTGAGGCTCTGGGG - Intronic
946868558 2:224065013-224065035 ACTTTGCCATTGAGGCCATTTGG + Intergenic
947296383 2:228635394-228635416 GCTTTGCCACTGTGGCTTTGTGG + Intergenic
947628066 2:231633502-231633524 GCTGAGCCAGTGAAGCTGTGAGG + Intergenic
948310225 2:236980036-236980058 ACCTATCCAGTGAGGCTGTGAGG - Intergenic
1169663894 20:8012421-8012443 TGTTTGGCAGTGAGGCTGTAAGG - Intronic
1170446649 20:16434933-16434955 ACATGCCCAGTGTGGCTGTGAGG + Intronic
1171341283 20:24431377-24431399 AGTTTGTCTGGGAGGCTGTGGGG - Intergenic
1171375436 20:24691101-24691123 TCTTTGAGAGTGAGGTTGTGAGG - Intergenic
1173942735 20:46925667-46925689 ACTCTGCTGGTGAGGCTGTGGGG + Intronic
1175159091 20:56994707-56994729 ACCTTCCCAGTGACTCTGTGAGG - Intergenic
1175373832 20:58511136-58511158 ACATGCCCAGGGAGGCTGTGTGG + Intronic
1176153023 20:63602771-63602793 ACTGTGGCAGGGAGGCTGGGAGG - Intronic
1179254316 21:39701893-39701915 CCACTGCCAGTGATGCTGTGTGG - Intergenic
1181325486 22:22042250-22042272 AAGATGCCAGTGAGGATGTGGGG + Intergenic
1181475300 22:23164371-23164393 ACTATGTCAGTCAGGGTGTGTGG - Intergenic
1181662050 22:24358654-24358676 AGTTGGAAAGTGAGGCTGTGGGG - Intronic
1181690678 22:24557808-24557830 GCTTTGCATGTGAGGCTGTGTGG + Intronic
1183842639 22:40512703-40512725 AATTAGCCAGTGAGGTTTTGTGG + Intronic
949177570 3:1084357-1084379 CCTGAGCCAGTGAGACTGTGTGG - Intergenic
949185431 3:1186481-1186503 ACTTTGCCAGTCAATCTGTAAGG - Intronic
950046602 3:9952019-9952041 ACTCTGCTGGAGAGGCTGTGGGG + Intronic
951097751 3:18651589-18651611 ATTTTGCCAGAGAGCCTATGGGG - Intergenic
952560023 3:34581064-34581086 ACTTTGGCTGTGAAGCTGAGTGG + Intergenic
953891512 3:46755054-46755076 ACCCTGCCAGTGAGGCTGTGGGG - Intronic
955731985 3:61996890-61996912 ACTTGGGGACTGAGGCTGTGGGG - Intronic
955964200 3:64371228-64371250 TCTTTGGCAATGAGGATGTGTGG + Intronic
956247731 3:67203087-67203109 AATTTGCCTGTGAAACTGTGTGG + Intergenic
956437020 3:69244113-69244135 ACTTTTACAGTCAGGCTGAGTGG + Intronic
960034134 3:113086167-113086189 TATTTGCCAGTGAGGCTGCAAGG - Intergenic
961085970 3:124067755-124067777 ACTTTTTCAGAGAGGCTCTGGGG + Intergenic
962191589 3:133316715-133316737 ACCTTGCCAGCTAGGCTGTTTGG - Intronic
962633427 3:137303017-137303039 ACTTTGCAAATGAAGCTCTGAGG + Intergenic
964412527 3:156413663-156413685 TCTTGGCCAGGGAGGCTCTGTGG - Intronic
964969234 3:162539551-162539573 AATTTGCCAGTGAGGTTTTTAGG - Intergenic
965835767 3:172850549-172850571 ATTCAGCTAGTGAGGCTGTGAGG + Intergenic
967977459 3:195043559-195043581 ACTTGGCTGGTCAGGCTGTGGGG - Intergenic
971427979 4:26534433-26534455 AGATTTCCAGTGAGGTTGTGAGG + Intergenic
971484543 4:27145981-27146003 GCTTGGCAAGTGAAGCTGTGAGG - Intergenic
972020593 4:34308673-34308695 GCTTTCCCAGTAAAGCTGTGTGG - Intergenic
973066557 4:45801917-45801939 ACACTGCCTGTGAAGCTGTGTGG - Intergenic
975282036 4:72571990-72572012 ATTTTGCCAGAGAGGATGTTAGG + Intergenic
975924082 4:79427857-79427879 AGTGAGCCAGAGAGGCTGTGTGG - Intergenic
978441073 4:108733928-108733950 GCTCTGCCTCTGAGGCTGTGGGG + Intergenic
981364359 4:143884696-143884718 ATTTTACCAGGCAGGCTGTGTGG + Intronic
981385473 4:144125187-144125209 ATTTTACCAGGCAGGCTGTGTGG + Intronic
981454532 4:144938056-144938078 TCTCTATCAGTGAGGCTGTGGGG + Intergenic
985655160 5:1127769-1127791 AGTTTACCAGTGAGTCTGTGTGG - Intergenic
986254853 5:6093907-6093929 ACTCTGCTGGAGAGGCTGTGGGG + Intergenic
988069751 5:26273161-26273183 AGTTTGCCAGTGAGGTTGGTGGG + Intergenic
990736378 5:58867862-58867884 TCTTTTCAAGTGAGGCTATGAGG + Intergenic
993330994 5:86599640-86599662 AATTTGGCAGTGAATCTGTGGGG - Intergenic
998474230 5:142407249-142407271 ACTTGCCCTGAGAGGCTGTGAGG + Intergenic
999330181 5:150668482-150668504 ACATTTACAGTGAGGCGGTGAGG - Intronic
1003634444 6:7819572-7819594 ACCTTCCCAGTGAGGCTTAGAGG - Intronic
1006069718 6:31489506-31489528 AATTTGCCTGTGAGGTTTTGTGG - Intergenic
1007631052 6:43273946-43273968 ACCTGGCCAGTGGGGATGTGTGG + Intronic
1011180906 6:84619307-84619329 ACTTTGCTAGGGGGGCTGTGAGG + Intergenic
1014598780 6:123381525-123381547 AATTTCACAGTGAGGCTCTGAGG + Intronic
1014699941 6:124672663-124672685 CCTTTGACAATGAGGCTGTGTGG + Intronic
1016064719 6:139668602-139668624 ACTTTTCCAGTGAAGCTATCTGG - Intergenic
1017187310 6:151614911-151614933 ACTTTACCAGTGAGTCTGGGAGG - Intronic
1017322415 6:153109311-153109333 ACTTTGCCAATGAGTTTATGAGG + Intronic
1017412996 6:154189238-154189260 ACTTTACCAATGAGGATGTGGGG + Intronic
1017868735 6:158468049-158468071 GCTTTGCCAGTCCAGCTGTGTGG + Intronic
1020155171 7:5717394-5717416 ACTTCGCTGGCGAGGCTGTGTGG + Intronic
1021380797 7:19963507-19963529 ACTGTGGCAGTGAGCCTGTGAGG - Intergenic
1022270256 7:28800367-28800389 AGTTGGCCAGTGTGGCTGGGTGG + Intronic
1022593365 7:31687517-31687539 ACTTTGCAAATGAGTTTGTGAGG - Intronic
1022826999 7:34025287-34025309 CATTTGCCTGAGAGGCTGTGGGG + Intronic
1022904539 7:34843092-34843114 ACTGTGCTGGGGAGGCTGTGTGG - Intronic
1023383216 7:39629228-39629250 ACACTGCTGGTGAGGCTGTGAGG - Intronic
1023549583 7:41355264-41355286 ACTATGCCAGTGAGCCTCTGTGG + Intergenic
1023921739 7:44635326-44635348 ACTTAGTAAGTGAGGTTGTGTGG + Intronic
1024198553 7:47083694-47083716 ACATTGGCAGTGGGGTTGTGGGG + Intergenic
1027451195 7:78333666-78333688 ACCTTGTCATTGAGACTGTGTGG + Intronic
1027882428 7:83857861-83857883 ACAATGCTGGTGAGGCTGTGAGG + Intergenic
1027999883 7:85480414-85480436 AATTTGGCAGTGGTGCTGTGAGG + Intergenic
1032066467 7:128775193-128775215 ACTCTGCCAGCCAGGCTGGGTGG - Intronic
1033215621 7:139491368-139491390 ACTTTTCCTGCCAGGCTGTGTGG + Intergenic
1033947314 7:146736401-146736423 ACATTGCCTGTGAGGATTTGAGG + Intronic
1034342940 7:150369531-150369553 ACTCTGCCAGGCAGGATGTGGGG + Intronic
1034410799 7:150941150-150941172 ACATTGCCAGTGAAGGAGTGGGG + Intergenic
1035563104 8:622630-622652 AATTTGCTAGTGAAGCTGTCTGG - Intronic
1036041160 8:5083325-5083347 ACATTAACAGTGAGGCTTTGAGG + Intergenic
1037403246 8:18515147-18515169 CCATTGCCAATGAGGCAGTGAGG - Intergenic
1037562638 8:20088657-20088679 ATTGTGGCAGTGAGGCTATGAGG - Intergenic
1037948084 8:23001755-23001777 AGTTTGCCAGTCAGGCAGTTGGG + Intronic
1039126126 8:34203741-34203763 ATTTTGCAAGTGATGCTGGGTGG + Intergenic
1039708698 8:40033736-40033758 TATTTGCCAGTGAGTGTGTGGGG + Intergenic
1039784641 8:40823078-40823100 ACTTTTCTAGTCAGGCAGTGTGG + Intronic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1039846465 8:41329343-41329365 ACTTTGCCAGCGACACTGAGCGG - Intergenic
1041897035 8:62937389-62937411 AGTTTCCCAGTGAGGATGTGTGG - Intronic
1043508747 8:80929452-80929474 ACACTGCGAGTGAGGATGTGAGG - Intergenic
1043517441 8:81007728-81007750 TCTCTGCCACTGAGGCTTTGAGG + Intronic
1044805250 8:96001880-96001902 AATTTGCCAGTGAAGCTATTTGG - Intergenic
1046691451 8:117290153-117290175 ACTTTGCCGGTGTGTCTGTCAGG - Intergenic
1046967802 8:120186654-120186676 ACTTTCCCAGTGCGGTAGTGTGG + Intronic
1047043078 8:121020622-121020644 ATTTTGACAGAGAGGCAGTGAGG + Intergenic
1047181281 8:122590607-122590629 ACTTTGCCAGTGTGGTACTGTGG - Intergenic
1050634938 9:7602405-7602427 ATTTTGCTAGTGAGGCATTGAGG + Intergenic
1052014124 9:23445195-23445217 ACTTAGGCAGTGAGTTTGTGAGG - Intergenic
1056329738 9:85511464-85511486 ACATCGCCTGTGGGGCTGTGTGG + Intergenic
1058417067 9:104800365-104800387 ACTTTACCAGTGAGGCAGTACGG - Intronic
1059509324 9:114829346-114829368 AATTTACCAGTCAGGCTTTGAGG + Intergenic
1060301545 9:122377211-122377233 ACTTGGCTGCTGAGGCTGTGGGG + Intronic
1060395430 9:123313168-123313190 ACTCTGCCACAGAGGCTGTGTGG + Intergenic
1060774293 9:126359504-126359526 ATTTTACCAGTGAGGCTCTCTGG + Intronic
1061927002 9:133810848-133810870 GCGTTGCCTGTGAGGTTGTGTGG - Intronic
1062275476 9:135728443-135728465 ACATCCGCAGTGAGGCTGTGGGG - Intronic
1185611573 X:1396485-1396507 CCTTTCCCAAGGAGGCTGTGTGG - Intergenic
1186122156 X:6374674-6374696 CCTTTACCAGTGAGGCCGTGAGG + Intergenic
1186664180 X:11701736-11701758 CATTTCCCAGTGAGGCAGTGAGG - Intergenic
1187819868 X:23276097-23276119 TCTGTGCCAGTGAGTCTGTCTGG - Intergenic
1189524551 X:41805980-41806002 ACTTAGGCATTGGGGCTGTGGGG - Intronic
1190380365 X:49834958-49834980 AATTTGCCAGTGAGGATATCTGG + Intergenic
1190569048 X:51763382-51763404 ACTCTTCCTGGGAGGCTGTGAGG + Intergenic
1190581920 X:51898179-51898201 ACCGTGCCAGTGAGGGTGAGTGG + Exonic
1195322343 X:103729873-103729895 ACCTTGCCAGAGAGGGTTTGAGG + Intergenic
1198301999 X:135342645-135342667 AGTTTGGCACTGAGGCTTTGGGG - Exonic
1199701475 X:150380167-150380189 ACTTTGTTGGTGAGGCTTTGGGG - Intronic