ID: 1118617171

View in Genome Browser
Species Human (GRCh38)
Location 14:67582002-67582024
Sequence AACAGGGATGGGGCTTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118617171_1118617182 22 Left 1118617171 14:67582002-67582024 CCAGAGAAAGCCCCATCCCTGTT 0: 1
1: 0
2: 1
3: 25
4: 222
Right 1118617182 14:67582047-67582069 TTTCTTATTCTCTTCTTTGTAGG 0: 1
1: 0
2: 8
3: 109
4: 1355
1118617171_1118617178 -1 Left 1118617171 14:67582002-67582024 CCAGAGAAAGCCCCATCCCTGTT 0: 1
1: 0
2: 1
3: 25
4: 222
Right 1118617178 14:67582024-67582046 TTGGAATCCCTGCTGAGTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118617171 Original CRISPR AACAGGGATGGGGCTTTCTC TGG (reversed) Intronic