ID: 1118611837

View in Genome Browser
Species Human (GRCh38)
Location 14:67547458-67547480
Sequence TTCTTAGGAGAGCTCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118611828_1118611837 28 Left 1118611828 14:67547407-67547429 CCCTAGCAGAGCCAAGACAAGTT 0: 1
1: 0
2: 1
3: 11
4: 115
Right 1118611837 14:67547458-67547480 TTCTTAGGAGAGCTCCTGCTGGG 0: 1
1: 0
2: 3
3: 9
4: 119
1118611829_1118611837 27 Left 1118611829 14:67547408-67547430 CCTAGCAGAGCCAAGACAAGTTA 0: 1
1: 1
2: 1
3: 26
4: 273
Right 1118611837 14:67547458-67547480 TTCTTAGGAGAGCTCCTGCTGGG 0: 1
1: 0
2: 3
3: 9
4: 119
1118611830_1118611837 17 Left 1118611830 14:67547418-67547440 CCAAGACAAGTTATAGATCGCAG 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1118611837 14:67547458-67547480 TTCTTAGGAGAGCTCCTGCTGGG 0: 1
1: 0
2: 3
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118611837 Original CRISPR TTCTTAGGAGAGCTCCTGCT GGG Intronic
900959181 1:5908566-5908588 GTCTGAGCTGAGCTCCTGCTTGG - Intronic
901417202 1:9125516-9125538 TTCCCAGGAGAGCACCTGCGTGG - Intronic
902557410 1:17255110-17255132 TTCTTAGAAGTGCTCCAGGTGGG - Intronic
905140662 1:35841317-35841339 CTCTTGGGAGATCTCCTGCCGGG - Exonic
906133322 1:43475683-43475705 TTCCTAGGAGAGCCCCCGCATGG + Intergenic
911686254 1:100780646-100780668 CTCATAGGAGAACTTCTGCTAGG - Intergenic
912643711 1:111371188-111371210 TTATTGGTAGAGCTCCTGATGGG + Intergenic
915609289 1:156978281-156978303 TGATTCGGGGAGCTCCTGCTGGG + Exonic
920100775 1:203515761-203515783 TGCTTGGGAGAGCCCCTGCCAGG + Intergenic
921878041 1:220220981-220221003 TTCTTCTGAGGGCTGCTGCTGGG + Intronic
922870991 1:228901865-228901887 TTCTAAGGTGAGCTCTTCCTCGG + Intergenic
923832682 1:237575309-237575331 GTGTCAGGAGAGCTCCTCCTAGG - Intronic
923835096 1:237602578-237602600 TTATTAGGAGAGGTCATTCTGGG + Intronic
1063432028 10:5999473-5999495 TTCCTTGGAGAGCTACTGTTAGG + Intergenic
1065732593 10:28722796-28722818 TTCTTCAGCGAGCTCCTCCTAGG - Intergenic
1065779093 10:29150291-29150313 ATTTTAGGTGGGCTCCTGCTTGG - Intergenic
1066587428 10:36951538-36951560 TTCTTAGGAGCACTATTGCTGGG - Intergenic
1067093324 10:43282854-43282876 TTCCTTGCAGAGCTGCTGCTGGG - Intergenic
1067732174 10:48820369-48820391 CTCTTGAGGGAGCTCCTGCTTGG + Exonic
1071989117 10:91082629-91082651 TTCTTACGAGATCTGATGCTGGG + Intergenic
1080120433 11:28670671-28670693 TTTTTAGGAAAGATTCTGCTTGG + Intergenic
1085805823 11:79635083-79635105 GTCTGAGGCCAGCTCCTGCTAGG + Intergenic
1085981129 11:81727504-81727526 TTCTTAGGATAAATCCTACTTGG + Intergenic
1089043847 11:115481513-115481535 TTCTTAGGAGATCTCATCCATGG + Intronic
1089769476 11:120793057-120793079 TTCTTAGGACAGCACCTGGCAGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1092515887 12:9212047-9212069 TCCTTAGGAGGGCTCCTACTGGG + Intergenic
1095624239 12:44296244-44296266 TTCTTAAGAGGGCTCCCACTGGG + Intronic
1097303689 12:58045730-58045752 CACAAAGGAGAGCTCCTGCTTGG + Intergenic
1097712259 12:62929948-62929970 CTCTTTGCAGAACTCCTGCTTGG - Intronic
1098557432 12:71835342-71835364 TTCTTTGGACAGCTCCTGCATGG + Intergenic
1098718470 12:73863410-73863432 TTCTTAGCTGAACTTCTGCTGGG + Intergenic
1100093843 12:91007215-91007237 TTCTTAGTAGTGCCCATGCTTGG + Intergenic
1101423395 12:104567609-104567631 TTCACAGGAGAGCTCATGCTAGG - Intronic
1102833185 12:116026762-116026784 TTCTTAGAAGTGCTGTTGCTAGG - Intronic
1106931982 13:34676180-34676202 TTCTTGGGAGAGCACTTTCTTGG - Intergenic
1117180744 14:53189203-53189225 TTCATTGGAGAGCACCTGCCAGG + Intergenic
1117215523 14:53547662-53547684 TTCCCAGTAGGGCTCCTGCTTGG + Intergenic
1117560870 14:56936956-56936978 TTCTTAGGAGATATCATGGTTGG - Intergenic
1118116673 14:62785470-62785492 TTTTTAGGTCAGCTCCCGCTGGG + Intronic
1118611837 14:67547458-67547480 TTCTTAGGAGAGCTCCTGCTGGG + Intronic
1119215688 14:72867435-72867457 CTCATAGGAGAGCTAGTGCTTGG - Intronic
1119683521 14:76611602-76611624 TTCCTGGAAGAGCTCCTCCTAGG - Intergenic
1124508671 15:30303725-30303747 TCCTTGGGATAGCTCCTCCTGGG + Intergenic
1124734886 15:32234936-32234958 TCCTTGGGATAGCTCCTCCTGGG - Intergenic
1124871881 15:33551988-33552010 TTCTTAGGAAAACACTTGCTTGG - Intronic
1125796963 15:42410245-42410267 TCCTTAGGAGAGCGGCTCCTGGG + Intronic
1127558454 15:60111456-60111478 TTCTAATGAGAGTTCATGCTGGG + Intergenic
1128633463 15:69287805-69287827 CTCCTAGGAGAGCCGCTGCTTGG - Intergenic
1130430540 15:83842642-83842664 ATTTTAAGAGAGCTACTGCTTGG + Intronic
1131111439 15:89767363-89767385 TTCTGAGGGGACCTGCTGCTGGG + Intronic
1132350115 15:101134099-101134121 CTCTGAGGAGGGATCCTGCTGGG - Intergenic
1132763078 16:1520407-1520429 TTCTTGTGAGAGCTCCTGCTCGG - Intronic
1139299736 16:65934674-65934696 ATCTAAGATGAGCTCCTGCTAGG - Intergenic
1140020912 16:71237780-71237802 TTCTTAGGAGAGAATCTGATTGG + Intergenic
1143869254 17:9946450-9946472 ATCTTCAGAGAGCTCCAGCTTGG - Intronic
1145955978 17:28854988-28855010 ATCGTAGGAGCGCTCCTGGTCGG + Exonic
1147550198 17:41436356-41436378 TTCCTCTGAGAGCTCCTGCTTGG - Intergenic
1149982075 17:61318649-61318671 TTCTGAAGAGCACTCCTGCTCGG + Intronic
1152827393 17:82475863-82475885 TCCTTATGAGAGGTCCTACTGGG - Intronic
1153915344 18:9739917-9739939 TGCTTAGGAGAGAAACTGCTGGG - Intronic
1159493986 18:69176853-69176875 TTCTGCTGATAGCTCCTGCTAGG + Intergenic
1164877211 19:31699894-31699916 TTCTTAGGACATCACCTCCTGGG - Intergenic
1165897855 19:39154213-39154235 TACCCAGGAGAGCTCTTGCTAGG + Intronic
925070645 2:964839-964861 TTCTGAGAAGAGCTCCTCTTGGG + Intronic
928453355 2:31398385-31398407 TACTTGGGAGAACTCCTGGTTGG - Intronic
929333477 2:40712431-40712453 CCCTTAGCAGAGCTCCAGCTGGG + Intergenic
930185988 2:48412540-48412562 TTCTTAGCAGAGGAACTGCTAGG + Intergenic
932045535 2:68345341-68345363 TTCTTAGGATAACAGCTGCTTGG - Intergenic
933606728 2:84391312-84391334 TTCTTAGGCTGGCTCCTGTTGGG - Intergenic
934690463 2:96354633-96354655 TTCTTAACAGATTTCCTGCTGGG + Intronic
937442799 2:121931278-121931300 TTCTTAGGAAAACACCTGCCAGG - Intergenic
938191434 2:129285294-129285316 TTCTCAAGAGAGCTACTGCTGGG + Intergenic
939608195 2:144277954-144277976 TTCCTAGGAGTGCTTCTCCTTGG - Intronic
940869218 2:158846175-158846197 TCCTTTGCAGACCTCCTGCTGGG + Intronic
941242734 2:163060806-163060828 TTCTTAGGACAAATCCTACTTGG - Intergenic
941431292 2:165417462-165417484 TACTCAGGAGAGTTCATGCTCGG + Intergenic
943447282 2:188003008-188003030 TTCTTAGTAGAGCTCTTTGTTGG + Intergenic
944098922 2:196001007-196001029 TTTTTATTAGAGCTCCTCCTTGG - Intronic
944805012 2:203272246-203272268 TGGTGAGGAGAGTTCCTGCTGGG + Intronic
948277984 2:236724753-236724775 TTCCCAGGTGAGCACCTGCTTGG + Intergenic
948337665 2:237223425-237223447 TTCTTAGGGGAATTCCTGCAGGG - Intergenic
1177098121 21:16864786-16864808 TTCTTAGGAGGGATCCTCTTAGG - Intergenic
1179363693 21:40736243-40736265 TTCAGAGGAGAGCTCCTGGGTGG - Intronic
1183610517 22:38900731-38900753 TTCTAAGAAGAGCACATGCTTGG + Intergenic
952652248 3:35740027-35740049 TTCATAGAGGAGCTCCTGCCTGG - Intronic
959283377 3:104376726-104376748 TTCTTAGGAGAGCACTTGTAAGG - Intergenic
961174936 3:124827288-124827310 TGCTTTGCAGAGCTGCTGCTAGG + Intronic
965961855 3:174439105-174439127 TTCTTAGGAGAACTTCTTCAGGG - Intronic
968702400 4:2063154-2063176 TTTATAGGAAAGCTCCTCCTGGG + Intronic
970850479 4:20596983-20597005 TTCTTAGGAAATCTGCAGCTAGG + Intronic
972794682 4:42403591-42403613 TTCTAAGGAGAGCTCATTTTGGG - Intergenic
973137887 4:46729774-46729796 TTCTTTGGACAGCTCATGATAGG - Intergenic
983711623 4:170723720-170723742 TGACTAGGAAAGCTCCTGCTTGG - Intergenic
992153116 5:73925959-73925981 TACTTAGGAGAATTGCTGCTAGG + Intronic
995433898 5:112113930-112113952 TTTTAAGGAGAGCTCTTGTTGGG + Intergenic
996748881 5:126869344-126869366 TTCTGAGGAGAGCGCTGGCTGGG - Exonic
1000007525 5:157200795-157200817 TTGGTAGGAGAACTCCTCCTTGG + Intronic
1001041016 5:168335275-168335297 TCATTAGGAGAACTGCTGCTGGG - Intronic
1008172670 6:48228617-48228639 GATTTAGGAGTGCTCCTGCTGGG - Intergenic
1008458495 6:51740098-51740120 TTCTCAGAAGATCACCTGCTTGG + Intronic
1010665848 6:78629335-78629357 TTCTCTGCAGAGCTGCTGCTGGG + Intergenic
1011694018 6:89895821-89895843 TTCTCGGAATAGCTCCTGCTTGG + Exonic
1013320187 6:108980514-108980536 TCCTGAGGAGAACGCCTGCTGGG + Intergenic
1014747991 6:125222350-125222372 GTCTGAGGAGAGATCCTACTGGG + Intronic
1016711922 6:147183360-147183382 TTCTTTGTAGAGTTCTTGCTAGG - Intergenic
1017806079 6:157946566-157946588 TTCTTACAAAAGCACCTGCTGGG - Intergenic
1021227977 7:18050922-18050944 GTCTTAGGAGACCTCTTCCTGGG - Intergenic
1022497391 7:30861668-30861690 TGCTTAGCACAGCTCCTGGTGGG + Intronic
1023035426 7:36127373-36127395 TCCTCAGGAGAGCTCCTTCTGGG - Intergenic
1024675194 7:51631876-51631898 CTCAGAGGTGAGCTCCTGCTGGG + Intergenic
1029820597 7:103142826-103142848 TTTTTAAAAGATCTCCTGCTAGG + Intronic
1038999446 8:32963457-32963479 ATCCCAGCAGAGCTCCTGCTGGG - Intergenic
1041134505 8:54742905-54742927 TTCCTTGGACAGCTTCTGCTGGG - Intergenic
1041390513 8:57343549-57343571 TCCTTAAGAGAGGTCCTGCTTGG + Intergenic
1041884878 8:62797121-62797143 TCCTGAGGAGAGATCCTTCTCGG - Intronic
1046344482 8:112904519-112904541 TACTTAGGAGAGCTACTGGGAGG + Intronic
1047573112 8:126122642-126122664 TCCCTGGGAGAGCTCTTGCTGGG + Intergenic
1048015741 8:130495552-130495574 TTCTTAGAAGTGGTACTGCTCGG - Intergenic
1057459186 9:95244210-95244232 TTCTCAGGAGAGCCCCTGCTGGG - Intronic
1060743503 9:126114620-126114642 GTATTAGGAGAGCTAATGCTTGG - Intergenic
1060764678 9:126284686-126284708 TTCTTAGGATAGCCAGTGCTTGG - Intergenic
1061012655 9:127964511-127964533 CTCTGAGGAGAGCCCCTGATGGG - Intronic
1062245876 9:135565795-135565817 TTTCTAGGTGAGCTCCTGCCTGG + Exonic
1187279119 X:17843888-17843910 TTCTTAGGAGAGAAGTTGCTTGG + Intronic
1187968552 X:24637053-24637075 TTCTTAGGAATGCAACTGCTGGG + Intronic
1188635411 X:32424590-32424612 TGCTTAGGAGAGCCCATGCTTGG + Intronic
1189776105 X:44471293-44471315 TTCTTAAGAGAGCTGCTGCTGGG - Intergenic
1195753917 X:108182336-108182358 TACTCAGTAGAGCTCCTGCAAGG + Intronic
1197133448 X:123032862-123032884 TTCTTAGGAGCTTTCCTTCTAGG + Intergenic
1198787803 X:140309809-140309831 TTCTTAGGAAAGATCCTACTTGG - Intergenic
1200898322 Y:8400392-8400414 TTCTTAGAAGAGGTTTTGCTGGG + Intergenic