ID: 1118617847

View in Genome Browser
Species Human (GRCh38)
Location 14:67587160-67587182
Sequence GTCCATCCAGTTCCCACAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118617847_1118617848 13 Left 1118617847 14:67587160-67587182 CCAGCTGTGGGAACTGGATGGAC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1118617848 14:67587196-67587218 TTCTGTTTCCTGTGCTACCAAGG 0: 1
1: 0
2: 4
3: 35
4: 373
1118617847_1118617850 15 Left 1118617847 14:67587160-67587182 CCAGCTGTGGGAACTGGATGGAC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1118617850 14:67587198-67587220 CTGTTTCCTGTGCTACCAAGGGG 0: 1
1: 0
2: 2
3: 15
4: 163
1118617847_1118617849 14 Left 1118617847 14:67587160-67587182 CCAGCTGTGGGAACTGGATGGAC 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1118617849 14:67587197-67587219 TCTGTTTCCTGTGCTACCAAGGG 0: 1
1: 0
2: 2
3: 25
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118617847 Original CRISPR GTCCATCCAGTTCCCACAGC TGG (reversed) Exonic
901177746 1:7317044-7317066 GTCCATCCAGTTCCAAGAACAGG - Intronic
903445344 1:23419073-23419095 GTCCATCCAGCTACTACAGGTGG - Exonic
904635986 1:31881935-31881957 GACTGTCCAGTTCCCTCAGCAGG - Intergenic
904813384 1:33178700-33178722 GTGCACACAGTGCCCACAGCAGG + Intronic
906663467 1:47599106-47599128 GCCCATCCTGTTGCCACTGCAGG + Intergenic
907751657 1:57269063-57269085 GTGGATCCAATTCCCACAGGTGG - Intronic
910517350 1:88076788-88076810 GTCCATCCAGTTCCTCATGCTGG - Intergenic
921294388 1:213688418-213688440 GATCTTTCAGTTCCCACAGCTGG + Intergenic
922035751 1:221846246-221846268 GGACATCCAGTTCCCAAAGAAGG + Intergenic
1065929227 10:30464431-30464453 TTCCATCCAATTCCCGAAGCAGG - Intergenic
1067481535 10:46602629-46602651 CTCCCTCCAGCTCCAACAGCTGG + Intergenic
1067613217 10:47739100-47739122 CTCCCTCCAGCTCCAACAGCTGG - Intergenic
1067768968 10:49109964-49109986 GTCCACACAGCTCCCACGGCAGG + Intronic
1070005381 10:72419414-72419436 GTCCAGCCTTTTCCCACAGCAGG - Intronic
1070025417 10:72627040-72627062 TTCCATCCTATTTCCACAGCAGG - Intergenic
1071628629 10:87199204-87199226 CTCCCTCCAGCTCCAACAGCTGG - Intergenic
1074284776 10:112088040-112088062 GTCCTTCCCTTTCCCACAGCAGG + Intergenic
1074955476 10:118384428-118384450 GTGCAACCAGTTCACACAACTGG + Intergenic
1075402425 10:122170858-122170880 CTCCATCCACTCCCCTCAGCGGG + Intronic
1077469138 11:2748631-2748653 GGCCACCCAGAGCCCACAGCAGG + Intronic
1083059467 11:59854509-59854531 GTCCATCTACATCTCACAGCAGG - Intronic
1083232775 11:61333441-61333463 GTCCTTCCCGTTCCCAAAGGAGG - Intronic
1086234145 11:84607630-84607652 GTCCATGCACTTCCCACTGTAGG - Intronic
1090372508 11:126266559-126266581 AGCCACCCAGTTCCCACACCCGG + Exonic
1097904794 12:64908658-64908680 GGTCATCCAGTTGCCACTGCAGG - Intergenic
1098566468 12:71942872-71942894 GTCCATACAGTGCCAACGGCAGG + Intronic
1101840257 12:108322888-108322910 TTTCATCCAATTGCCACAGCTGG + Intronic
1102454511 12:113063389-113063411 TCCCACCCAGTTCACACAGCTGG + Intronic
1103333813 12:120174074-120174096 GTTCATCCCGTTCCTTCAGCAGG - Exonic
1105888796 13:24666876-24666898 CTCCACCGAGTTCCCAAAGCAGG + Intergenic
1111004115 13:82226407-82226429 GTCCATCTATCTCACACAGCAGG - Intergenic
1113496352 13:110732836-110732858 TTCCACCCAGATCACACAGCTGG - Intergenic
1114485931 14:23061619-23061641 GTCCCTCCTCTCCCCACAGCTGG - Exonic
1117734209 14:58752480-58752502 GTCCATCCCGATCCCAAGGCTGG + Intergenic
1118617847 14:67587160-67587182 GTCCATCCAGTTCCCACAGCTGG - Exonic
1118812482 14:69285380-69285402 GACAATCCTATTCCCACAGCAGG - Intronic
1119423027 14:74518909-74518931 CTTCATCCAGTTCCCACATACGG - Intronic
1119544629 14:75462689-75462711 GTCTCTCCAGCTCCCACAGGAGG - Intronic
1122413706 14:101538641-101538663 CTCCCTCCAGGTCACACAGCAGG + Intergenic
1122766820 14:104078117-104078139 GTCCCTCCAGTGCCCTCTGCCGG - Intergenic
1122945308 14:105005968-105005990 ACCCAGCCAGTCCCCACAGCAGG + Intronic
1124064046 15:26323159-26323181 ATCCACCAAGTGCCCACAGCTGG + Intergenic
1124868060 15:33513605-33513627 GTACATGCAGTACCCACAGCAGG - Intronic
1127933048 15:63610225-63610247 GGCCATCCACCTCCCATAGCAGG - Intronic
1128521886 15:68380749-68380771 GTCCCTCCAGATCCCACCTCAGG - Intronic
1129894726 15:79094800-79094822 TTCTCTCCAGTCCCCACAGCTGG + Intergenic
1130630528 15:85563588-85563610 GTTCATGCGGTGCCCACAGCAGG - Intronic
1133001803 16:2855664-2855686 CTCCATACAGTTCTCAGAGCGGG - Exonic
1133630343 16:7614418-7614440 GTCCTTCTAGATCCCACAGAGGG + Intronic
1139505165 16:67394955-67394977 CTCCCTCGAGTTCCCAGAGCAGG + Intronic
1141033329 16:80608275-80608297 GTCCACCCATGTCCCTCAGCTGG + Intronic
1141820620 16:86442957-86442979 GCCCAGCCAGTGCCCAGAGCAGG + Intergenic
1142586310 17:976594-976616 ACCCATCCAGTGCCCTCAGCTGG + Intronic
1142698939 17:1648242-1648264 GTCCTCCCAGTTCCCAGCGCAGG + Intronic
1143007248 17:3845340-3845362 GTATATCCAGTTCTCAGAGCTGG - Intronic
1143443829 17:6995903-6995925 GCACAGCCAGTCCCCACAGCCGG + Intronic
1150448821 17:65248549-65248571 TTCCTTCCAGCTCCCACTGCTGG - Intergenic
1152993923 18:388736-388758 GGCCACCCAGGTCCCAGAGCTGG + Intronic
1153499038 18:5729779-5729801 GTCCCTCCTGTTACCACGGCTGG + Intergenic
1153769995 18:8407796-8407818 GCCTCTCCACTTCCCACAGCGGG - Intergenic
1160321791 18:77903029-77903051 ATCCTTCCAGTGGCCACAGCAGG + Intergenic
1162125906 19:8499405-8499427 CTCCAAGAAGTTCCCACAGCTGG - Exonic
1165277895 19:34770829-34770851 GTCCATGCAGTTCCCTTTGCCGG + Intronic
1168409844 19:56132865-56132887 GTCCACCCAGCTCCGGCAGCAGG - Intronic
927422635 2:22949164-22949186 AACCACCTAGTTCCCACAGCTGG + Intergenic
928648941 2:33384769-33384791 GTTCATGCAGTTCCCCAAGCTGG + Intronic
929401765 2:41590620-41590642 GTTTTTCTAGTTCCCACAGCAGG - Intergenic
929896233 2:45963102-45963124 GCCCATCTAGTCCCCACGGCAGG - Intronic
932672701 2:73752182-73752204 GTCCATTCAAGTCCCACAGTGGG - Intergenic
948485407 2:238277849-238277871 GCCCAGCCAGGTCCCACTGCAGG - Exonic
1169195299 20:3679524-3679546 GTCCATCCAGGACCCAGTGCGGG + Exonic
1169787142 20:9371022-9371044 GTCCCTCTGGTTCCCAGAGCTGG - Intronic
1172969816 20:38865146-38865168 CTCCTTCCAGTTCCCTCAACCGG - Intronic
1173249498 20:41357200-41357222 CTCCCTCCCCTTCCCACAGCTGG - Intronic
1173420390 20:42895988-42896010 CTCCCTCCAGTTCCCAGAGACGG - Intronic
1175689498 20:61055367-61055389 GCACATCCAGAACCCACAGCGGG + Intergenic
1176524789 21:7857923-7857945 CTCCATCCAGTTGGCCCAGCAGG + Intergenic
1178658809 21:34487936-34487958 CTCCATCCAGTTGGCCCAGCAGG + Intergenic
1178725328 21:35046366-35046388 GTCCATGCAATTCTCACAGAAGG - Intronic
1180948808 22:19711334-19711356 GTGCATCCACTTTCCCCAGCAGG - Intergenic
1182093618 22:27612203-27612225 CTCCCTCCAGTGCCCACAGCAGG - Intergenic
1182119744 22:27779057-27779079 GTCCATCCCGGTCCCTCTGCAGG + Intronic
1182737031 22:32538080-32538102 GGCCTTCCAGTTCCCAGAGATGG + Exonic
1184468071 22:44680545-44680567 CTCCATGGAGGTCCCACAGCAGG + Intronic
1184520615 22:44991770-44991792 GTCCATCCAGCTCCATAAGCAGG + Intronic
1184772646 22:46606986-46607008 CTGCTTCCAGTGCCCACAGCTGG - Intronic
950551261 3:13667471-13667493 CTCCATCCAGTTCAGACAGCAGG - Intergenic
952060539 3:29503587-29503609 CTCCTTACAGTTCCCAAAGCAGG - Intronic
952411653 3:33054906-33054928 CACAACCCAGTTCCCACAGCAGG + Intronic
960348485 3:116564698-116564720 GGCCATCCAGTTCCCTCCACTGG - Intronic
960567145 3:119146024-119146046 GTCCCTCCACTTACAACAGCGGG + Intronic
960960363 3:123066710-123066732 GTTGATCCAGATCACACAGCCGG - Intergenic
961576089 3:127837633-127837655 GAGCATCCAGCTCCAACAGCCGG + Intergenic
962205188 3:133428429-133428451 GTGCATTCACTCCCCACAGCTGG - Intronic
965942948 3:174207526-174207548 GTCCATTCAGTTCACACATTTGG - Intronic
966974164 3:185070303-185070325 GTCCCTCCCGTGCCCTCAGCCGG - Intergenic
967413879 3:189195643-189195665 CTCCAGTCAGCTCCCACAGCTGG + Intronic
968602779 4:1518232-1518254 GTCCACCCCGTGCCAACAGCAGG + Intergenic
973669718 4:53203849-53203871 CTCCATCCAGATCACTCAGCAGG + Intronic
981926950 4:150150953-150150975 GTCCTCCCAGTTCCAATAGCTGG + Intronic
982260307 4:153488613-153488635 CTCCATCCAGCCCCCTCAGCTGG - Intronic
993404968 5:87499957-87499979 CTCCATGCAGGGCCCACAGCAGG - Intergenic
994373696 5:98994790-98994812 GTCCATCTATTTCCTAGAGCTGG + Intergenic
994584107 5:101683549-101683571 TTCCATCCTGTTCCCACAAATGG - Intergenic
996474440 5:123900387-123900409 TTCCATGCAGTTCTCACTGCGGG - Intergenic
997233226 5:132258301-132258323 GTCCATCCACTTCCCACTTTGGG + Intronic
1001963363 5:175893985-175894007 CACCCTCCAGTTCCCACAGGGGG - Intergenic
1003145110 6:3503969-3503991 GTCCACCCACTACCCACACCCGG - Intergenic
1004044438 6:12011750-12011772 GCCCATCCAGTCCCTACACCCGG + Intronic
1006379960 6:33691660-33691682 GTCCATCTTGTCCCCACTGCAGG - Exonic
1006641495 6:35491847-35491869 GTCCAGCCAGTTCTTCCAGCAGG - Intronic
1006908451 6:37548539-37548561 GTCGAGCCAGTTCACGCAGCTGG + Intergenic
1006939783 6:37744097-37744119 GTACCTCCAGTTTCCACATCAGG + Intergenic
1012111044 6:95234084-95234106 GCCCATCCAGTGGCCAAAGCGGG - Intergenic
1012445838 6:99306362-99306384 GTCCATCCAGTTGCTCCATCTGG - Intronic
1013219610 6:108066546-108066568 GTACCTCCAGTTCTCTCAGCAGG - Intronic
1015964326 6:138683049-138683071 GGCCCTCCAGTTCCCACGGCAGG + Intronic
1019009718 6:168834310-168834332 CTCCATGCAGTTCCTACATCTGG - Intergenic
1019611777 7:1940393-1940415 CTTCATCCAGTTTTCACAGCCGG + Intronic
1019910273 7:4096272-4096294 ATCCATGCAGGTCCCAGAGCTGG - Intronic
1021183285 7:17533491-17533513 GCCCATCCAGTGCCCACTGAAGG + Intergenic
1021606549 7:22414610-22414632 GCCCAGCCAGCTCCCAGAGCGGG + Intergenic
1026850965 7:73722945-73722967 GTCCACCCAAGTGCCACAGCAGG - Intergenic
1026858706 7:73770896-73770918 CTCCCTCCAGTTCCCATCGCTGG + Intergenic
1027346882 7:77269851-77269873 GCCCAGCCACTGCCCACAGCTGG + Intronic
1032195685 7:129787049-129787071 GCCCAGCAGGTTCCCACAGCAGG - Intergenic
1033041794 7:137925986-137926008 CACCATTCAGTTCCCCCAGCTGG - Intronic
1035123547 7:156590463-156590485 GTGCAGCCTGTGCCCACAGCAGG + Intergenic
1036646958 8:10616948-10616970 CGCCCTCCAGCTCCCACAGCGGG + Intronic
1037562355 8:20086475-20086497 GTCTATGAAGTTCCCAAAGCTGG - Intergenic
1042102648 8:65290223-65290245 GTCACTTCAGTTGCCACAGCAGG - Intergenic
1042761210 8:72273314-72273336 TTCCACCCAGTTTCCACTGCAGG - Intergenic
1044668614 8:94656009-94656031 GCCCATCCAGTATCCACAGTAGG + Intronic
1045268834 8:100644486-100644508 GGCCAGCCAGTTCACACAGCAGG + Intronic
1049612540 8:143562190-143562212 GCCCTTCCCGTGCCCACAGCTGG + Exonic
1050476617 9:6047399-6047421 TTGCATCCCGTTCCCACACCAGG - Intergenic
1062048343 9:134434675-134434697 GCCCTTCCAGGGCCCACAGCCGG - Intronic
1062276664 9:135734546-135734568 GTCCATGGAGTGCCCACAGCCGG - Intronic
1186507763 X:10107483-10107505 GTCCTGTCACTTCCCACAGCTGG - Intronic
1187053382 X:15716247-15716269 TTTCATCCAGTTTCCAAAGCTGG - Intronic
1187174406 X:16883016-16883038 GTCCTCCCAGTCCCCACAGGGGG + Intergenic
1189208258 X:39260338-39260360 GTCTTTCCAGTTCCTACAGCTGG - Intergenic
1192496837 X:71621894-71621916 GTCGAGCCAGTTTCCTCAGCAGG + Intergenic
1197853849 X:130893735-130893757 GTCTATCCACTTCCCATATCTGG + Intronic
1198984342 X:142431931-142431953 GACCAACCAGTACCCACATCTGG - Intergenic
1199995669 X:153024232-153024254 GTCCCCCCACTTCCCACAGAGGG + Intergenic
1200064828 X:153499352-153499374 GTCCAGCCTGTCCCCACAGTCGG - Intronic
1200078886 X:153565916-153565938 CTCCAGGCAGTGCCCACAGCAGG - Intronic