ID: 1118611873

View in Genome Browser
Species Human (GRCh38)
Location 14:67547638-67547660
Sequence CCTGTAGGGTGAGCAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118611867_1118611873 27 Left 1118611867 14:67547588-67547610 CCTGGGACATTACATGGGCTGAT 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1118611873 14:67547638-67547660 CCTGTAGGGTGAGCAAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 194
1118611866_1118611873 28 Left 1118611866 14:67547587-67547609 CCCTGGGACATTACATGGGCTGA 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1118611873 14:67547638-67547660 CCTGTAGGGTGAGCAAAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118611873 Original CRISPR CCTGTAGGGTGAGCAAAGCC TGG Intronic
900269412 1:1779214-1779236 CCTGTGGGGTGCGCAAAACACGG - Intronic
901469254 1:9444248-9444270 CCTGCAGGATGAGCACAGGCAGG + Intergenic
902732073 1:18376288-18376310 ACTGTAGGGAGAGAAAGGCCAGG - Exonic
903543885 1:24111612-24111634 CCTGTGGGGTTGGCCAAGCCGGG + Intronic
904083880 1:27889775-27889797 CCTGTGGGATGAGCACAGGCAGG - Intergenic
904961855 1:34339663-34339685 CTTGCTGGGAGAGCAAAGCCTGG + Intergenic
908174444 1:61540492-61540514 CCTGGAGGGTCAGAGAAGCCTGG - Intergenic
910547378 1:88433272-88433294 CCTGAAGGGTGAGGCCAGCCAGG + Intergenic
911878212 1:103197170-103197192 CCTGTAGTGTGCACAAAACCTGG + Intergenic
914370414 1:147019773-147019795 ACTATGGGGTGACCAAAGCCAGG + Intergenic
914484280 1:148093637-148093659 ACTATGGGGTGACCAAAGCCAGG - Intergenic
915636747 1:157192940-157192962 TCTGTAGGGTGGGCAGATCCAGG - Intergenic
915657642 1:157375024-157375046 CCTGTAGGGTGGGCAGATGCAGG - Intergenic
917638706 1:176961395-176961417 CCTGTAGGGGAAGCAAAGTCAGG + Intronic
919866451 1:201786627-201786649 CCTGCAGGGTGAGGCAAGGCAGG + Intronic
920250466 1:204619275-204619297 CCTGGAGGGGCTGCAAAGCCTGG - Exonic
922164428 1:223103137-223103159 CCTGCAGGTTGTGCCAAGCCTGG - Intergenic
923269952 1:232346606-232346628 CCTGTGGGGTGAGGAGAGGCAGG + Intergenic
923917822 1:238529361-238529383 ACTGTGGGCTGAGCACAGCCTGG - Intergenic
1066293024 10:34031031-34031053 CCTGTGCTGGGAGCAAAGCCGGG - Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1067415000 10:46096137-46096159 CCTGTAGGGGGAACAGAGCTGGG - Intergenic
1067438708 10:46296280-46296302 CCTGTAGGGGGAACAGAGCTGGG + Intronic
1069817917 10:71210273-71210295 CCTGGAGGGAGAGCAGGGCCCGG + Intergenic
1072805408 10:98420901-98420923 CCTGTAGGATGTGCTGAGCCAGG + Intronic
1075650960 10:124128213-124128235 CAGGTAGGGTGAGGCAAGCCCGG - Intergenic
1077046776 11:550206-550228 CCTCCAGGGTGAGCATGGCCAGG - Exonic
1077336874 11:2009267-2009289 GCTGTAGGGTCAGCAGAGGCTGG - Intergenic
1078470610 11:11583081-11583103 CCAGGAGGGCCAGCAAAGCCTGG + Intronic
1078999065 11:16735227-16735249 TCTATAGGCTGATCAAAGCCGGG - Intronic
1080250988 11:30233654-30233676 TCTGCATGGTGAGCACAGCCGGG - Exonic
1083772437 11:64875782-64875804 CCTGCAGGGCGAGCAAAACGTGG + Intronic
1202819858 11_KI270721v1_random:64449-64471 GCTGTAGGGTCAGCAGAGGCTGG - Intergenic
1091722220 12:2821589-2821611 CCTGGATGGTGAGCAATGCTAGG + Exonic
1091747921 12:3004251-3004273 CCTGTCGGGGGAGCATATCCTGG + Intronic
1093212504 12:16324934-16324956 CCTGTAGGGTTACCACAGCTGGG - Intergenic
1094704672 12:32902874-32902896 GCTGAAGGGTGAGCACAGCATGG + Intergenic
1097288206 12:57893693-57893715 CCTCAAGTGTGAGCCAAGCCAGG - Intergenic
1102680299 12:114686324-114686346 CCTGAAGGGTGCGAAAGGCCAGG + Intergenic
1102863145 12:116353819-116353841 CCTGAAGTCTGAGCAAGGCCAGG - Intergenic
1103799109 12:123525752-123525774 CCTGGAGGTTGAGACAAGCCTGG - Intronic
1104636777 12:130442505-130442527 CCTGGAGGGAGAGCACATCCTGG - Exonic
1104819492 12:131666673-131666695 CGGGAAGGGTGAGCACAGCCAGG + Intergenic
1105775254 13:23653851-23653873 TCTGCAGGGAGAGCACAGCCAGG + Intronic
1105900031 13:24745878-24745900 CCTGCAGGGTGAGCCACGCGGGG + Intergenic
1107414551 13:40188598-40188620 CCAGAAGGGTCAGCACAGCCAGG + Intergenic
1111905379 13:94249685-94249707 CCTGTATTGTGGTCAAAGCCTGG - Intronic
1112344675 13:98579167-98579189 CTTCTAGGGTCAGCAGAGCCAGG + Intergenic
1113243211 13:108363563-108363585 TCTGAAGGGTTAGAAAAGCCTGG - Intergenic
1113658879 13:112090264-112090286 CTTGTTGAGTGAGCAAATCCAGG - Intergenic
1116356788 14:43939571-43939593 ACTGGAGGGTGAGCAAGGCAGGG - Intergenic
1118611873 14:67547638-67547660 CCTGTAGGGTGAGCAAAGCCTGG + Intronic
1121527986 14:94632787-94632809 ACTGGAGGGTGAGCAAGGCATGG + Intergenic
1121724769 14:96139238-96139260 CCTGTAGAGTGGGAAAAGCATGG - Intergenic
1122204833 14:100143197-100143219 CCTGAGGAGTGAGCAGAGCCAGG + Intronic
1122386200 14:101350005-101350027 CCTGTAGAGTAGGCAAAGGCTGG - Intergenic
1125604049 15:40930109-40930131 CCTGGCCGGTGAGCACAGCCTGG + Exonic
1125612067 15:40978257-40978279 CGTGCAGGGTGAGCAAGGCTAGG + Intergenic
1130655001 15:85786342-85786364 CCTGAAGGGTGGGGAGAGCCTGG + Intronic
1131380608 15:91960702-91960724 CCTGTAGGATGAGCAAAGAAGGG - Intronic
1131643521 15:94317489-94317511 CCTTGAGGCTGAGCAATGCCCGG - Intronic
1132227026 15:100150695-100150717 CCTGTAGGGCCAGCTCAGCCTGG + Intronic
1132898243 16:2238898-2238920 CCTGTACTGTGAGCACAGCTGGG + Intergenic
1133765191 16:8832877-8832899 CCTGGAGGGTGAGGGAACCCTGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1137752755 16:50879221-50879243 CCTGATGGGTGCCCAAAGCCAGG - Intergenic
1137977602 16:53044330-53044352 CCTGTGGGGTGGGCAGGGCCTGG + Intergenic
1140170581 16:72599891-72599913 CCTGTAGGGTGAGTCCAGGCCGG + Intergenic
1141946707 16:87315703-87315725 CCTGTGGGGTGAGGAGAGCAGGG - Intronic
1142176054 16:88646002-88646024 TCTGTAGGCTGAGCCAAGGCTGG - Intronic
1142191518 16:88720370-88720392 CCTTTGGGGTGAGCCAGGCCCGG - Exonic
1142234301 16:88914728-88914750 CCTGCCGGTTGAGCAAAGCCTGG + Intronic
1142509162 17:383913-383935 CCAGGGAGGTGAGCAAAGCCAGG + Intronic
1142807588 17:2379662-2379684 CCTGCAGGGTCAGCACTGCCGGG - Exonic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1145867380 17:28249929-28249951 CTTCTAGGGTGAGCAGAGCGGGG - Intergenic
1146818817 17:35968040-35968062 CCTGTATGTGGAGGAAAGCCGGG + Intergenic
1148553519 17:48564444-48564466 CCTGGAGGCCGAACAAAGCCGGG - Intronic
1148560690 17:48604280-48604302 CCTGGAGGGGGAGCCAAGGCAGG - Intronic
1148574304 17:48698535-48698557 CCTGTAGTTTGAGCCCAGCCTGG - Intergenic
1148821658 17:50363585-50363607 TCTGTAGGGTTAGCTCAGCCTGG + Intergenic
1151955297 17:77377073-77377095 CTTGAAGGGGGAGCAAAGGCGGG - Intronic
1152078317 17:78171717-78171739 CCTGCAGGGGGAGCACAGCAGGG - Exonic
1152576578 17:81143823-81143845 CCCGACGGGTGAGCAGAGCCTGG - Intronic
1152637277 17:81435267-81435289 CCTGATGGGTTAGTAAAGCCAGG - Intronic
1152704293 17:81834749-81834771 CCCCTCAGGTGAGCAAAGCCTGG - Exonic
1154165392 18:12010757-12010779 CAGGAAGGGTGAGCAGAGCCCGG + Intronic
1155586600 18:27373371-27373393 ACTGTAGGGTGAACTCAGCCCGG + Intergenic
1157080667 18:44521522-44521544 CCTGGAGAATGTGCAAAGCCTGG + Intergenic
1157913782 18:51644463-51644485 CCTGCAGGGTGTGTGAAGCCTGG + Intergenic
1161622410 19:5305205-5305227 CCTGGATGGTGGGAAAAGCCTGG - Intronic
1161888848 19:7019218-7019240 CCAGGAGGGTGAAGAAAGCCAGG - Intergenic
1161890520 19:7032803-7032825 CCAGGAGGGTGAAGAAAGCCAGG + Exonic
1161890928 19:7037930-7037952 CCAGGAGGGTGAAGAAAGCCAGG - Exonic
1161892606 19:7051531-7051553 CCAGGAGGGTGAAGAAAGCCAGG + Exonic
1161893011 19:7056391-7056413 CCAGGAGGGTGAAGAAAGCCAGG - Exonic
1162044470 19:7989224-7989246 GCGGCAGGCTGAGCAAAGCCAGG + Intronic
1163314372 19:16532167-16532189 CCTGATGGCTGAGCAAAGTCAGG + Intronic
1163698625 19:18776207-18776229 CCTGTCTGGTGAGCCCAGCCTGG + Intronic
1163726793 19:18927744-18927766 TCTGTGGGGACAGCAAAGCCGGG - Exonic
1165828493 19:38719027-38719049 CCTGCAGGGGGAGCCAGGCCCGG - Intronic
1166631715 19:44412530-44412552 GCTGTGGGGTGAGGATAGCCTGG - Intergenic
1166636462 19:44456091-44456113 GCTGTGGGGTGAGGATAGCCTGG + Intergenic
925177293 2:1794542-1794564 CCTGTGGGGTGACCAAGGCAGGG + Intronic
925783665 2:7407316-7407338 CCTGTAAGGTGGGCAATGCGGGG - Intergenic
925905010 2:8535096-8535118 CCTGCAGGGTCAGCAAAGACAGG + Intergenic
927996526 2:27490880-27490902 CCTATCGGGTGAGCCAAGTCAGG - Intergenic
928836729 2:35556175-35556197 CTTGCAGGTTGAGCAAAGCAAGG - Intergenic
929243785 2:39679917-39679939 CCTGTATGCTGAAAAAAGCCTGG + Intronic
929819393 2:45261279-45261301 CCTGAAGGGTGAACAAAGAGAGG + Intergenic
937846459 2:126584357-126584379 AGTTTAGGGTGAGCAAAACCTGG + Intergenic
938541295 2:132286145-132286167 GCTGTGGGGTGAGGATAGCCTGG + Intergenic
940909505 2:159197808-159197830 CCAGTAGGGTGAAAAAAGCAGGG + Intronic
941548307 2:166882250-166882272 GCTGTAGGTTGAGCAAAGCAAGG - Intergenic
941905978 2:170716389-170716411 CCTGGAGGGTGAGCCCAGCGCGG - Exonic
943419652 2:187654836-187654858 CCTGAAGGGTGAGTAAGGCAGGG - Intergenic
944073048 2:195694914-195694936 TCTGAAGGGTGAGCACAGCAGGG + Intronic
946385352 2:219381198-219381220 CCAGTAGAGTGAGAAAAGCAGGG - Intronic
1168937660 20:1680412-1680434 CATATCAGGTGAGCAAAGCCTGG - Intergenic
1169304345 20:4475429-4475451 CTTGTAGGAAGAGCAAGGCCGGG + Intergenic
1170501718 20:16981548-16981570 CCTGCAGGATGAGCAGAGGCTGG + Intergenic
1173660088 20:44727255-44727277 CCTGGAGGGTGGGCAGGGCCTGG - Exonic
1174350683 20:49965391-49965413 CCTGAAAGGTGATCAAAACCAGG + Intergenic
1175447453 20:59032693-59032715 CCTGAAGCGGGCGCAAAGCCAGG - Intergenic
1176385072 21:6135065-6135087 CCTGGACGGTCAGCAAGGCCTGG - Intergenic
1177814464 21:25960760-25960782 CCTATTGGATAAGCAAAGCCTGG + Intronic
1179044391 21:37831721-37831743 CCTGCAGGGTGAGCTGAGCTAGG - Intronic
1179738401 21:43403187-43403209 CCTGGACGGTCAGCAAGGCCTGG + Intergenic
1180619172 22:17148560-17148582 CCTGTAGGGACAGCCAAGACAGG + Exonic
1181134061 22:20751921-20751943 GCAGTAAGGTGAGCAACGCCTGG + Intronic
1181590508 22:23882396-23882418 CCTGTAGGGGGACCAAAGAGGGG + Intronic
1181863698 22:25839355-25839377 CCTGCAGGGTGAGCACGGCCAGG - Intronic
1181866489 22:25861010-25861032 CCTGTAGTCTGAGCAACGCAGGG - Intronic
1182309066 22:29391896-29391918 ACTGTAGGCTGAGCAAGGGCAGG - Intronic
1183489958 22:38110912-38110934 CCAGTAAGGTGGGCAATGCCTGG - Intergenic
1183949962 22:41347371-41347393 CCTGTGGGGAGGGCAAACCCAGG - Intronic
1184907579 22:47499215-47499237 CCTGATGTGAGAGCAAAGCCAGG - Intergenic
949196276 3:1312742-1312764 CATGCAGGGGGAGCAAAGCATGG + Intronic
951710812 3:25583653-25583675 CCTGGAAGGTGAGCAAGGGCAGG - Intronic
952543572 3:34395203-34395225 CCTGGATGGTGTGCATAGCCTGG + Intergenic
954350765 3:50041609-50041631 CCTGCAGAAAGAGCAAAGCCCGG - Intronic
954439368 3:50513288-50513310 CTTGAGGGGTGAGCAGAGCCTGG - Intergenic
955487230 3:59447450-59447472 CCTGCAGGGTCACCACAGCCTGG + Intergenic
955536598 3:59930210-59930232 CCTGGAGAGTGAGAAAAGCCAGG + Intronic
955945698 3:64191542-64191564 ACCGTAGGGTGAGTAAAGCAAGG - Intronic
961454575 3:127017679-127017701 CCCGTAGGCTGGGCCAAGCCAGG + Intronic
961650926 3:128416314-128416336 CCTGCAGGGTGGGCCAGGCCGGG - Intergenic
962366258 3:134786103-134786125 GCTGTAGGGTGACTACAGCCAGG - Intronic
962848474 3:139290319-139290341 CCTGTAGGGTGGGCATGGCAGGG + Intronic
965785470 3:172330417-172330439 CAGGTAGAGTAAGCAAAGCCAGG - Intronic
968908236 4:3464150-3464172 CCTGTAGGGAGGGCTGAGCCGGG + Intronic
970371548 4:15412139-15412161 CCTCTGGGGTGATCAGAGCCAGG - Intronic
970980755 4:22094337-22094359 CCTGTAGTATGGTCAAAGCCAGG - Intergenic
971001644 4:22329856-22329878 CCCGTAGAGTGAACAAAACCAGG - Intergenic
972548102 4:40100992-40101014 CTTCTAGGGAGAGCCAAGCCTGG + Intronic
975831822 4:78377124-78377146 CCTTTATGGTGAGTAAAGCTTGG + Intronic
986071727 5:4291807-4291829 CCAGAAGGGTCAGCAAAGTCAGG - Intergenic
990313855 5:54565959-54565981 CCTGTTGCCTGAGAAAAGCCTGG + Intergenic
992197554 5:74354882-74354904 CCTGCATGATGACCAAAGCCTGG + Intergenic
993328283 5:86567986-86568008 CCGATAGGGGGAGCACAGCCTGG - Intergenic
993902639 5:93595171-93595193 CCATAAGGGGGAGCAAAGCCAGG - Intergenic
997717276 5:136051718-136051740 CTTGGAGGGTGAGCAGGGCCAGG - Intronic
1000050710 5:157560737-157560759 GCTGTTTGGTGAGCAAACCCTGG - Intronic
1000589964 5:163146564-163146586 CATGGAGGGTGAGCAGAGGCAGG + Intergenic
1002446797 5:179295050-179295072 CCAGTAGGGTGCTCAAGGCCTGG - Intronic
1003897542 6:10622020-10622042 CCTGTAGGGGGAGCAGGGACTGG - Intronic
1005203772 6:23377523-23377545 CTTGTAGGGAGAGCAGAGCTTGG + Intergenic
1007476414 6:42122647-42122669 TCTGTAGGGTGAGCCAGGCAAGG - Intronic
1007909872 6:45502867-45502889 CCAGCAGGGTCAGCACAGCCTGG + Intronic
1010287555 6:74096769-74096791 CCTTTAGGATGGGCAAAGTCAGG - Intergenic
1019188003 6:170232289-170232311 ACAGAAGGGTGAGCCAAGCCCGG + Intergenic
1020555331 7:9663656-9663678 TTTGAAGGGTGAGCAAAGCAGGG + Intergenic
1021409200 7:20309722-20309744 CATGTAGGTTGAGCACTGCCAGG + Intergenic
1022972325 7:35529625-35529647 CCTGTAGGATGTGCCAACCCTGG + Intergenic
1023159677 7:37284995-37285017 CTGGTAGGGAGAGCAGAGCCCGG - Intronic
1023818976 7:43969861-43969883 CCTGTGGGGTCAGCTCAGCCAGG + Intergenic
1024249725 7:47496848-47496870 TCTGTGGGGTGAGCCAAGGCAGG + Intronic
1026166597 7:67915693-67915715 CCTGTAGGGTAAGAATAGACTGG - Intergenic
1027974500 7:85133618-85133640 CCAGTAGGCTGAGCAATCCCTGG - Intronic
1028987824 7:97021807-97021829 CCTCGGGGGTGAGCAAGGCCTGG - Intronic
1029744027 7:102506824-102506846 CCTGTGGGGTCAGCTCAGCCAGG + Exonic
1029762017 7:102605987-102606009 CCTGTGGGGTCAGCTCAGCCAGG + Exonic
1032237178 7:130135421-130135443 CCTGTAGGAAGAGCAAAGCTAGG - Exonic
1034420443 7:150987723-150987745 CCTGAAGGTTGATCAAGGCCTGG - Intergenic
1038651358 8:29406759-29406781 AGAGTAGGGTCAGCAAAGCCTGG - Intergenic
1043511252 8:80952514-80952536 CATGGAGGGTGAGCAAAGGAAGG + Intergenic
1043695250 8:83208925-83208947 ACTGGAGGGTGAGCAAGGCAGGG - Intergenic
1046051232 8:109024856-109024878 CCTGTAGTGGAAGAAAAGCCAGG - Intergenic
1046214855 8:111130977-111130999 CCTGTGGGATGAGGAAACCCAGG - Intergenic
1046785153 8:118257913-118257935 CCTGAATGGTGAGCAAGGTCAGG - Intronic
1056825183 9:89872303-89872325 GCTGTTGGCTGAGCAAGGCCTGG - Intergenic
1057099513 9:92344846-92344868 CCTATAAGATGAGCAAAGACTGG - Intronic
1061969245 9:134035053-134035075 CCCTCAGGGTGAGCAAAGCCTGG + Intronic
1062474062 9:136718967-136718989 CTTCAAGGGTGAGCAAGGCCTGG - Intronic
1190247104 X:48697556-48697578 GCTGTAGGGAGAGGAAAGCGTGG + Intronic
1190944047 X:55073355-55073377 CATGGAGGGTGAGCAAAAGCAGG - Intergenic
1193525368 X:82581632-82581654 CTTGGAGGGTGAGCAAAATCAGG - Intergenic
1195164316 X:102203160-102203182 CCTGTATGGGAAGCATAGCCTGG - Intergenic
1195194544 X:102483935-102483957 CCTGTATGGGAAGCATAGCCTGG + Intergenic
1195468966 X:105211820-105211842 CATGGAGGGTGAGCAGAGGCAGG + Intronic
1198410037 X:136357511-136357533 CCTGTAGGGTGGGCAATACAGGG - Intronic
1198518908 X:137433223-137433245 CATGGAGGGTGAGCCAAGACAGG + Intergenic
1199529605 X:148831607-148831629 CCTGATAGGAGAGCAAAGCCAGG - Intronic
1200378432 X:155808935-155808957 CATGGAGGGTGAGCAAAAGCAGG + Intergenic