ID: 1118617596

View in Genome Browser
Species Human (GRCh38)
Location 14:67585382-67585404
Sequence TAGACAAGGCTGCTTGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118617596_1118617600 28 Left 1118617596 14:67585382-67585404 CCTGTCACAAGCAGCCTTGTCTA 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1118617600 14:67585433-67585455 CTTTGTTTTCCAAGATGAGGTGG 0: 2
1: 0
2: 2
3: 18
4: 250
1118617596_1118617599 25 Left 1118617596 14:67585382-67585404 CCTGTCACAAGCAGCCTTGTCTA 0: 1
1: 0
2: 2
3: 9
4: 135
Right 1118617599 14:67585430-67585452 CATCTTTGTTTTCCAAGATGAGG 0: 1
1: 0
2: 1
3: 40
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118617596 Original CRISPR TAGACAAGGCTGCTTGTGAC AGG (reversed) Intronic
903274384 1:22211342-22211364 TAGTTAGGGATGCTTGTGACAGG - Intergenic
904209493 1:28877321-28877343 TAGGCAAGGCTGCCCGAGACCGG + Intergenic
904859150 1:33521690-33521712 TAGGCAAGGGTGGGTGTGACCGG + Intronic
907857192 1:58315157-58315179 GAGACAAGGCTACTGGTCACAGG - Intronic
910085760 1:83400329-83400351 TAGTAAGGGCTGCTTTTGACAGG + Intergenic
913293617 1:117297978-117298000 TAGACAAGCGTGCTTCAGACTGG - Intergenic
914989215 1:152483889-152483911 GGGACAAGGCTGTTTGTGAATGG - Intergenic
917779311 1:178374926-178374948 AAGAAAAAGCTGCTTGTGAGAGG + Intronic
922453493 1:225755636-225755658 TATACAAGCCTGCTTGTGGGAGG - Intergenic
923510869 1:234651653-234651675 TAGTAAAGGCTGCTTGTAAGAGG - Intergenic
1064929925 10:20613809-20613831 TGGACGAGGCTGCTTGTCAGAGG - Intergenic
1068029987 10:51694433-51694455 TAGATAAGCCTACTTTTGACTGG + Intronic
1069906856 10:71737071-71737093 CAGACAAGGGTCCTTGTGATCGG - Intronic
1072404216 10:95134350-95134372 AAGAAAAGGCTGCCTGGGACTGG - Intergenic
1072803527 10:98409616-98409638 TGGGCAAGGCTGCATGTGCCAGG + Intronic
1081961956 11:47144646-47144668 AAGACAAGACTTCTTGTGATTGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1084311219 11:68317387-68317409 TGGACAAGGGTGCTGGGGACTGG - Intronic
1086523217 11:87696214-87696236 TAGCCAAGCCTTCTTGTGAATGG + Intergenic
1088789499 11:113211831-113211853 TAGACAAGGCTGCCTCTTAGTGG + Intronic
1090657344 11:128856119-128856141 TACACAAAGATGCTTCTGACAGG - Intronic
1096627694 12:52905335-52905357 CAGGCAAGTCTGCTTGTTACAGG - Intronic
1097757770 12:63426328-63426350 CAGACAAGGATGCTTGTGCAGGG + Intergenic
1099553643 12:84080416-84080438 TAGAGAAGACTTTTTGTGACTGG - Intergenic
1108497102 13:51035890-51035912 TAGACAAGCCTGCCTGAGGCCGG - Intergenic
1108935452 13:55875904-55875926 TAGATAAGGCTGTTTGTGGATGG - Intergenic
1109391126 13:61695011-61695033 TATAAAAAGCTACTTGTGACTGG - Intergenic
1113235558 13:108269063-108269085 GAGACCAGGCTCCTTGGGACAGG + Intronic
1113355673 13:109577615-109577637 TTGAGAAGCCTGCTTATGACTGG - Intergenic
1117091329 14:52253709-52253731 TATGCAAGGCTGCTTTTCACAGG + Intergenic
1118236630 14:64011205-64011227 TAAACAGGGCTGCTTCCGACTGG - Intronic
1118590917 14:67400394-67400416 TAAACATGTCTGCTTGTGTCAGG - Intronic
1118617596 14:67585382-67585404 TAGACAAGGCTGCTTGTGACAGG - Intronic
1119419442 14:74499532-74499554 TGAACAAGGCTCCATGTGACTGG - Exonic
1121743563 14:96270409-96270431 TGGACAAGTCTGCTTGTCTCTGG - Intergenic
1127910206 15:63410593-63410615 TGGAGAAGGCTGCTCCTGACTGG - Intergenic
1128260397 15:66228916-66228938 TAGAGAGGACTGCCTGTGACAGG - Intronic
1131076883 15:89500951-89500973 GAGAGAAGGCTGCATGTGAGTGG - Intergenic
1131737290 15:95347350-95347372 GAAACATGGCTGCTTGTGATTGG - Intergenic
1133602275 16:7351098-7351120 TAGAGAAGGCCCCTTGGGACTGG + Intronic
1138026781 16:53528355-53528377 GTGACAAGACTGCTGGTGACAGG + Intergenic
1138217775 16:55219828-55219850 AAAATAAGACTGCTTGTGACAGG + Intergenic
1138528516 16:57622385-57622407 CAGACAAGGCTGCTTCTAGCTGG + Intronic
1139563014 16:67755715-67755737 TGGACATGGCTGCTTGGGTCAGG + Intronic
1141853512 16:86664921-86664943 GAGACAAGGTTGCGTGTGAAAGG + Intergenic
1147791841 17:43018584-43018606 TACACATGGCTGCAGGTGACAGG - Exonic
1148658306 17:49306095-49306117 TACACAATTCTGCTAGTGACTGG + Intronic
1151289290 17:73137541-73137563 GAGATAAGGCTACTTGTCACTGG - Intergenic
1153298781 18:3574173-3574195 TAGACAAGTCTGATTGAGAGAGG - Intronic
1154306408 18:13233935-13233957 CAGACAAGGATGCTGGTGACTGG - Intronic
1155367882 18:25066788-25066810 GAGAGAAGGCTGCTTGTGGATGG - Intronic
1155748263 18:29388410-29388432 TAGACTAGCCTGCATGTGACTGG + Intergenic
1159392561 18:67812363-67812385 TAGCCTAGGCTGATTGTGTCCGG + Intergenic
1161114809 19:2490737-2490759 TGGACAAGGCTGTTTGTGCCGGG - Intergenic
1163399207 19:17081900-17081922 TCCACAAGGCTGCGTGTGCCTGG + Intronic
1163974732 19:20840309-20840331 TATACAAGGCTGCATCTCACAGG + Intronic
1164272835 19:23688350-23688372 TAGACATGTCTGCGTGTGATTGG - Intergenic
1164436911 19:28238248-28238270 GAAACATGGCTGCTGGTGACTGG + Intergenic
1165369550 19:35396027-35396049 GAGACCAGGCTGCTTGTGCTGGG + Intergenic
1165485098 19:36090651-36090673 TAAACAAGGATGCTTGCGAGAGG + Intronic
937939568 2:127274603-127274625 ACGGCAAGGCAGCTTGTGACTGG - Intronic
938407086 2:131038710-131038732 CTGACAAGGCTGCCTCTGACAGG - Intronic
938888769 2:135681310-135681332 TTCACAAGGCTGCTTGTGAAAGG + Intronic
939328534 2:140727298-140727320 TGTAGAAGGTTGCTTGTGACAGG + Intronic
940386902 2:153084647-153084669 TAGACAAGACAGCTTGTGCAGGG - Intergenic
942773240 2:179548308-179548330 TAAAGAAGGATGCTTGTTACTGG - Intronic
942850186 2:180474963-180474985 GAGACAAGGCTGCTTGTGGCAGG - Intergenic
944147232 2:196518825-196518847 CAGAGAAGGCTGCTTGTAAGAGG - Intronic
946729821 2:222698414-222698436 TAAACAGGACTTCTTGTGACTGG + Intronic
1169729855 20:8774802-8774824 GAGACAAGGGTGGGTGTGACTGG + Intronic
1170204254 20:13781458-13781480 TAGACAATGTTGCTTTAGACAGG + Intronic
1170764122 20:19275553-19275575 TAGTCAAGGCTGTTTGTCAGGGG + Intronic
1172319070 20:33982259-33982281 TGGAGAAGTCTGCCTGTGACTGG - Intergenic
1175678972 20:60970805-60970827 TAGACGAGGCTGCCTGAGGCCGG + Intergenic
1179165073 21:38929067-38929089 TGGACAGGGCTGCTGGTGCCAGG - Intergenic
1181810425 22:25400660-25400682 TGGACAAGGGTGCTGGGGACTGG + Intronic
1184797710 22:46741446-46741468 TAGACGGGGCTGCTGGTGCCAGG - Intergenic
1185187109 22:49407691-49407713 TAGACCAGGCTGCGGGTGTCAGG + Intergenic
1185187156 22:49407898-49407920 TAGACCAGGCTGCGGGTGTCAGG + Intergenic
952843388 3:37666980-37667002 TAGACAAGGATGCAAGTGCCAGG - Intronic
953542134 3:43830221-43830243 TATAAAAGACTGCTTGAGACTGG + Intergenic
954316885 3:49806221-49806243 TAGGAAAGGCTGCTGGTAACTGG - Intronic
954682970 3:52355802-52355824 TCGGCAAGGCTGCTTGTTGCTGG - Intronic
957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG + Intergenic
957854010 3:85850130-85850152 TAAATAAGGTTGCTTGTGGCTGG + Intronic
961602256 3:128071262-128071284 TAGACAAGGCCACGTGTGATAGG - Exonic
962432715 3:135334955-135334977 TAGAGGAGGCTGCTTCAGACAGG - Intergenic
965500853 3:169454974-169454996 TAGACATGGCTGATTGTAAGAGG - Intronic
965505468 3:169510307-169510329 AAGTCAAGACTGCTGGTGACAGG - Intronic
967016987 3:185491290-185491312 TAGAAAATGCTGTTTGTGGCCGG - Exonic
970646975 4:18133626-18133648 GAGAAAAGTCTGCTTATGACTGG + Intergenic
970874598 4:20855024-20855046 TAAACAAGACTCCTTGTTACAGG - Intronic
971643593 4:29166766-29166788 GAGGCAAGGCTGCTTCTGACTGG - Intergenic
972735846 4:41840441-41840463 CAACCAAGGCTGCTTGTGGCAGG + Intergenic
972746623 4:41939374-41939396 TAGAAAAGGATACTTGTAACTGG - Exonic
973671339 4:53221353-53221375 TAGACAAGGATGCTTGTGAATGG - Intronic
974195506 4:58569537-58569559 TTCACAAGGCTACTTGTCACAGG + Intergenic
976371452 4:84293243-84293265 TATACAAAGCTGCTAGTGACAGG + Intergenic
976942527 4:90721319-90721341 TAGAATAGGCTTCTTATGACAGG + Intronic
977528611 4:98174015-98174037 TAGACAAAGCTGCTTAGAACTGG - Intergenic
978392485 4:108241845-108241867 GGGAGAAGGCTGATTGTGACTGG + Intergenic
979388426 4:120098321-120098343 TTGAAAAGGAAGCTTGTGACCGG + Intergenic
979438267 4:120720634-120720656 TAAGCAAGGCTGCTTGTTAGAGG - Intronic
979471911 4:121109031-121109053 TAAACAAGGCTGATTGAGTCAGG + Intergenic
984625206 4:181999137-181999159 GAGACAAGGTTGCTGGTGCCAGG - Intergenic
984904323 4:184612700-184612722 TAAACTAGGCCCCTTGTGACTGG - Intergenic
991217962 5:64177907-64177929 TAGAAAAGGCTGCCTGGGGCTGG + Intronic
991570548 5:68048985-68049007 CACACAAGCCTGCTTGTGCCTGG - Intergenic
992549581 5:77847970-77847992 TTGACAAGGCTGCTTCTCCCAGG + Intronic
993277959 5:85886576-85886598 GAAGCATGGCTGCTTGTGACTGG - Intergenic
1001002732 5:168022936-168022958 TAGGCAAGGGTGCGTGTGCCAGG + Intronic
1008295816 6:49775295-49775317 GAAACATGGCTGCTTGTGATTGG + Intergenic
1013324318 6:109029517-109029539 TAGACAAATCTGCTTGTTATTGG - Intronic
1013581303 6:111537096-111537118 AAAACAAGGCTGCTTGTGTGAGG + Intergenic
1015022381 6:128492186-128492208 TAGAGAAGGCAGCATGTGAAGGG - Intronic
1016386290 6:143533930-143533952 GAGAGAAGGCAGCTTGTGAAGGG + Intergenic
1016726301 6:147372727-147372749 AAGACAAGGATGGTAGTGACTGG - Intronic
1021408599 7:20303014-20303036 TACACAAGCCTGCCTGTTACTGG + Intergenic
1026843016 7:73681422-73681444 TAAACAAGGCTGCTTGAGGCTGG - Exonic
1027302639 7:76856790-76856812 TAGTAAGGGCTGCTTTTGACAGG + Intergenic
1030720240 7:112862485-112862507 TATACAAGGCTACTGGTGCCAGG + Intronic
1032017435 7:128388994-128389016 TAGAAGAGGCTGCATGTGGCTGG + Intergenic
1035647466 8:1236801-1236823 TAGACAAGGCACCATGTGAGAGG - Intergenic
1035647603 8:1239011-1239033 TAGACAAGGCACCATGTGAGAGG - Intergenic
1036404203 8:8440670-8440692 TAGAAAAGGCTGCCTAAGACTGG + Intergenic
1037797149 8:22005391-22005413 TATACAAGGCAGGTTGTGGCAGG - Exonic
1038478019 8:27882449-27882471 CAGGCAAGGCTGCTGGTCACCGG - Intronic
1041007563 8:53510045-53510067 AAGACAAGGCTGGTTGGGTCAGG + Intergenic
1043562493 8:81510391-81510413 TGGGCAAGGCATCTTGTGACAGG - Intergenic
1044867241 8:96584102-96584124 TAGTCAAGGCTTCTTTTTACAGG + Intronic
1047367509 8:124225355-124225377 TAGAAAAGGTTGCCTGGGACTGG - Intergenic
1048439962 8:134452618-134452640 CAAACAAGGCTGCTTCTGCCAGG + Intergenic
1049509440 8:143019977-143019999 GAGACAAGGCTGCGTGCCACTGG - Intronic
1049827145 8:144676409-144676431 TAGACACGGGTGCTGCTGACTGG + Intergenic
1051585352 9:18721447-18721469 TAGACAAGGCAGCTGGTGGGAGG - Intronic
1056803928 9:89713361-89713383 TGGACACTGCTGCTTGTGAATGG - Intergenic
1058162765 9:101587516-101587538 TATACTAGGCTGCTGGAGACAGG - Intronic
1059082885 9:111268738-111268760 TAGACCAGGCTTCTTGTACCTGG + Intergenic
1061221210 9:129253319-129253341 CACAGAAGGCTGCTTGTGGCCGG + Intergenic
1061907250 9:133705001-133705023 TGGACAAGGCTGCGTGTTCCAGG - Exonic
1187190267 X:17027969-17027991 TGGCCAAGCCTGCCTGTGACTGG - Intronic
1187470975 X:19569567-19569589 TAGCCAATGCTGCTTGTCAAAGG + Intronic
1187984135 X:24792215-24792237 TGGACAAGGCTGCTTTTTAATGG + Intronic
1188976635 X:36683435-36683457 TAGATTGGGCTGCATGTGACTGG - Intergenic
1189337255 X:40177251-40177273 TAGACAAGGCTGCATGTGCGGGG - Intronic
1194542500 X:95191364-95191386 TAGACAAGAGTGCTTGTGTAGGG + Intergenic
1197639537 X:128952622-128952644 TAGGTATGGCTGCTGGTGACAGG + Intergenic