ID: 1118610163

View in Genome Browser
Species Human (GRCh38)
Location 14:67533432-67533454
Sequence CTGGGGCTGCGCCGCGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 421}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118610160_1118610163 -10 Left 1118610160 14:67533419-67533441 CCGCTGTGGTGGGCTGGGGCTGC 0: 1
1: 1
2: 8
3: 42
4: 397
Right 1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG 0: 1
1: 0
2: 5
3: 44
4: 421
1118610159_1118610163 -7 Left 1118610159 14:67533416-67533438 CCGCCGCTGTGGTGGGCTGGGGC 0: 1
1: 0
2: 2
3: 18
4: 310
Right 1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG 0: 1
1: 0
2: 5
3: 44
4: 421
1118610151_1118610163 2 Left 1118610151 14:67533407-67533429 CCCGCGCTCCCGCCGCTGTGGTG 0: 1
1: 0
2: 1
3: 11
4: 133
Right 1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG 0: 1
1: 0
2: 5
3: 44
4: 421
1118610149_1118610163 27 Left 1118610149 14:67533382-67533404 CCGCGAGCTCGCTGGAGGTGAGC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG 0: 1
1: 0
2: 5
3: 44
4: 421
1118610152_1118610163 1 Left 1118610152 14:67533408-67533430 CCGCGCTCCCGCCGCTGTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG 0: 1
1: 0
2: 5
3: 44
4: 421
1118610157_1118610163 -6 Left 1118610157 14:67533415-67533437 CCCGCCGCTGTGGTGGGCTGGGG 0: 1
1: 0
2: 5
3: 51
4: 540
Right 1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG 0: 1
1: 0
2: 5
3: 44
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118610163 Original CRISPR CTGGGGCTGCGCCGCGGCGG AGG Intronic
900113523 1:1019552-1019574 CGGGAGCTGCGGCGCGGAGGCGG - Intergenic
900117176 1:1033764-1033786 CTGGGGCTGGGCCGGGACTGGGG - Intronic
900166644 1:1246660-1246682 CTGGGCCTGGGCCGCGGTCGTGG - Exonic
900814555 1:4833445-4833467 CTGGGGCTGCACAGCTGCTGTGG - Intergenic
900968863 1:5978227-5978249 CAGGGGCTGCTCCAAGGCGGAGG - Intronic
900970944 1:5992192-5992214 GTGGGCCGGCGCCGCGGGGGAGG - Intronic
901059636 1:6466071-6466093 GCGGGGCTGCGCGGCGGTGGCGG - Exonic
901279849 1:8025914-8025936 CCCGGGCTGCGCCGCCGGGGAGG + Intronic
901797975 1:11691596-11691618 CCGGGGCTGCCCCTCGGCTGGGG + Exonic
902323570 1:15684307-15684329 CGGGCTGTGCGCCGCGGCGGCGG - Intergenic
903069098 1:20717822-20717844 CAGGGGCGGGGCCGCGGCGGGGG + Exonic
903435300 1:23344519-23344541 CTGGGGCGCCTCCGGGGCGGGGG + Intergenic
904941048 1:34165043-34165065 CTGCGGCTGCCCCGCGGGGAGGG - Exonic
905867029 1:41382123-41382145 CTGGGCCTGCACGGCGGCGGCGG + Exonic
906206668 1:43990948-43990970 CTGGGGCTGCTCCTCAGCAGGGG - Exonic
906292986 1:44632008-44632030 CCGTGGCTGCCCGGCGGCGGCGG - Intronic
907442570 1:54488259-54488281 CTGGGGCGGCGCTGGGGGGGCGG + Intergenic
910657567 1:89633588-89633610 CTGCCGCTGCGGCGCGGCGTTGG - Intronic
912514752 1:110210690-110210712 CGGGGGCCGCGCTGGGGCGGGGG - Intergenic
912800185 1:112715320-112715342 CGGGGGCGGGGCCGCGGCCGAGG - Exonic
913109082 1:115641927-115641949 CTCGGGCTGCGGGGCGGCGCCGG + Intergenic
913653798 1:120942560-120942582 ATGAGGCTGCGGCGGGGCGGAGG + Intergenic
914221464 1:145685905-145685927 GTGGGGCTGAGCCGCAGCTGAGG + Intronic
914519490 1:148402675-148402697 ATGAGGCTGCGGCGGGGCGGAGG + Intergenic
914643992 1:149636726-149636748 ATGAGGCTGCGGCGGGGCGGAGG + Intergenic
915288571 1:154868136-154868158 CTGGGGCTGAGCTGGGGCGCGGG + Intronic
915937759 1:160098917-160098939 CTGGGGCTGGGCCGAGGCCCGGG - Intronic
918001648 1:180502610-180502632 CTGGCGCTGGGCCGTGGGGGCGG + Exonic
919465942 1:197921673-197921695 CCGGGGCTGCGCCGGGGGTGAGG - Intronic
919820551 1:201469268-201469290 CGGGGGCGGGGCCGCAGCGGGGG + Intergenic
919847014 1:201648705-201648727 GTGGAGCTGAGCAGCGGCGGCGG + Exonic
921029705 1:211326772-211326794 CTGGGGCGGGGCCGGGGCGCGGG - Intronic
922648828 1:227318843-227318865 CCGGGGCCACGGCGCGGCGGTGG - Intergenic
922766398 1:228158684-228158706 CGGGGGCCGCGGCGCGGGGGCGG - Exonic
922811253 1:228416695-228416717 CGGGGGCTGGGGGGCGGCGGGGG + Intronic
1062843686 10:689400-689422 CGGGGCCTGCGGCGGGGCGGGGG - Intronic
1063453091 10:6164200-6164222 CTGGGGCAGGTCCGCGGTGGAGG + Intronic
1064981957 10:21174170-21174192 TTTGGCCTGCGCGGCGGCGGCGG - Intronic
1065099615 10:22320909-22320931 CTCGCTCCGCGCCGCGGCGGCGG - Intronic
1065188872 10:23192967-23192989 CTGCGGCGGCGCGGCGCCGGCGG + Exonic
1067216942 10:44311053-44311075 CGGGGTCTGCGCGGCTGCGGTGG + Intergenic
1067524373 10:47029332-47029354 CTGGGGCTGCACAGAGGCTGTGG - Intergenic
1070877175 10:79825755-79825777 CTTGGGCCGAGCCGCGGGGGTGG + Intergenic
1071309437 10:84328765-84328787 CTGCAGCTGGGCCGCGGCCGAGG + Exonic
1071643671 10:87341799-87341821 CTTGGGCCGAGCCGCGGGGGTGG + Intergenic
1072059742 10:91798478-91798500 CCCCGGCTGCCCCGCGGCGGCGG - Exonic
1072465248 10:95656786-95656808 CTGGAGCTGCGGCGCGGCAATGG + Intergenic
1074085707 10:110207888-110207910 CTGGGGCGCGGCCACGGCGGGGG - Exonic
1074772512 10:116742839-116742861 CCGGGGCTGCGCTGCGGGAGCGG + Intergenic
1075748429 10:124743981-124744003 CCGGGGCCGGGCGGCGGCGGCGG - Intronic
1075761926 10:124863845-124863867 CTAGGGCTGGGCCCCGGCCGTGG - Intergenic
1076116844 10:127907040-127907062 CTGTGGCTCCGCGGCGGGGGCGG - Exonic
1076806108 10:132859656-132859678 CTGTGGCTGCTCCGGGGCGGCGG - Intronic
1076895361 10:133308836-133308858 CGGGGGCTGCGCGGGGGCTGTGG - Exonic
1077021071 11:417400-417422 CCGGGGCTACGCCGCCGCCGGGG - Intronic
1077121514 11:910961-910983 CCGGGGCGGGGCCGCGCCGGGGG + Intronic
1077125972 11:936931-936953 CTGGGCCTGTGCTGCGGCAGGGG + Intronic
1077436564 11:2542200-2542222 CTGGGGCTGTGCCGAGGGTGTGG + Intronic
1079689411 11:23403545-23403567 CTGGGCCCGTCCCGCGGCGGCGG - Intergenic
1080037294 11:27722637-27722659 CGGGGGCTGCCCCGCCGCCGGGG + Intergenic
1080503790 11:32893208-32893230 GGGGGGCTGCGCAGCGGCGCTGG - Exonic
1080606632 11:33869622-33869644 CTGCGGGCGCGCCGCGGCCGAGG + Intronic
1083885752 11:65572730-65572752 CTGAGGCCGCGCGGCAGCGGTGG - Exonic
1084295984 11:68213615-68213637 CGGGGGCGGCGACGCGGCGGCGG - Intronic
1084642181 11:70432535-70432557 CTGGGGCTCCGAAGCGGCAGTGG + Intronic
1084758305 11:71252543-71252565 CTGCACCTGAGCCGCGGCGGCGG - Intronic
1085507115 11:77066956-77066978 CTGGGACTGGCCTGCGGCGGGGG - Exonic
1085561097 11:77473669-77473691 CACGGGCAGCGCGGCGGCGGCGG - Exonic
1089842124 11:121427390-121427412 CTGGGGAGGCGCCGGCGCGGCGG - Intergenic
1089943266 11:122441231-122441253 GTGGGGCAGCGCGGGGGCGGGGG + Intergenic
1090238209 11:125164819-125164841 CGGCGGCGGCGGCGCGGCGGCGG + Intronic
1090293886 11:125569543-125569565 CAGGGCCGGAGCCGCGGCGGCGG + Exonic
1090768252 11:129895594-129895616 CTGGGCCTGCGCGGCGGAAGGGG + Intergenic
1090817781 11:130314433-130314455 CTGGGGCGGCGAGGCGGCGGCGG + Exonic
1091372987 11:135076361-135076383 CTGCGCCTGCGCCGGCGCGGCGG + Intergenic
1092108930 12:5945365-5945387 CTGTGGCTGCGCGGCGCCGGCGG - Intronic
1094041108 12:26122614-26122636 GGGGGGCGGCGCGGCGGCGGCGG - Exonic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1095476153 12:42589407-42589429 AGGGGGCTGCGGCGCGGTGGTGG - Intronic
1096024761 12:48350961-48350983 CCGGGGCTCTGCGGCGGCGGAGG + Intronic
1097787826 12:63780173-63780195 CTGGGGCTGCTGGGCGGCTGGGG + Intronic
1101339016 12:103824773-103824795 CTGGGGCTGGGCAGGGGTGGAGG - Intronic
1101606007 12:106248042-106248064 CGGGGTCGGCGCCGCGGCGGCGG - Intronic
1102197158 12:111033979-111034001 CGGCGGCGGCGGCGCGGCGGCGG + Intergenic
1102520681 12:113476062-113476084 CCGGGTCTGCGCGGCGGCGGCGG + Intergenic
1102571658 12:113830561-113830583 CTAGGGCTGCGGGGCGGGGGGGG + Intronic
1103516111 12:121509527-121509549 CTGGGGCTGGGCGGCCGAGGAGG - Intronic
1104069416 12:125331217-125331239 CTGGGGCAGCAACGCGGAGGAGG - Intronic
1104929152 12:132329224-132329246 CTGGGGATGCCCCGCGGGTGAGG - Intronic
1104983171 12:132582906-132582928 CCGGGGCTGCGCCGCGCGGCAGG + Intronic
1105431431 13:20340764-20340786 CTGGTGCTGCGCTGCTGAGGCGG - Intergenic
1105432616 13:20350966-20350988 CTGGGGCTGGGCCTCGGGGAGGG + Intergenic
1105851263 13:24338843-24338865 CTGGGGCTGCCCCTAGGCCGGGG + Intergenic
1106125587 13:26897893-26897915 CTGGGGCTGGGCCTGGGCTGTGG + Intergenic
1106246534 13:27954528-27954550 CTGGGTCTGCGCCGCTGCCCGGG - Intergenic
1108363833 13:49691321-49691343 CTGGGCCTGCGCCTGGGCCGCGG - Exonic
1111672460 13:91348053-91348075 CCGGGGCAGCGTGGCGGCGGCGG + Intergenic
1112290794 13:98143047-98143069 CTGGGCCGGCCCCTCGGCGGGGG - Intronic
1112507652 13:99984855-99984877 AGGGGGCTGGGCCGCGGCGAGGG - Intronic
1112509614 13:99997810-99997832 CTGGGCCTGGGCCGCAGCCGTGG - Intergenic
1113473163 13:110561294-110561316 CTGGGGCTCCGCCGGGGACGGGG - Intronic
1113724315 13:112587437-112587459 GAGCGGCTGCGCCGCGGAGGTGG - Intronic
1114483290 14:23048208-23048230 CAGGAGCTGCGCCACGTCGGCGG + Exonic
1114490051 14:23094897-23094919 CTGCGCCTGCGCCGCGGCAGAGG + Exonic
1116187000 14:41609794-41609816 CTGGGGCTGCTGGGGGGCGGGGG + Intronic
1117478167 14:56118297-56118319 CTGGGGCCGCGCGGGGGAGGCGG - Intronic
1117524098 14:56579966-56579988 GTGGGGCTGCGGCGCTCCGGGGG + Exonic
1117875927 14:60249719-60249741 GCGGGCCTGCGCGGCGGCGGCGG + Intronic
1117920790 14:60723760-60723782 CGGGGTCTGCGCGGCGGCGGCGG + Exonic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1119410312 14:74426158-74426180 CGAGGGCTGCGCGGCGGCGGCGG - Intergenic
1120993250 14:90396960-90396982 AGGCGGCTCCGCCGCGGCGGAGG + Intronic
1122065973 14:99174797-99174819 CCGGGGCTGGGCAGCGGCGCGGG + Exonic
1122081690 14:99271290-99271312 CGGCGGCAGCGGCGCGGCGGCGG - Intronic
1122115006 14:99523196-99523218 CTGGGGCTGGGCTGGGGCAGGGG + Intronic
1122126105 14:99579574-99579596 CTGGGGCTGCGCCCTGGAGAAGG - Intronic
1122462447 14:101906836-101906858 GTGGGGCTCAGCCCCGGCGGGGG + Intronic
1123004515 14:105314867-105314889 CTGGGGCTGCGGCCGGGCCGCGG - Exonic
1123041104 14:105490558-105490580 CCGGGGCTGCTCCGTGGCGGCGG + Intronic
1123412917 15:20074077-20074099 CTGAGGCTGGGCCGGGGTGGCGG + Intergenic
1123506244 15:20942769-20942791 CAGGGGCAGGGCTGCGGCGGTGG + Intergenic
1123522259 15:21081190-21081212 CTGAGGCTGGGCCGGGGTGGCGG + Intergenic
1123563470 15:21516473-21516495 CAGGGGCAGGGCTGCGGCGGTGG + Intergenic
1123599722 15:21953759-21953781 CAGGGGCAGGGCTGCGGCGGTGG + Intergenic
1124109484 15:26773051-26773073 CCGGGCCAGCGCGGCGGCGGCGG - Exonic
1124453871 15:29822551-29822573 AGGGGGCGGGGCCGCGGCGGGGG + Intronic
1124500347 15:30223034-30223056 TTGGGGGGGCGCGGCGGCGGCGG - Intergenic
1124743226 15:32315632-32315654 TTGGGGGGGCGCGGCGGCGGCGG + Intergenic
1125674250 15:41494070-41494092 CCGGGGCTCCCCCGCGGCGGCGG - Exonic
1126668263 15:51094142-51094164 CCGGGACTGCGCTGCGGCGCAGG - Intronic
1126738050 15:51751614-51751636 CAGGGGCGGCGCCGTGGCCGGGG - Exonic
1127606432 15:60592217-60592239 CTCAGGTGGCGCCGCGGCGGTGG + Intronic
1128056476 15:64703243-64703265 CGGGGGCGGGGCGGCGGCGGCGG - Exonic
1128067849 15:64775580-64775602 CGGCGAGTGCGCCGCGGCGGCGG + Exonic
1128454120 15:67823209-67823231 CTTGGGCTGCGGGGAGGCGGCGG + Intronic
1129232220 15:74203112-74203134 CTGGGGCTGGGCTGGGGCGGAGG + Intronic
1129691978 15:77718941-77718963 CTGGGGCTGGGCTGGGGTGGAGG + Intronic
1131199980 15:90388177-90388199 CTGGGGCGGTGCCGCTGGGGCGG + Intergenic
1202971828 15_KI270727v1_random:243610-243632 CAGGGGCAGGGCTGCGGCGGTGG + Intergenic
1132578694 16:675502-675524 CTGGAGCTGCGCCAGAGCGGGGG + Intronic
1132583005 16:693971-693993 CTGTGGCTGTGGCGTGGCGGAGG + Exonic
1132690637 16:1180510-1180532 CTGTGGCTGTGCCTCGGAGGGGG - Intronic
1132937457 16:2488306-2488328 CTGGGGCTGTGGCGGGGTGGGGG + Intronic
1132978166 16:2720853-2720875 GTGGGGCTGGGCCGCGCTGGTGG + Intergenic
1133040671 16:3058560-3058582 CTGGCGCTACGACGAGGCGGCGG + Exonic
1133188519 16:4116575-4116597 CTGGGGCTGCGGGGCGGGGCGGG + Intergenic
1133219925 16:4315652-4315674 CGGGGGCGGGGCCGCGGGGGGGG + Intronic
1133332941 16:4987717-4987739 CTGGGGCTGGGGGGCGGAGGAGG + Intronic
1134482311 16:14630285-14630307 CAGCGCCTGCGCGGCGGCGGGGG + Intronic
1136554775 16:31001378-31001400 CCGGGGCTGCGGCTGGGCGGTGG + Intronic
1136861543 16:33707206-33707228 CTGGGCCTGCGCCGGCGCCGTGG + Intergenic
1137719916 16:50621906-50621928 CTGGGGCTGGGCTGAGGGGGTGG - Intronic
1138352986 16:56356415-56356437 CAGGGGCTGCGCCGCGAGGTGGG - Intronic
1139140912 16:64261209-64261231 CTGGGCCTGCGCCTGGGCCGCGG - Intergenic
1139750407 16:69106357-69106379 GCGGGGCTGCGCCGAGGCCGGGG + Intronic
1140476762 16:75242845-75242867 CTGAGGCTGGGCCGGGGTGGCGG + Exonic
1141456274 16:84144767-84144789 GGGGTGCAGCGCCGCGGCGGGGG + Intronic
1142271790 16:89093787-89093809 CCGGCGCGGCGCCGTGGCGGCGG - Exonic
1142321444 16:89385804-89385826 CTCTGGCTGCGCAGCGGCGGGGG - Intronic
1203123043 16_KI270728v1_random:1555397-1555419 CTGGGCCTGCGCCGGCGCCGTGG + Intergenic
1142836813 17:2593662-2593684 CTGGAGCGGCGGGGCGGCGGCGG + Intronic
1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG + Intergenic
1143512847 17:7405501-7405523 CTGGGCCTGCGGGGCCGCGGGGG + Intronic
1143562674 17:7705026-7705048 CGGGGGCTGAGGCGGGGCGGCGG + Intergenic
1143586834 17:7854642-7854664 CTGGGGCTGCGGAGGGGTGGGGG + Exonic
1143962905 17:10735315-10735337 CTTGGGCTGCCCCGTGGAGGAGG + Intergenic
1144625727 17:16843591-16843613 CTGGGGCTGGGCCATGGCTGAGG - Intergenic
1144880706 17:18429129-18429151 CTGGGGCTGGGCCATGGCTGAGG + Intergenic
1144907739 17:18650268-18650290 CTGGGCTGGCGCAGCGGCGGTGG - Intronic
1144930922 17:18858223-18858245 CTGAGGCTGCGGCGGGGCCGGGG + Exonic
1145151531 17:20515258-20515280 CTGGGGCTGGGCCATGGCTGAGG - Intergenic
1145243586 17:21253271-21253293 GCGGGGCTGCGGCGCGGCGCCGG + Exonic
1145254800 17:21316673-21316695 CTGGGGCCGCGCCCCGGCAAGGG - Intergenic
1145321800 17:21771292-21771314 CTGGGGCCGCGCCCCGGCAAGGG + Intergenic
1146143477 17:30389032-30389054 CTGGGGCTGTGCTTCGGGGGCGG - Intronic
1146255440 17:31389554-31389576 CTGGGGCTGCCCCCTGGTGGGGG - Intergenic
1146658857 17:34651447-34651469 CTGGGACTGCGCAGTGGCGTGGG + Intergenic
1147700051 17:42388212-42388234 CGGGGGCTCCGCAGCGGCAGGGG - Intronic
1147971819 17:44222254-44222276 CAGGCGCTGCCCCCCGGCGGCGG + Intergenic
1148271763 17:46267020-46267042 CTGAAGCTGAGGCGCGGCGGCGG - Intergenic
1148664079 17:49361855-49361877 CGGGGGCGCCGCCGCGGCGGTGG + Intronic
1150311056 17:64129899-64129921 CCGGGGCAGCGTCGCGGCGCCGG - Intronic
1150624895 17:66835321-66835343 CCGGTGCTGGGCCGCGGCGCCGG + Intronic
1150764622 17:67993534-67993556 CTGAGGCTGAAGCGCGGCGGCGG + Intronic
1152197289 17:78925170-78925192 CGGGGGCTGAGCCGGGGCCGAGG + Exonic
1152224669 17:79087212-79087234 CTGGGGCTGGGCTGGCGCGGGGG - Intronic
1152280685 17:79383370-79383392 CTGGTGCACCGCCGCGGCCGTGG - Intronic
1152468054 17:80476706-80476728 CCGGGCCCGCGGCGCGGCGGGGG + Intronic
1152656837 17:81523768-81523790 CTGGGGCCACCCCGCGGCTGAGG - Intronic
1152697415 17:81804067-81804089 CGGGGGCGGCCCCGCGGGGGTGG - Intergenic
1152921938 17:83070177-83070199 CTGGGACTGCCCCACTGCGGAGG + Intergenic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1153625068 18:7015730-7015752 CTGGGGCTACGATGCGGAGGTGG - Exonic
1154167938 18:12029888-12029910 CTGGGGGTGCACCGCTGCTGCGG - Intronic
1155152795 18:23135878-23135900 CTGGGCCGGCGCGGCGGCCGCGG - Exonic
1155300637 18:24426426-24426448 CTAGGAATGCGCCGGGGCGGGGG - Intergenic
1156171757 18:34494046-34494068 CAGGGGCTGCGGCGCTGCGAAGG - Intronic
1157292872 18:46422523-46422545 GTGGGGCTGCGCCCAGGTGGAGG - Intronic
1157594699 18:48857493-48857515 CTGGGGCTGCAGGTCGGCGGGGG + Intronic
1157616213 18:48989154-48989176 CTGGGGCTGCCCGGGGGCTGTGG + Intergenic
1157753012 18:50194986-50195008 CCGTAGCTGCGCCGCCGCGGCGG - Exonic
1158190964 18:54828433-54828455 CTCGGAGTCCGCCGCGGCGGCGG - Exonic
1159040541 18:63319920-63319942 CTGGTCCTGCGCGGCGGCGCTGG + Exonic
1159511295 18:69400926-69400948 CGGGGGCGGCGGCGCGGTGGGGG + Intergenic
1160024934 18:75209236-75209258 CGGGGGCTGCGCCGGCGCCGGGG - Exonic
1160387106 18:78503414-78503436 GTGGGGCTGCACCACGGAGGTGG - Intergenic
1160453597 18:78980676-78980698 GGGGGGCGGCGCGGCGGCGGAGG - Intronic
1160530116 18:79557604-79557626 CTGGGGCTGCTCCCAGGCCGAGG + Intergenic
1160773407 19:843804-843826 CTGGGGCTGCACCGCGGCCTCGG + Intronic
1160788776 19:913252-913274 CTGGGGCTGCGCGGCGGGGCGGG + Intergenic
1160794976 19:941055-941077 GTGGGGCCAGGCCGCGGCGGCGG - Intronic
1160853547 19:1206052-1206074 GCGGGGCGGCGCGGCGGCGGGGG - Intronic
1160907868 19:1460255-1460277 CTGGCGCTGCGCCGCTACGCGGG + Exonic
1160930514 19:1567788-1567810 CGGGGACGGCGCAGCGGCGGCGG - Exonic
1160930688 19:1568258-1568280 CTCTGGCTGCGGCTCGGCGGCGG + Intergenic
1161027204 19:2042212-2042234 GTGGGGCGGGGCCGCGGCGGGGG - Intronic
1161063708 19:2227538-2227560 CTGGGGCTGCTGCGGGGCGGGGG + Intronic
1161302143 19:3547890-3547912 CAGGGGCTGGGCCGTGGCAGGGG + Exonic
1161348497 19:3779482-3779504 TTGGGGCTGCTCCGCTGCGTGGG + Intronic
1161372004 19:3917799-3917821 CTGGGGCTGGGTCGGGGCAGCGG + Intronic
1162027705 19:7903911-7903933 CGGGCGGTGCGCGGCGGCGGTGG + Exonic
1162033246 19:7926172-7926194 CGGGGGCGGGGCCGCCGCGGGGG + Intergenic
1162131107 19:8526674-8526696 CAGGGGCGGGGCCGCGGCCGGGG + Intronic
1162235909 19:9309605-9309627 CTGAGGAGGCGCCGCGGCGGCGG + Intronic
1162523976 19:11197080-11197102 CTGGGGCATGGCCGCGGAGGAGG + Intronic
1163034949 19:14564800-14564822 CTGGGGCTTCGCCGCGTGGATGG + Exonic
1163117593 19:15197739-15197761 CTGGGGCTGGGGCGGGGGGGGGG - Intronic
1163442440 19:17328725-17328747 CGGGGGCTGCGGGGCGCCGGAGG - Exonic
1163529723 19:17842353-17842375 CTGGGGCTGCTCCGCGTGGCTGG - Exonic
1163592828 19:18203978-18204000 GTGGGGCTGCGCGGCGGCGGCGG + Exonic
1163631888 19:18421697-18421719 CTGGGGCTGGGCCCAGGTGGAGG + Intronic
1163720441 19:18895973-18895995 CTGGGGCAGCGCGCTGGCGGCGG - Exonic
1165407859 19:35641945-35641967 CTGGGGCTGCCCTGCTGCAGGGG - Exonic
1165454023 19:35900480-35900502 CTGGCGCAGCGCCGAGGCCGCGG - Exonic
1166856908 19:45786737-45786759 CTGGGGCGGGGCCGAGGCGCAGG + Exonic
1167120808 19:47515303-47515325 GTGGGGCGGGGCCTCGGCGGGGG - Intergenic
1167134433 19:47608681-47608703 CGGGGGCGGCGCCGGCGCGGAGG + Intronic
1167134620 19:47609346-47609368 CGGGCGCTGCGCCCCGGCTGGGG - Intronic
1167418812 19:49390855-49390877 CAGCAGCTGCGCCGCGGCAGGGG + Exonic
1167463854 19:49640046-49640068 CGGGGGCGGCCCCGGGGCGGGGG - Exonic
1167468442 19:49662502-49662524 CTGGGGCTCCGCAGGGGCTGAGG + Exonic
1167578437 19:50328832-50328854 ATGGGGCGGCACGGCGGCGGCGG - Exonic
1167697636 19:51024602-51024624 CTGGGGCGGTGCCGGGGTGGGGG - Intronic
1168104250 19:54156899-54156921 CTGGGGCTGGGCCGGGCGGGGGG + Exonic
1168471327 19:56643138-56643160 CTGCGGCTGCGCAGACGCGGAGG - Exonic
925013417 2:503426-503448 CTGAGGCGGCGCTGCGGCTGTGG + Intergenic
925179744 2:1809400-1809422 CTGGGGCTGCCTCTTGGCGGGGG + Intronic
925413068 2:3651145-3651167 CTGGGGCTGCCCGGCGGTGGCGG + Intergenic
926297926 2:11582000-11582022 CTGGGGCTAGGCTGCTGCGGAGG - Intronic
927709055 2:25314004-25314026 CTGGGGCTGCGCGGGGCTGGGGG + Exonic
927713879 2:25341066-25341088 CTGGGGGTGCGGGGCGCCGGCGG - Intronic
933741471 2:85538000-85538022 CTGGGGCTGGGCCTCGGTGCAGG - Intergenic
933893233 2:86789683-86789705 CAGGGGCTGCGACGCGATGGTGG + Exonic
934296834 2:91749089-91749111 CCGGGGCGCCGCCGCGGCGCTGG - Intergenic
934566972 2:95346589-95346611 CGGCGGCGGCGCGGCGGCGGGGG - Intronic
934566975 2:95346592-95346614 CGGCGGCGGCGGCGCGGCGGCGG - Intronic
934754765 2:96817148-96817170 CTGGAGCTGGCGCGCGGCGGCGG + Exonic
935592700 2:104856109-104856131 CGGGAGGTGCGCGGCGGCGGCGG - Exonic
937084041 2:119158820-119158842 CCGGGGCTGAGCGGCGGAGGCGG + Exonic
937110941 2:119366854-119366876 CGGGGCTAGCGCCGCGGCGGGGG + Intergenic
937290078 2:120776742-120776764 CTGGGGCTGAGCCGGGGCAGAGG + Intronic
938018180 2:127885367-127885389 CTTGGGCCGAGCCGCGGGGGTGG + Intronic
938073180 2:128318902-128318924 CCGGGGCGGGGCGGCGGCGGCGG - Intergenic
938093386 2:128447443-128447465 CTGGGGCTGCCCAGCAGCAGTGG + Intergenic
938414554 2:131093427-131093449 CGGTGGCTGCGCAGCGTCGGCGG - Exonic
940316780 2:152335377-152335399 CCGGGGCCGCGCTGGGGCGGCGG + Exonic
944414767 2:199470262-199470284 CTGGGGATCCTCCGCGGCAGGGG - Intronic
944495852 2:200306838-200306860 CAGGGGAGGCGCCGCGGCGGTGG - Intronic
944547500 2:200812203-200812225 CCGGGTGTGCGCCGCGGCGCTGG + Intronic
945530849 2:210950979-210951001 ATGGGGCGGCGGCGGGGCGGAGG - Intergenic
946414005 2:219530270-219530292 CAGGAGCTGCGCAGCGGCAGGGG - Intronic
946416693 2:219543557-219543579 CTGGGGGTTCGCCGGGGCCGGGG - Exonic
948080722 2:235203122-235203144 CTGGGGCTGGGCCAGGGCAGTGG + Intergenic
948697372 2:239738324-239738346 CTGGGCCTGGGCCGGGGCTGGGG - Intergenic
948711376 2:239827653-239827675 CTGGGCTTGTGGCGCGGCGGAGG + Intergenic
948922718 2:241073269-241073291 CTCGAGCTGCGCCGAGGCTGTGG - Exonic
948988713 2:241541253-241541275 GTGGGGCGGGGCCGCGGCGGGGG + Intergenic
1169065486 20:2692624-2692646 CCGGGCCCGGGCCGCGGCGGCGG - Intergenic
1170630022 20:18057767-18057789 CCTGGGCCGCGCCGCGGCGGGGG - Exonic
1170756808 20:19212494-19212516 CTGGGGCGGCGGCGCGGCGGGGG - Intergenic
1171013850 20:21522766-21522788 CTGGGGCTGCGCGGTGGCCGCGG - Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171250203 20:23640620-23640642 CTGGGGCTCCGCCATGGCTGGGG + Intergenic
1171279156 20:23881777-23881799 CTGGGGCTCCGCCATGGCTGGGG + Intergenic
1171289638 20:23974806-23974828 CTGGGGCTGCTCCTGGGAGGAGG + Intergenic
1172662155 20:36574791-36574813 CTCGGTCTGGGCCGCGGGGGAGG + Intronic
1173606771 20:44337246-44337268 CTCGGGCTGGGCCGGGGCTGGGG - Exonic
1173803737 20:45911103-45911125 CCGGGGCGGGGCCTCGGCGGTGG - Intronic
1174607030 20:51768450-51768472 CCGGGGCGGCGCGGCGCCGGCGG - Exonic
1175267057 20:57709526-57709548 ATTGGGCTGCCCGGCGGCGGCGG + Exonic
1175847103 20:62064995-62065017 CGGGGGCGGGGCGGCGGCGGGGG + Exonic
1175910482 20:62403001-62403023 CTGGGGCTGGGCTGCAGCTGTGG - Intronic
1175964632 20:62654401-62654423 CTGGGCCTGCGCTGGGGCTGGGG - Intronic
1175985932 20:62764182-62764204 CTGGGGCAGCGCCGCTTGGGAGG - Intergenic
1176151794 20:63595263-63595285 TTGGGGCTGGGCCGTGGGGGTGG + Intronic
1176221081 20:63969675-63969697 CGGGGGCTCGGGCGCGGCGGGGG + Intronic
1180177890 21:46098869-46098891 CTGGGACTCCGCCGGGGCGCTGG + Intronic
1180184481 21:46132704-46132726 CTGGGGCTGGGCGGGGGCCGGGG - Exonic
1180843673 22:18970524-18970546 CCGGGGCTGGGCCGGAGCGGCGG + Intergenic
1182857937 22:33534673-33534695 CTGGGGCAGCCCCGCCTCGGAGG - Intronic
1182903849 22:33920440-33920462 CCCGGGCTCCGGCGCGGCGGCGG + Intronic
1183370132 22:37427498-37427520 CAGGGGCAGAGGCGCGGCGGCGG - Intergenic
1183466912 22:37984554-37984576 CTGAGCCTGAGCCGCTGCGGAGG + Intronic
1183824002 22:40370746-40370768 CGGGGGCTGCGGGGCGGCTGTGG + Intronic
1184101509 22:42343753-42343775 CGCGGGCGGCGCCGCTGCGGTGG + Intergenic
1184184803 22:42857336-42857358 CGGCGCCTGCGCCCCGGCGGTGG - Exonic
1184680940 22:46071797-46071819 CAGCGGCTTCGCAGCGGCGGGGG + Intronic
1185272766 22:49936345-49936367 CGGGGGGTGTGCGGCGGCGGCGG - Intergenic
1185296697 22:50058274-50058296 CTCGGGCTGTGCAGCGGCGGCGG + Intergenic
1185313788 22:50170355-50170377 CGGGGGCCGGGCTGCGGCGGAGG + Intergenic
1185337612 22:50277766-50277788 CCGGGGCTGGGCCGCGGGGTGGG + Intronic
1185337630 22:50277817-50277839 CCGGGGCTGGGCCGCGGGGTGGG + Intronic
1185409069 22:50673334-50673356 CTGGGGCTGCTTGGGGGCGGAGG + Intergenic
1185409442 22:50674446-50674468 CGGGGGCTCCGCAGGGGCGGCGG - Intergenic
952301225 3:32106403-32106425 CTAGGGCCGCGCAGCGACGGGGG + Intronic
952451775 3:33440106-33440128 CGGGGGCTGGGCGGCGGCGCCGG - Exonic
954200055 3:49018636-49018658 CTGGGGCGGGGATGCGGCGGTGG + Intronic
954389252 3:50260302-50260324 CGGGGTCGGCGCCGCGGAGGCGG + Intergenic
954615550 3:51967330-51967352 CTGGGGCTGTCCTGCGGCGGCGG + Exonic
954778995 3:53045741-53045763 CGGCGGCGGCGCCGGGGCGGGGG - Intronic
956678013 3:71753638-71753660 AGGGGGCTCCGCGGCGGCGGCGG + Intronic
956813596 3:72888213-72888235 ATGGTGCGGCGCGGCGGCGGCGG - Exonic
956978971 3:74614602-74614624 CTGGCGCTTGGCGGCGGCGGCGG - Intergenic
958900141 3:99876289-99876311 GTGTGGCTGCGCCGCCGCCGCGG - Intronic
960110313 3:113838876-113838898 GCGGGGCGGTGCCGCGGCGGCGG + Exonic
961537953 3:127581268-127581290 CTGGGGCTGCTCCCCGCCTGGGG - Intronic
961574452 3:127823217-127823239 CTGGGCCGGCTCGGCGGCGGGGG + Intronic
963061690 3:141231697-141231719 CTGGAGCTCCGCCCCGGAGGCGG - Intronic
963253080 3:143120005-143120027 CGGAGGCTGCGGAGCGGCGGGGG + Exonic
963253283 3:143120782-143120804 CCGGGCCGGCGGCGCGGCGGAGG - Exonic
963870689 3:150410393-150410415 CTGGGGCTGCTGCGCCGCGGGGG - Exonic
965547576 3:169931788-169931810 CTGGGGCTGCCCCTCCTCGGGGG + Intronic
966815206 3:183884795-183884817 CTGGGGCTGCGGCCAGGCGTGGG - Exonic
968077583 3:195824948-195824970 CTGGGGCTGCCTCGGGGAGGAGG + Intergenic
968372780 4:11126-11148 CCGGCGCGGCGCCGGGGCGGGGG + Intergenic
968372795 4:11175-11197 CCGGCGCGGCGCCGGGGCGGGGG + Intergenic
968478747 4:824949-824971 CTGGAGCGGCGCCTCCGCGGTGG + Intronic
968514392 4:1010196-1010218 GTGGGACAGGGCCGCGGCGGCGG + Intronic
968525000 4:1052231-1052253 CTGAGGCTGCACAGCGGTGGGGG + Intergenic
968573371 4:1353938-1353960 CTGGGGCTGGGGGGCGGGGGCGG - Intronic
968576297 4:1367799-1367821 CTGGGGCTGCGTCTCGGTGGGGG - Intronic
968603248 4:1520298-1520320 GTGGGGCTGCGCCACGGCCCCGG + Intergenic
968615651 4:1576706-1576728 CTGGGACTGTGCCCCGGCTGGGG + Intergenic
968661805 4:1801753-1801775 CTGGGGCGGCGCGGGGGTGGGGG + Intronic
970191683 4:13524033-13524055 GTAGGGCTGCTCGGCGGCGGCGG - Intergenic
970332707 4:15002584-15002606 CTGGGGTTGCGCGGCCGTGGTGG - Intergenic
971457805 4:26860783-26860805 GGGGGGATGCGCCGCGGCGGCGG + Intronic
972586043 4:40437879-40437901 CAGGGGCGGCGGCGCGGCTGAGG - Exonic
974009330 4:56592780-56592802 CGGGGACAGCGCCGCGGCTGGGG + Intronic
975710590 4:77157285-77157307 CCGGCGTTGCGCCGCGGCGGAGG + Exonic
975801064 4:78059104-78059126 CCGCGGCTGGGCGGCGGCGGCGG + Intronic
976146123 4:82044183-82044205 TCGGGGCTGCCCCGCGGCTGCGG + Intronic
976199088 4:82561785-82561807 CGGGGGCTGCAGCGCGGCTGGGG - Intronic
976602407 4:86950067-86950089 CTGGGGCTTCGCCGCGTGGATGG - Intronic
981550519 4:145937493-145937515 CGGGAGCTGCGCCGAGGCGAAGG - Intronic
981688514 4:147481252-147481274 CCCGGGCTCCGGCGCGGCGGCGG - Exonic
985462614 4:190121440-190121462 CCGGCGCGGCGCCGGGGCGGGGG - Intergenic
985638686 5:1053005-1053027 GTGGGGCTGAGCCCCAGCGGAGG + Intronic
985666483 5:1183938-1183960 CTGGGGCTGCGCCCGGGGTGGGG - Intergenic
985791602 5:1931164-1931186 CAGGGGCTGCGCCGCGTCCCCGG + Intergenic
988564134 5:32307387-32307409 CTGGGGCTGGGCTGGGGTGGGGG + Intronic
989637956 5:43556659-43556681 CTGGGCTGGCGCAGCGGCGGTGG + Exonic
989637987 5:43556776-43556798 CGGGGCCTGGGCCGCGGAGGGGG - Exonic
992042367 5:72848539-72848561 CGGGGGCTGGGCCGCAGCGCGGG - Intronic
995725471 5:115177616-115177638 CTGGGGCTGCGGGGCGGGGCAGG + Intronic
997975421 5:138439130-138439152 CTGAGGCCGAGCGGCGGCGGCGG - Exonic
997990807 5:138543136-138543158 CGGCGGCGGCTCCGCGGCGGCGG + Exonic
997990808 5:138543139-138543161 CGGCGGCTCCGCGGCGGCGGCGG + Exonic
999326934 5:150649589-150649611 CAGGGCCAGCCCCGCGGCGGCGG + Exonic
1001639436 5:173234633-173234655 CGAGGGCTGGGCTGCGGCGGGGG - Intronic
1002887827 6:1312044-1312066 CTGCGGCGGCTCCGCGGGGGCGG - Intergenic
1002928733 6:1619648-1619670 GCGGGGCTGCACCGGGGCGGGGG - Intergenic
1003871160 6:10404435-10404457 CTGCGCTTGCGCCGGGGCGGTGG - Intronic
1003995717 6:11537930-11537952 CAGGGGCAGCGCCGCGCCGCGGG - Intergenic
1004615041 6:17281430-17281452 CGAGGGCGGCGGCGCGGCGGGGG - Exonic
1006860849 6:37170682-37170704 CCGGGGATGCGGGGCGGCGGCGG + Intronic
1006932543 6:37696833-37696855 CTCGGGCTGCGCCGCCTCGCGGG - Exonic
1007432727 6:41786139-41786161 CTGGCGCTGCACCGAGGCGGAGG + Exonic
1007665327 6:43510038-43510060 GTGGGGCGGCGCTGGGGCGGGGG + Exonic
1013232099 6:108168449-108168471 CTGCGGCTGCGCCCCCGCTGTGG + Intronic
1015149273 6:130020000-130020022 CGGCGGCCGCGCCGGGGCGGCGG + Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1015843865 6:137497831-137497853 GGCGGGCTGCGCCGCGGAGGCGG + Intergenic
1016368284 6:143342275-143342297 CTGGGGCTGCGGCTCAGCGTGGG + Intergenic
1016378719 6:143450814-143450836 CGGCGGCTGCGCGGCGGCAGCGG + Intronic
1016982164 6:149863770-149863792 CTGGAGCTGCGCGCGGGCGGCGG - Exonic
1017672095 6:156778153-156778175 CTGGTGGGGCGGCGCGGCGGGGG - Exonic
1017793637 6:157823069-157823091 CCGGGGCGGCGGCGCGGCGCGGG + Intronic
1018686479 6:166307955-166307977 CCGGGGCCGCGCCGGGCCGGCGG + Exonic
1019303697 7:322391-322413 CTGGGTCTGCGGGGCGGCGGGGG - Intergenic
1019422441 7:957341-957363 CTGGAGCTGCCCCACGGAGGAGG - Intronic
1019494646 7:1332124-1332146 CTGAGGCTGCACCGCTGGGGAGG + Intergenic
1020418225 7:7969494-7969516 CGTGGGCTGCGCCCCGGCTGCGG + Exonic
1021600048 7:22356336-22356358 CTGGGTCTGCCCCTCGGCGGTGG + Intronic
1022375346 7:29806820-29806842 CCGGGGCTGCAGCCCGGCGGGGG - Intronic
1022485028 7:30771443-30771465 CTGGTGCTGCGGCCCGGCGTGGG + Exonic
1024965353 7:55019031-55019053 CTGCGGCCGCGCTGCGCCGGGGG - Intronic
1026817150 7:73521970-73521992 CTAGTGCTGCGCCGCGGGGCCGG - Exonic
1027059421 7:75073693-75073715 CTGGGGCTCGGCTGGGGCGGCGG - Exonic
1028585471 7:92447559-92447581 CTGGCGCTGCCCCGTGGAGGCGG - Exonic
1028709472 7:93890804-93890826 CTCAGGCTCCGCCCCGGCGGGGG - Exonic
1029264018 7:99324739-99324761 ATGGCGCTGGGCGGCGGCGGGGG + Intergenic
1029425827 7:100493629-100493651 GTGGGGCTGTGCCGCGGGCGGGG - Exonic
1029701533 7:102249285-102249307 CTGGGTCTGGGCCGCGGGGTTGG - Exonic
1029715133 7:102321554-102321576 CGGGGGCTCCTCGGCGGCGGTGG - Exonic
1030138698 7:106284561-106284583 CGGCGGCGGCGGCGCGGCGGGGG - Intronic
1030138703 7:106284572-106284594 CTGGGGGCGCGCGGCGGCGGCGG - Intronic
1031073645 7:117190842-117190864 CTGAGGCTGCATCTCGGCGGGGG + Exonic
1031361823 7:120857362-120857384 CTGGGGCGGCGGGGCGGGGGCGG + Intronic
1032215378 7:129953021-129953043 GTGGGGCGCCGCCGCGGCGTGGG + Intergenic
1034192631 7:149223842-149223864 CTGGGGCTGTGGCGGGGCCGGGG - Exonic
1034441155 7:151086689-151086711 CCGGGGCGGCGCGGCGGAGGCGG - Intronic
1034560624 7:151877328-151877350 CTGGGGCCGCGGCGCGGCGGGGG - Intergenic
1035169501 7:157009840-157009862 CTACGGCTACTCCGCGGCGGCGG - Exonic
1035553013 8:544650-544672 CTGCGCCTGGGCGGCGGCGGCGG + Exonic
1035857958 8:2997027-2997049 CAGGGGCTGGGGCTCGGCGGAGG + Intronic
1038542598 8:28402182-28402204 CGGGGCCTGCGCAGCGTCGGTGG + Intronic
1039212699 8:35235368-35235390 CTGGGGCGGGGCCGCGGGAGGGG - Intergenic
1043296129 8:78665984-78666006 TGGGGGCGGGGCCGCGGCGGAGG - Intergenic
1043502809 8:80873845-80873867 CCGGCGCTGCGCGGCGGCGGCGG + Intronic
1045535182 8:103021004-103021026 CTGCGGCTGCGCAGTGGCGCGGG + Intergenic
1048833351 8:138496956-138496978 CTGGGGCTGCCCGGAGGCCGCGG - Intergenic
1049003921 8:139843004-139843026 CTGGGGCTGGGCAGTGGCTGGGG - Intronic
1049242203 8:141543731-141543753 ATGGGGCTGAGCCCCGGCGCAGG + Intergenic
1049637060 8:143694754-143694776 CGGGGGCTGCGCCCCGGCGCCGG + Exonic
1049762180 8:144336613-144336635 CTGAGGCTCCGCCGCGGCGGCGG - Intergenic
1049766634 8:144358202-144358224 CTTGGGCTTGGCCGCGGCGCTGG + Exonic
1049788564 8:144462740-144462762 CTGCGGGTTCGCGGCGGCGGCGG - Intronic
1049936400 9:504869-504891 CCGGGGTTGCGCGGCGGCCGTGG + Intronic
1050537753 9:6645355-6645377 CGGGGACAGCGCCGCGGCTGGGG - Exonic
1051513749 9:17907034-17907056 CTGGGGCTGCGCTGCCGCCCAGG + Intergenic
1052824988 9:33167687-33167709 CTGGGCCTGCAGCGCGGCGGCGG + Intergenic
1052903991 9:33817744-33817766 CTGGGCCATCGCGGCGGCGGCGG - Exonic
1053001158 9:34577960-34577982 CGGGGGCGTCGCGGCGGCGGGGG + Intronic
1056170456 9:83980170-83980192 CTGAGGCGGCGCGGCAGCGGAGG - Exonic
1056799535 9:89681478-89681500 CGGGGGCAGCGGTGCGGCGGGGG - Intergenic
1057596181 9:96417857-96417879 GTGGGGATGAGCGGCGGCGGCGG + Exonic
1057600047 9:96450122-96450144 CGGCGGCGGCGCCGCGGGGGCGG + Intergenic
1057665241 9:97039349-97039371 CGGGGGCTGCGCGGAGGAGGGGG + Intronic
1059234700 9:112751324-112751346 CTGCGGCTGCGACCCCGCGGAGG - Intronic
1059455684 9:114398617-114398639 CTGGGGGCGGGCCGTGGCGGCGG - Intergenic
1060263169 9:122093190-122093212 CTGGGGCGGCGGAGCGGCGGCGG - Exonic
1060389796 9:123268209-123268231 CCGGGGCACCGCAGCGGCGGCGG + Intronic
1060708331 9:125829805-125829827 CTGGTGCTGCTCCGTGGCAGTGG + Intronic
1061075740 9:128340534-128340556 CTGGGGCTGCGCTGCGCCGCCGG + Intergenic
1061084939 9:128393165-128393187 CTGTGGCTGAGTCGCGGCCGGGG + Intergenic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061208510 9:129177629-129177651 CAGGGGCTGCGCGGCGGCGGCGG - Exonic
1061208698 9:129178476-129178498 CTGGGGCTGCCGCGCCGCGCGGG + Intergenic
1061258800 9:129467836-129467858 CTGGGGCTGCACTGAGGAGGTGG - Intergenic
1061453503 9:130681629-130681651 CAGGTGGTGCGCGGCGGCGGCGG - Exonic
1061453564 9:130681789-130681811 CTGGGGTTGCGCCCCGGAGGCGG + Exonic
1062016891 9:134295622-134295644 CTCGGACTGGGCAGCGGCGGGGG - Intergenic
1062272088 9:135714350-135714372 CGGGGGCTGCGCAGGGGCAGGGG - Intronic
1062341411 9:136095305-136095327 CGGCGGCCGCACCGCGGCGGGGG + Intergenic
1062341422 9:136095322-136095344 CGGGGGCGGGGCGGCGGCGGGGG + Intergenic
1062379595 9:136280829-136280851 CTGGGGCTGCTCTGGGGTGGTGG + Intergenic
1062414267 9:136439836-136439858 CGGGCGCGGCCCCGCGGCGGCGG - Intergenic
1062519076 9:136950187-136950209 CTGCGTCTGCCCCGCGGTGGGGG + Intronic
1062574497 9:137200062-137200084 CGGGGTCTGCACCGCGGCGCGGG - Exonic
1062718607 9:138023399-138023421 CTGTGGCTGCGGTGCGGCCGCGG - Exonic
1203792595 EBV:159793-159815 CTGGGGGTGCGCCGTGAAGGCGG + Intergenic
1185463966 X:344557-344579 CTGGGGCCGCGCCGGGCCGGGGG + Intronic
1186426088 X:9465199-9465221 CTGCGGCGGCGGCGGGGCGGGGG - Exonic
1187419544 X:19122528-19122550 CGGGGGCGGCGCCGAGGCCGCGG - Exonic
1190285301 X:48957467-48957489 CCGGCGCCGCGGCGCGGCGGAGG - Exonic
1191937050 X:66437484-66437506 CTTGGGCTGCGCAGAGGAGGAGG + Intergenic
1195668348 X:107449912-107449934 CAGCGGCGGCGCAGCGGCGGCGG - Intergenic
1197415297 X:126166120-126166142 CTGAGGCTCGGCGGCGGCGGCGG + Intergenic
1199445103 X:147912040-147912062 GTGCGGCAGCGCGGCGGCGGCGG + Exonic
1200128957 X:153830762-153830784 GGGGGGCAGCGGCGCGGCGGCGG + Intergenic