ID: 1118611592

View in Genome Browser
Species Human (GRCh38)
Location 14:67545188-67545210
Sequence CCTCCGAGTCACTAACTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118611592_1118611595 10 Left 1118611592 14:67545188-67545210 CCTTTAAGTTAGTGACTCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1118611595 14:67545221-67545243 TTCTTCTGCTGATATGCCACTGG 0: 1
1: 0
2: 2
3: 14
4: 183
1118611592_1118611597 29 Left 1118611592 14:67545188-67545210 CCTTTAAGTTAGTGACTCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1118611597 14:67545240-67545262 CTGGCCAGATCTTATTCACATGG 0: 1
1: 1
2: 10
3: 86
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118611592 Original CRISPR CCTCCGAGTCACTAACTTAA AGG (reversed) Intronic
919475748 1:198031820-198031842 CCTCCAAGTCATTCTCTTAAAGG - Intergenic
922154471 1:223030265-223030287 CCCCCAAGTCACTAAGCTAAAGG - Intergenic
1087047387 11:93853458-93853480 CCCCCAAATCACTAAATTAAAGG - Intergenic
1097203849 12:57303437-57303459 CTTCTGATTCTCTAACTTAATGG - Intronic
1097252074 12:57640702-57640724 CCCCCAAATCACTAAGTTAAAGG + Intergenic
1097579165 12:61432409-61432431 CTTCTGAATTACTAACTTAATGG - Intergenic
1098315273 12:69186004-69186026 TCTCCAAATCACTAAGTTAAAGG + Intergenic
1099685444 12:85881565-85881587 GCTCAGATTCAATAACTTAAGGG - Intronic
1101760576 12:107655382-107655404 CCTCCAAGTGACTATCATAAAGG - Intronic
1109758129 13:66788679-66788701 GCTCCAAGTCAGTATCTTAAAGG + Intronic
1113196839 13:107818209-107818231 CCTCCGTGTGTCTAACTGAACGG - Intronic
1113417030 13:110136631-110136653 CCCCCAAGTCACTAAGCTAATGG - Intergenic
1115243429 14:31271591-31271613 CCTCAAAATCACTAAGTTAAAGG + Intergenic
1118611592 14:67545188-67545210 CCTCCGAGTCACTAACTTAAAGG - Intronic
1120169957 14:81238160-81238182 CCCCCAAGTCACTAAACTAAAGG - Intergenic
1134061802 16:11203783-11203805 CCTCCAAATCACTATTTTAATGG - Intergenic
1135831305 16:25776247-25776269 CCCCAGAATCACTAAGTTAAAGG + Intronic
1136546826 16:30959165-30959187 CCTCCCAGTCCCTAAGTTTAAGG + Exonic
1141429301 16:83962904-83962926 CCCCCAAATCACTAAGTTAAAGG - Intronic
1142836969 17:2594196-2594218 CCTCCGGGTCTCTCACTCAACGG - Intronic
1149914311 17:60594464-60594486 CCTCCTAGTTTCTATCTTAAAGG + Intergenic
1154391042 18:13936484-13936506 CCTCTGGGTCACTAGCTTAGAGG - Intergenic
1157763230 18:50280348-50280370 CCTCCCTGTCACTGACCTAAGGG + Intronic
1157912932 18:51636344-51636366 CCTCCAACTCACTAAGCTAAAGG + Intergenic
1166590925 19:43997828-43997850 CCTCCGGCTCACTCAGTTAAGGG + Exonic
925164078 2:1704857-1704879 CCCCCAAATCACTAAGTTAAAGG - Intronic
925930430 2:8702976-8702998 CCTCAGAATCACTAAGCTAAAGG - Intergenic
934791553 2:97066678-97066700 CCTCAAAGTCACTAAGCTAAAGG - Intergenic
934814885 2:97315865-97315887 CCTCAAAGTCACTAAGCTAAAGG + Intergenic
934822810 2:97392618-97392640 CCTCAAAGTCACTAAGCTAAAGG - Intergenic
935514992 2:104024967-104024989 CCTTTGAGTTCCTAACTTAAAGG - Intergenic
936477146 2:112849132-112849154 CCTCCAAATCACTAAGCTAAAGG + Intergenic
944543823 2:200779533-200779555 ACTCAGTCTCACTAACTTAAGGG + Intergenic
1170835554 20:19881343-19881365 CCTGCGCATCACTAACTAAAGGG + Intergenic
1172335240 20:34110654-34110676 CCTCCAAGTCACTACGTTGATGG + Intronic
1175976844 20:62715187-62715209 CCTCAGAGTCACCATCTGAACGG - Intronic
952485891 3:33809401-33809423 CATTCGAGTCACTAAATTATAGG - Intronic
960217947 3:115065859-115065881 CTTCTGAGTCACTACTTTAAGGG - Intronic
960227347 3:115183999-115184021 CCTCAGAATCACTAAGCTAAAGG + Intergenic
961526468 3:127502840-127502862 CCTCAAAGTCACAAACATAATGG + Intergenic
962399371 3:135044093-135044115 CTTACAAATCACTAACTTAAGGG + Intronic
964448327 3:156784423-156784445 CCTCCAAATCATTAAGTTAAAGG - Intergenic
966365042 3:179176308-179176330 CCTCCTAGTCCTGAACTTAATGG + Intronic
968379241 4:74874-74896 CCTCCAAATCACTAAGCTAAAGG - Intronic
973170855 4:47141750-47141772 CATGCCACTCACTAACTTAAAGG + Intronic
979083706 4:116378461-116378483 GCTTCAAGTCACTAACTTAATGG + Intergenic
980269660 4:130567688-130567710 CCCCCAAATCACTAAGTTAAAGG - Intergenic
982509370 4:156262226-156262248 CCCCCAAGTCACTAAGCTAACGG + Intergenic
989726471 5:44592953-44592975 CTAACTAGTCACTAACTTAAAGG - Intergenic
996132702 5:119801251-119801273 CCTCTCTATCACTAACTTAAAGG - Intergenic
998928503 5:147154970-147154992 ACTCTGAGTCACTAGCTTAGGGG - Intergenic
1003755363 6:9113479-9113501 CCTCCAAGTCATTAGGTTAATGG + Intergenic
1004471828 6:15936381-15936403 CCTCCCAGAAACTCACTTAAAGG + Intergenic
1015236141 6:130973547-130973569 CCCCCAAGTCACTAAGCTAAAGG + Intronic
1017348980 6:153417741-153417763 CCCCCAAGTCACTAAGCTAAAGG + Intergenic
1026329215 7:69337360-69337382 CCCCCAAATCACTAACTGAAAGG + Intergenic
1033045473 7:137958276-137958298 TCTCCAAGTCGCAAACTTAAGGG - Intronic
1035495714 7:159324057-159324079 CCCCCAAGTCACTAAGCTAAAGG + Intergenic
1037036123 8:14169431-14169453 CTTCCAAGTCAGTAAATTAAGGG + Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1039026014 8:33258901-33258923 GATACGAGTCACTAACCTAATGG + Intergenic
1039351725 8:36770796-36770818 CCCCCAAATCACTAAGTTAAAGG - Intergenic
1039775029 8:40727118-40727140 CCTCCAAACCACTAACTAAAAGG - Intronic
1040944437 8:52868906-52868928 CCTCAAAATCACTAAGTTAAAGG - Intergenic
1042218449 8:66450295-66450317 CCTGTGAGTCACCCACTTAAGGG - Intronic
1043692445 8:83172011-83172033 CATGGGAGTCAATAACTTAATGG + Intergenic
1047574985 8:126143136-126143158 CCTGCGTGTCATTAACTTATTGG + Intergenic
1062407562 9:136404039-136404061 CCTCCCAGGCACTCACTTGATGG + Exonic
1185773129 X:2780975-2780997 CCCCCAAGTCACTAAGCTAAAGG - Intronic
1185812267 X:3121604-3121626 TCTCCAAGTCACTAAGCTAAAGG - Intergenic
1186007892 X:5094556-5094578 CCTCCAAATCACTAAGCTAAAGG - Intergenic
1188094517 X:26005089-26005111 CCCCCAAATCACTAAGTTAAAGG + Intergenic
1190953327 X:55167535-55167557 ACTCAGAGTCACCAACTTATGGG - Intronic
1199804370 X:151283161-151283183 GTTCAGAGTCACCAACTTAATGG - Intergenic
1199859100 X:151783716-151783738 CCTACTAGTCACCAACTTGATGG + Intergenic
1200389134 X:155925839-155925861 CCTCCAAATCACTAAGCTAAAGG - Intronic
1201297565 Y:12477396-12477418 CCCCCAAGTCAGTAAGTTAAAGG + Intergenic