ID: 1118621433

View in Genome Browser
Species Human (GRCh38)
Location 14:67618036-67618058
Sequence CAGTAGCACAGGAAGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118621428_1118621433 6 Left 1118621428 14:67618007-67618029 CCGCGCCCAGCGGAAGCAAGAGG No data
Right 1118621433 14:67618036-67618058 CAGTAGCACAGGAAGCCCTGAGG No data
1118621431_1118621433 0 Left 1118621431 14:67618013-67618035 CCAGCGGAAGCAAGAGGTTTTTG No data
Right 1118621433 14:67618036-67618058 CAGTAGCACAGGAAGCCCTGAGG No data
1118621427_1118621433 9 Left 1118621427 14:67618004-67618026 CCACCGCGCCCAGCGGAAGCAAG No data
Right 1118621433 14:67618036-67618058 CAGTAGCACAGGAAGCCCTGAGG No data
1118621430_1118621433 1 Left 1118621430 14:67618012-67618034 CCCAGCGGAAGCAAGAGGTTTTT No data
Right 1118621433 14:67618036-67618058 CAGTAGCACAGGAAGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118621433 Original CRISPR CAGTAGCACAGGAAGCCCTG AGG Intergenic
No off target data available for this crispr