ID: 1118626485

View in Genome Browser
Species Human (GRCh38)
Location 14:67664015-67664037
Sequence TTCCAGGGAGAACAGTCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118626485 Original CRISPR TTCCAGGGAGAACAGTCATT TGG (reversed) Intronic