ID: 1118616976

View in Genome Browser
Species Human (GRCh38)
Location 14:67580656-67580678
Sequence CCATGGGGCTGCCTAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118616976 Original CRISPR CCATGGGGCTGCCTAGCCTC TGG Intronic
900772980 1:4560695-4560717 GCATGGGGATGCCTCCCCTCAGG - Intergenic
901184210 1:7361902-7361924 CCCTGGGGCTGCCTTCCTTCTGG + Intronic
901209767 1:7518293-7518315 CCATAGGGCAGCTCAGCCTCTGG - Intronic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
901632670 1:10655552-10655574 CCATGGGGCAGCCCTGCCTCTGG + Intronic
902070253 1:13728522-13728544 CCCTGGGGCTGCCCAGCGTCTGG + Intronic
903861046 1:26364755-26364777 CCAGGGGCCTTCCAAGCCTCTGG - Exonic
904416826 1:30367213-30367235 AGATAGGGCTGCCTATCCTCTGG - Intergenic
904614591 1:31743021-31743043 CCATGGTGCCGCCCAGCCACCGG - Intronic
905495213 1:38379635-38379657 CCATGGGCCTGCTTATCCTCTGG - Intergenic
906104421 1:43283338-43283360 CCCTGGGGCTGCCTGGCATCTGG - Exonic
908817775 1:68051606-68051628 CAATCGGGCTTCCTAGCCGCTGG - Exonic
912556164 1:110517693-110517715 CCAAGGGGCTGCAGATCCTCGGG - Exonic
912575975 1:110673646-110673668 CCAAGGGGCTGCAGATCCTCGGG - Exonic
915138509 1:153751167-153751189 CCATGGGACTGCCCAGCTCCAGG + Exonic
915755618 1:158256791-158256813 CCATGGGACAGCCAGGCCTCGGG - Exonic
916268723 1:162918179-162918201 CAATGGGTCTGCTCAGCCTCGGG + Intergenic
917105334 1:171485836-171485858 CCACGCGGCCCCCTAGCCTCCGG - Intronic
1063193416 10:3718605-3718627 CCATGCGTCCGCCTAGTCTCAGG - Intergenic
1066384888 10:34933646-34933668 CCAGGGGGCTGCCTGACCTTTGG - Intergenic
1067681229 10:48442595-48442617 CCATGGGGATGGGGAGCCTCGGG - Intergenic
1069684724 10:70310340-70310362 CCACTGGGCTGTCTAGCCTCAGG - Intronic
1070935661 10:80293001-80293023 CCGTGGTGCTGCCTAGGGTCAGG - Intergenic
1070956273 10:80465500-80465522 CCAGGGGGCTGCCATGCCTTTGG - Intronic
1071498519 10:86187579-86187601 TCCTGGGGCTCCCCAGCCTCTGG - Intronic
1072709624 10:97707559-97707581 CCATGAGGCAGCCTGGACTCTGG - Intergenic
1073368649 10:102966985-102967007 CCATGGGGCTACCTGGGGTCTGG + Intronic
1075085277 10:119410551-119410573 CCTTGGGGCTGCAAAGCGTCGGG - Intronic
1075766767 10:124899406-124899428 CCACGGGGCTGCCTGGCCGCAGG - Intergenic
1075965752 10:126610160-126610182 CCACAGGGCTCCCTGGCCTCTGG + Intronic
1076358634 10:129870693-129870715 CCATTGGGCTCCCTGGCCACAGG - Intronic
1077049006 11:558380-558402 CGCTGGGGCTGGCCAGCCTCCGG + Intronic
1077552901 11:3209641-3209663 CCATGGGGCTGCACTCCCTCTGG + Intergenic
1078085989 11:8233305-8233327 CCATGGGGCTGCCCTGGCTCAGG - Intronic
1078366659 11:10712250-10712272 CCAGGGTCCTGCTTAGCCTCAGG + Intergenic
1078431544 11:11292164-11292186 CCATGGGGTTGTGGAGCCTCAGG - Intronic
1079147112 11:17862738-17862760 CGATGGTGCTGCCCAGGCTCAGG + Intronic
1079170439 11:18089409-18089431 AAATGGGGCTGCTCAGCCTCTGG - Exonic
1081668946 11:44932786-44932808 CCATGAGGCTGTCCAGGCTCTGG - Exonic
1082191458 11:49250562-49250584 CTATGCTGCTGCCTAGCCTATGG - Intergenic
1082636731 11:55604202-55604224 ACATGGGGCTTCCTAGTGTCCGG + Exonic
1083363070 11:62124582-62124604 ACAAGGGGCGGCCCAGCCTCCGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084115922 11:67042952-67042974 CTGGGGGGCTGCCTAGCCTGGGG - Intronic
1086674668 11:89590455-89590477 CTATGCTGCTGCCTAGCCTATGG + Intergenic
1089387722 11:118079109-118079131 CCATGCTGCTGCCTTGCCTTTGG - Intronic
1089919578 11:122195760-122195782 CAGTGATGCTGCCTAGCCTCGGG - Intergenic
1091237525 11:134032031-134032053 CCTTGGGGCTGCCTTGTTTCAGG + Intergenic
1091410249 12:234430-234452 CCCTGGGGCTGCCCTGCCTATGG + Intronic
1092174126 12:6391172-6391194 CCCTGGGGCTGCTCAGCCTCAGG + Exonic
1094656418 12:32423648-32423670 CCATGGGGCTGCTCTGCCTATGG - Intronic
1098926072 12:76350422-76350444 CCTTGGGGCTGCTTTGCCTATGG - Intergenic
1099776610 12:87140410-87140432 CCATGGAGCTAGTTAGCCTCAGG - Intergenic
1103400662 12:120640963-120640985 ACCCGGGGCTGCCTAGCCGCCGG + Exonic
1104558407 12:129822642-129822664 CCACACGGCTGCCAAGCCTCAGG + Intronic
1104877347 12:132044887-132044909 ACAGGGGGCAGCTTAGCCTCTGG - Exonic
1108716671 13:53086070-53086092 CCATGAGGGTACCTAGCCTTGGG + Intergenic
1111190712 13:84803257-84803279 CTATGGGGCTGATCAGCCTCAGG - Intergenic
1112326100 13:98443707-98443729 CCAGAGGGCTGCCCAGCCTGTGG + Intronic
1113523222 13:110954867-110954889 CCACGGGCCTCCCTACCCTCGGG + Intergenic
1113702139 13:112395942-112395964 CCACGGGCCTCCCTACCCTCGGG - Intronic
1113863432 13:113506218-113506240 CCACGTGGCTGCCTGGCCTGTGG + Intronic
1114269352 14:21091620-21091642 CCATAGGGCTGCTTCCCCTCGGG + Intronic
1115010304 14:28537628-28537650 GCATGGGGTTGCCTAGCACCTGG - Intergenic
1118616976 14:67580656-67580678 CCATGGGGCTGCCTAGCCTCTGG + Intronic
1121915729 14:97835584-97835606 GCCTGAGGCAGCCTAGCCTCTGG - Intergenic
1122227806 14:100290055-100290077 CCCTGCGGCTGCCTGCCCTCTGG - Intergenic
1122878147 14:104678205-104678227 CCACGGGGCTTCTTAGCTTCTGG + Intergenic
1124319558 15:28702906-28702928 CCCTGGGGCTGCAGGGCCTCTGG + Intronic
1127071635 15:55292576-55292598 CCATGGGGATGCCCAGTTTCTGG + Intronic
1129189210 15:73927666-73927688 CCATGGGCCTGCGCCGCCTCGGG - Exonic
1129515830 15:76156865-76156887 CGATGCTGCTGCCCAGCCTCAGG + Intronic
1129656754 15:77529690-77529712 CCTTGGGCCTGCCTTTCCTCAGG + Intergenic
1129659931 15:77547926-77547948 CCAGGGGGCTGCCTGGCCGAGGG + Intergenic
1129847554 15:78774931-78774953 CCCTTGGGCTGCCCACCCTCTGG + Intronic
1130975203 15:88768573-88768595 CCCTGGGGCTGCTGAGCCTGAGG + Intergenic
1131260681 15:90885966-90885988 CCATGCTGCTGCCCAGTCTCTGG - Intronic
1132222704 15:100116920-100116942 CCAAGGGTCTGCCCAGCTTCCGG - Exonic
1134220094 16:12346935-12346957 CCACGGGGCTGCCAGGTCTCAGG - Intronic
1137020686 16:35424102-35424124 CCTTCATGCTGCCTAGCCTCTGG - Intergenic
1138519734 16:57564044-57564066 CCATGTCACTGCCTGGCCTCTGG + Intronic
1141487284 16:84349156-84349178 CCAGAGGGTTGCCCAGCCTCTGG - Intergenic
1143031665 17:3971390-3971412 CCTTAGGGCAGCCTGGCCTCAGG + Intergenic
1143261448 17:5601865-5601887 ACATGGGGCTTCTTAGCATCTGG + Intronic
1144807219 17:17976080-17976102 CACAGGGGCTGCCTAGCATCAGG + Intronic
1146999880 17:37354381-37354403 CCATTGGGCTGTCTAGTCTTAGG - Intronic
1147044321 17:37742472-37742494 ACAGGGGGCTCCCAAGCCTCGGG - Intronic
1148480131 17:47954556-47954578 CCATGGAGCTGCCTTCCCTGGGG + Intronic
1149298752 17:55285042-55285064 CCATGGGGTGGCCTGGACTCTGG - Intronic
1149430713 17:56594095-56594117 CCCTGCGCCTGCCCAGCCTCGGG + Exonic
1150656915 17:67045248-67045270 CCATGGGTCCCCCTAGCCTGAGG - Intronic
1151406988 17:73894585-73894607 CCATGAGGGTGCCTTGCCCCAGG + Intergenic
1152661189 17:81542964-81542986 CGATGGGGCTGCCTGGGCTTGGG - Intronic
1152681476 17:81670550-81670572 CCATGGGGCAGCCTGGATTCAGG + Intronic
1152742990 17:82026528-82026550 CCCCGGGGCTGCTTAGCCTCAGG - Intronic
1152868295 17:82736995-82737017 CCTTGGGGCTGCTAAGCCCCAGG - Intronic
1157421413 18:47550677-47550699 GCCTGGAGCTGCCTGGCCTCAGG - Intergenic
1157624558 18:49040244-49040266 CTATGGGGCTGCTTTTCCTCTGG + Intergenic
1158837266 18:61344024-61344046 CCAAGGTGCTTCCTAGCCTGTGG + Intronic
1160089054 18:75808742-75808764 CCATCGGGCTTCACAGCCTCTGG + Intergenic
1160251132 18:77204378-77204400 CCATGGCCGTGCCTGGCCTCTGG + Intergenic
1160616832 18:80136909-80136931 CAATGGGGCTGTCTGGCCTGGGG - Exonic
1160862582 19:1244040-1244062 CCAAAGGGCTGCACAGCCTCAGG - Intronic
1160974271 19:1784998-1785020 CCAAGGCGCTCCCTAGCCTGGGG - Intronic
1161202703 19:3024847-3024869 CCAGCGGGATGCCTGGCCTCAGG + Intronic
1161227040 19:3151526-3151548 CCTTGGGGCTCCATTGCCTCAGG + Intronic
1164643246 19:29841642-29841664 CCAGGGGCCTATCTAGCCTCAGG + Intergenic
1166790548 19:45396284-45396306 CTGTGGGGCTGCCTCTCCTCCGG + Intronic
1167769867 19:51508475-51508497 CCTGGGGGCTGCCTGGCCTCGGG - Intergenic
925351077 2:3201071-3201093 CTTTGGGGCTGCCGAGCCCCAGG + Intronic
926141388 2:10370593-10370615 TCATGGGGCAGCCTTGCCTGAGG - Intronic
926319753 2:11741171-11741193 CTATGGGGATGCTAAGCCTCAGG - Intronic
927408732 2:22800987-22801009 CCTTGGGGCTGCTTTGCCTATGG - Intergenic
930117133 2:47727815-47727837 CCTTGGGGCTGCTCTGCCTCTGG - Intronic
934882812 2:97998013-97998035 CCATGGAGCTGCTGAGCCTCAGG - Intergenic
937251100 2:120524324-120524346 CCACGGGGCTGGCCAGCCTGTGG + Intergenic
939638441 2:144610972-144610994 ATGTGGGGCTGCCCAGCCTCTGG + Intergenic
944412797 2:199459128-199459150 CGGTGGGGCTGCCTGTCCTCGGG + Intronic
946747606 2:222861333-222861355 CCGAGGGGCTCCCCAGCCTCGGG + Intronic
947973850 2:234347078-234347100 CCATGGGACTGCTTAGCCTGGGG - Intergenic
948827317 2:240578909-240578931 CCCTGGGCCTGAGTAGCCTCTGG + Exonic
1172904328 20:38357684-38357706 CCATGTTGCTGCTTAGCCTGTGG - Intronic
1174114002 20:48214580-48214602 CCACAGGGCTCCCTTGCCTCTGG + Intergenic
1175478485 20:59294086-59294108 CCACAGAGCTGCCTAGCCACTGG + Intergenic
1175783226 20:61696665-61696687 CCATGGGGCTGCCCTGGCCCAGG + Intronic
1178694845 21:34783862-34783884 CCAAAGTGCTTCCTAGCCTCAGG - Intergenic
1179987610 21:44930264-44930286 GCAGGGGGCTGCACAGCCTCAGG + Intronic
1180131770 21:45831179-45831201 CCATGAGGCTGGCTAGCTCCAGG + Intronic
1180193847 21:46182146-46182168 CCATGGGGCTGGCCTGGCTCTGG + Intronic
1180799963 22:18627163-18627185 ATATGGGGCCGCCAAGCCTCTGG + Intergenic
1181221752 22:21368103-21368125 ATATGGGGCCGCCAAGCCTCTGG - Intergenic
1182350040 22:29694268-29694290 CCACAGGCCTGCCTTGCCTCAGG + Intronic
1184419078 22:44369147-44369169 CCCGGCTGCTGCCTAGCCTCTGG - Intergenic
1184629160 22:45762649-45762671 CCAAGGGGCTTCCAGGCCTCAGG + Intronic
1185047962 22:48538351-48538373 CCATGGGGCGCCCCATCCTCAGG + Intronic
949307667 3:2661255-2661277 CCTTGGGGCTGCCTGGCTTTGGG - Intronic
949673521 3:6426413-6426435 CCATGGGGCTGCTCTGCCTATGG - Intergenic
950651655 3:14410938-14410960 TCATGGTGCTGACTAGCCTTGGG - Intronic
950837551 3:15935445-15935467 CCTTGGGCCTGCCTACCCTCTGG - Intergenic
951673362 3:25209547-25209569 CCATGGGTCTGCCTCCCTTCAGG - Intronic
953786670 3:45916416-45916438 CCATGAGGCCCCCAAGCCTCAGG + Intergenic
954300591 3:49698922-49698944 GCATGTGGCTGCCCACCCTCAGG - Intronic
955008122 3:54988627-54988649 CCAGGGGCCTGCCTACCCACTGG - Intronic
955398706 3:58575818-58575840 CCACGGGCCTGTCTGGCCTCAGG + Intronic
958259520 3:91364328-91364350 GCATGGGGTTGCTGAGCCTCAGG + Intergenic
958462554 3:94418117-94418139 GCATGGGGCTGCCGAGCACCAGG + Intergenic
959003148 3:100988453-100988475 CCCTGGGGTTGCCTGGGCTCTGG + Intronic
960684802 3:120285426-120285448 CCCTGGGGCGGCCCCGCCTCCGG + Intergenic
961553163 3:127680477-127680499 CCCTGGGGCTGCCCAGCCAGGGG - Exonic
961954675 3:130789267-130789289 CCATGGGGTTGCTTAGTCTAGGG - Intergenic
962343300 3:134602642-134602664 CCAAGGGCCTGGCCAGCCTCTGG + Intronic
963382490 3:144549378-144549400 GCAGGTGGCTGCCTAGTCTCAGG - Intergenic
967366585 3:188693566-188693588 CCATAGGGCTGCATAGACTGAGG + Intronic
968866276 4:3214037-3214059 CCCTGCAGCTGCCTGGCCTCTGG + Exonic
973613964 4:52660710-52660732 ACTCGGGGCTGCCCAGCCTCAGG - Intergenic
985530025 5:428747-428769 CCATGGGGCCGCCTAGTTACAGG - Intronic
986620101 5:9663939-9663961 CCATGCCTCTGCCTAGCTTCTGG - Intronic
986727638 5:10611394-10611416 CCACTGAGCTGCCTAGACTCAGG - Intronic
987061958 5:14251568-14251590 CAAAGAGGCTGCCCAGCCTCTGG - Intronic
987861496 5:23492858-23492880 GCATGGGGCTACCAAGCATCAGG - Intergenic
988253236 5:28787599-28787621 CCATTGAGCTGCCCAGACTCTGG - Intergenic
989099676 5:37812086-37812108 CCATGGGGCAGCCTAGGCTGGGG + Intergenic
992123222 5:73615423-73615445 CACTGGTGCTGCCTAGCCTTGGG + Intergenic
992743305 5:79795263-79795285 ACATGGGGCACCCTGGCCTCTGG + Intronic
997695279 5:135856550-135856572 CCTTGGGGCAGCCAGGCCTCAGG - Intronic
997844896 5:137277519-137277541 GCATGGGGCTGCCTGCCCTGTGG + Intronic
999776093 5:154814151-154814173 CCATGGGGGTGCCCAGTCCCAGG + Exonic
1000312960 5:160062679-160062701 CCATGGAGCTGCCCCTCCTCAGG + Intronic
1001907089 5:175481709-175481731 CGTTGGGCCTGCCTAGCATCAGG - Intronic
1002495069 5:179606276-179606298 CAGTGGGGCTGGCTGGCCTCTGG - Intronic
1004193843 6:13487165-13487187 CCAGGGGGCTTCGAAGCCTCCGG - Exonic
1005308393 6:24535286-24535308 ACAGGGAGCTGCCTAGCATCTGG + Intronic
1008995714 6:57656038-57656060 GCATGGGGTTGCTGAGCCTCAGG - Intergenic
1009184241 6:60554807-60554829 GCATGGGGTTGCTGAGCCTCAGG - Intergenic
1011866596 6:91836568-91836590 ACATGGGGATGCAAAGCCTCTGG + Intergenic
1012434204 6:99197667-99197689 ACATTGGACTTCCTAGCCTCTGG - Intergenic
1016686390 6:146887194-146887216 CCTTGGGGCTGCTCAGCCTATGG - Intergenic
1018588060 6:165384938-165384960 GCATGGCGCTGCCCATCCTCTGG - Intronic
1018795136 6:167179710-167179732 CCATGAGGTGGCCGAGCCTCAGG + Intronic
1018821182 6:167375352-167375374 CCATGAGGTGGCCGAGCCTCAGG - Intronic
1019235701 6:170610437-170610459 CCCTGTGGCTGCCTCGCCTTGGG + Intergenic
1019321128 7:415797-415819 CCAAGGAGCTGCCGAGCCGCCGG + Intergenic
1019523413 7:1470436-1470458 TCCTGGGCCTGCCTGGCCTCAGG + Exonic
1022424434 7:30254682-30254704 CCATGGAGATGTCTGGCCTCTGG + Intergenic
1029122563 7:98278675-98278697 CCCTGGGGCTGACTCGCCACTGG + Intronic
1032076493 7:128838519-128838541 CCCTGAGGCTGCCCACCCTCTGG - Intronic
1032417147 7:131744560-131744582 CCATGGGTCTACCTGGCTTCAGG - Intergenic
1033062445 7:138121975-138121997 CCATGTGTCTGCCAAGGCTCAGG - Intergenic
1033126893 7:138714389-138714411 CCCTGGGGTTGCCTAACGTCAGG - Intronic
1033305698 7:140223821-140223843 CCATGGGGCTGCCAGGCTCCAGG + Intergenic
1034946626 7:155266647-155266669 CCATGGGCTTCCCTATCCTCTGG + Intergenic
1035259519 7:157652714-157652736 CCATGGGGCTGTGCAGCCACTGG - Intronic
1035297513 7:157875771-157875793 CCCTGGGGATGCCTGGCCTGGGG - Intronic
1035297560 7:157875891-157875913 CCCTGGGGATGCCTGGCCTTGGG - Intronic
1035297583 7:157875951-157875973 CCCTGGGGATGCCTGGCCTGGGG - Intronic
1042747273 8:72121237-72121259 CCTTGGGGTTGCCTACCCTGAGG + Intergenic
1044754581 8:95447838-95447860 CCAGGGAGCTGCCCAGCTTCTGG - Intergenic
1049291677 8:141806619-141806641 CCATGGGGTTGCGTGGCCCCAGG - Intergenic
1049554070 8:143273591-143273613 TCATGGGGCTTTCCAGCCTCAGG - Intronic
1054869288 9:70034665-70034687 TCATGGGCCTCCCTAGTCTCTGG + Intergenic
1056722299 9:89082474-89082496 CCATGGGGCCACCTAGGCCCTGG + Intronic
1058150577 9:101459462-101459484 CCATGGGGCTTCCTTCACTCTGG - Intergenic
1060559043 9:124527802-124527824 CCCTGGGGTGGCCTAGCCTGGGG - Intronic
1060793859 9:126502177-126502199 CCATGAGGCTGCCTTGACGCAGG + Intronic
1061578946 9:131525021-131525043 CTGAGGGGCTGCCGAGCCTCAGG - Exonic
1062385852 9:136311272-136311294 CCACTGGGCTGCCCCGCCTCTGG - Intergenic
1186176507 X:6930640-6930662 CCATGGGGCTGCTCTGCCTATGG + Intergenic
1187130333 X:16496420-16496442 CCATAGGGCTGACTGACCTCAGG - Intergenic
1187639902 X:21276571-21276593 CCATGGAGCTGCCAAGCACCAGG + Intergenic
1192248634 X:69392919-69392941 CAACAGGGCAGCCTAGCCTCTGG - Intergenic
1192690239 X:73354610-73354632 GCATGGGGCTGCTGAGCATCAGG - Intergenic
1193916427 X:87370455-87370477 TCATGGAGCTGCCAAGCCCCAGG + Intergenic
1196626609 X:117884442-117884464 CCACTGTGCTTCCTAGCCTCTGG - Intergenic
1199555331 X:149101855-149101877 CCATAGCCCTGTCTAGCCTCTGG - Intergenic
1199976149 X:152895998-152896020 CCCTGGGGCGGCCCAGCCTGGGG + Intergenic