ID: 1118626963

View in Genome Browser
Species Human (GRCh38)
Location 14:67668424-67668446
Sequence ATTCAAAGGCAGAAAGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 790
Summary {0: 1, 1: 1, 2: 7, 3: 84, 4: 697}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118626961_1118626963 7 Left 1118626961 14:67668394-67668416 CCTAAAACAGGACACATTGTCTC 0: 1
1: 0
2: 1
3: 25
4: 221
Right 1118626963 14:67668424-67668446 ATTCAAAGGCAGAAAGTGAATGG 0: 1
1: 1
2: 7
3: 84
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118626963 Original CRISPR ATTCAAAGGCAGAAAGTGAA TGG Intronic
901030234 1:6303066-6303088 ATACAGCGGAAGAAAGTGAAAGG - Intronic
901920863 1:12536564-12536586 ACCCCAAGGCAGAAAGTCAAGGG + Intergenic
902155619 1:14483258-14483280 ATTCAAATGAAGATAGAGAATGG + Intergenic
903462632 1:23530353-23530375 ATCCAAAGTCTGAAAATGAAGGG + Intronic
904595433 1:31641759-31641781 ATTCAATGGGAGTAAGTGTAAGG - Intronic
905505190 1:38473730-38473752 ATTTATAGACAGAAAATGAATGG + Intergenic
905661447 1:39729179-39729201 ATTCACAGGCAAAGAGTGGAAGG - Intronic
905776997 1:40674742-40674764 ATTCCATGGCAGCAGGTGAAGGG - Intergenic
906636895 1:47416105-47416127 ATCCAAAGGCAGAAAGGGAGGGG + Exonic
907938385 1:59063501-59063523 ATTAAAAGGCAGAAACTTGAAGG + Intergenic
908026369 1:59956084-59956106 ATATATAGGGAGAAAGTGAATGG + Intergenic
908155812 1:61351643-61351665 ATTCAAAGACAGAAAATGCAAGG + Intronic
908364828 1:63410230-63410252 ATTCACAGCCATAAAGAGAATGG - Intronic
908792617 1:67798054-67798076 AGACTGAGGCAGAAAGTGAAAGG - Intronic
908980157 1:69946757-69946779 ATACATAGGATGAAAGTGAATGG - Intronic
909830346 1:80181432-80181454 ATTGAAAATCAGAAGGTGAAGGG - Intergenic
910472468 1:87569967-87569989 AAGCAAAGGCAAAAAGAGAAAGG - Intergenic
911329547 1:96511364-96511386 ACTCTAGGGTAGAAAGTGAAAGG + Intergenic
911435209 1:97846954-97846976 ATTCAAAACCATAAAGTGGAGGG + Intronic
911669781 1:100594670-100594692 CTACATAGGCTGAAAGTGAAAGG - Intergenic
911853236 1:102845127-102845149 ATTTCAAGGCAAAAAGTAAAAGG + Intergenic
912086911 1:106018387-106018409 ACACAGAGGCAGAAAGTAAATGG + Intergenic
912374038 1:109195771-109195793 ATTCAAAGGCAGAAATGCAAAGG + Intronic
912885504 1:113468084-113468106 ACACAAAGACAGAAAGTGGAAGG - Intronic
913945941 1:125165531-125165553 AATCAAAGGCAGAAATAGAATGG - Intergenic
913964667 1:143365811-143365833 ATTCATAGACAGAAATAGAATGG - Intergenic
914059037 1:144191415-144191437 ATTCATAGACAGAAATAGAATGG - Intergenic
914120112 1:144774956-144774978 ATTCATAGACAGAAATAGAATGG + Intergenic
914454455 1:147822900-147822922 ATTCAGAGGCAGGAATTGACTGG - Intergenic
915427318 1:155837441-155837463 CTGAAAAGGCAGAAAGGGAAAGG - Intronic
915534706 1:156528344-156528366 ATGCCCAGACAGAAAGTGAAGGG - Intronic
915968173 1:160330477-160330499 TTTCAAAGGCATAGAATGAAAGG - Intronic
916127789 1:161586906-161586928 ATGCAAAGGAAGGAAGTGATTGG + Intronic
916137708 1:161668710-161668732 ATGCAAAGGAAGGAAGTGATTGG + Intronic
916224802 1:162479040-162479062 ATTCATAGACTGAAAATGAAGGG + Intergenic
916450652 1:164917331-164917353 AATAAAAGGCAGAAGATGAATGG + Intergenic
916460952 1:165023736-165023758 ATCCCATGGCAGAAGGTGAAAGG + Intergenic
916960695 1:169885650-169885672 AATAAAATGCAGAAAGAGAAAGG + Intronic
917360034 1:174165073-174165095 AATGAAAGGCAGAAAGTAATGGG + Intronic
917679855 1:177354771-177354793 ACTCAATGGCAGGAACTGAAGGG + Intergenic
917701372 1:177584997-177585019 CTTCCAAGGCAGAAAGGCAAAGG + Intergenic
918009202 1:180570951-180570973 ATTCCCATTCAGAAAGTGAAAGG + Intergenic
918117647 1:181510658-181510680 ACTCACAGGCAGGAAGGGAATGG - Intronic
918584615 1:186171428-186171450 GCTCAAAGGCAGAAAATGCATGG + Exonic
918766807 1:188497582-188497604 ATGCAGAGGCTGAAAGTAAAGGG - Intergenic
918994701 1:191742006-191742028 AATAAAAGGCAGAAAGCTAAAGG - Intergenic
919139193 1:193549256-193549278 CTTCAAACTCAGCAAGTGAAGGG - Intergenic
919537442 1:198805809-198805831 TTTCAAAGTCAGAAATGGAAAGG + Intergenic
919543211 1:198877485-198877507 ATTCTAAGCCAGAAAGTGAAAGG - Intergenic
919553280 1:199020102-199020124 ATTCTAAGACAGAAAATGACAGG + Intergenic
919740160 1:200976397-200976419 ATACACAGTCAGAAACTGAAAGG - Intronic
921181892 1:212637926-212637948 GTTTAAAGGCAGAGAGTGTATGG - Intergenic
921830970 1:219727172-219727194 ACAAATAGGCAGAAAGTGAAGGG + Intronic
921919325 1:220648596-220648618 TTTCAAAGGCTGATGGTGAATGG - Intronic
922067596 1:222158931-222158953 AGTGAAAGTCAGACAGTGAAAGG + Intergenic
922079118 1:222277525-222277547 AATCAAAGTCAGATAGTCAACGG + Intergenic
922095495 1:222439800-222439822 TTGAAAAAGCAGAAAGTGAAAGG + Intergenic
922169448 1:223142787-223142809 TTTCCAAGGAAGAAAGTGACTGG + Intronic
922203674 1:223428534-223428556 ATCCCATGGCAGAAGGTGAAAGG + Intergenic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
922815902 1:228449086-228449108 AAAAAAAGGAAGAAAGTGAAGGG - Intergenic
923139142 1:231146533-231146555 ATTCAAAAGCAGAGAGTAAATGG + Intergenic
923157321 1:231290065-231290087 CTTCTAAGGCAGAAAGTAAAGGG - Intergenic
924675742 1:246176020-246176042 ATTCAAAAGCAGAAAGATAATGG + Intronic
1063519228 10:6725890-6725912 ATTCATAGACAGAAAGTAGAAGG - Intergenic
1063877187 10:10492585-10492607 ATTGAAAGCAAGAAACTGAAGGG + Intergenic
1064391873 10:14949444-14949466 TTTAAGTGGCAGAAAGTGAATGG - Intronic
1064438922 10:15335648-15335670 ATTCACAGCCTGAAAGTGACAGG + Intronic
1064642592 10:17429512-17429534 ACACACAGGGAGAAAGTGAAAGG - Intronic
1064866057 10:19881439-19881461 AGTCAATGGGGGAAAGTGAAAGG - Intronic
1064887889 10:20132696-20132718 ACTCATATGCTGAAAGTGAAAGG - Intronic
1065173111 10:23051509-23051531 TTTCAAAGGCAGAAAGGCAGAGG - Intergenic
1065587141 10:27230148-27230170 TTTCAAAAGCAGAGAATGAAAGG - Intronic
1066572087 10:36784486-36784508 AATCAGCTGCAGAAAGTGAATGG + Intergenic
1066750912 10:38655987-38656009 ACACAAAGGTTGAAAGTGAAAGG + Intergenic
1066966132 10:42267126-42267148 ACACAAAGGTTGAAAGTGAAAGG - Intergenic
1067384779 10:45808803-45808825 TTCCAAAGGCAGAGAGAGAATGG - Intergenic
1067859494 10:49830367-49830389 ATTCAAAGACAAAAACTGCATGG - Intronic
1068187310 10:53602259-53602281 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1068328138 10:55522681-55522703 ACACATAGGCTGAAAGTGAAGGG - Intronic
1068356633 10:55918348-55918370 ATGCACAGACTGAAAGTGAAGGG + Intergenic
1068489290 10:57701650-57701672 AAGCAAAGGCAGAAAGATAAAGG + Intergenic
1069059541 10:63881088-63881110 ACACAGAGGCTGAAAGTGAAGGG - Intergenic
1069970097 10:72160390-72160412 AGTAAAAGGAAGAAAGTAAAGGG + Intronic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071939036 10:90567156-90567178 TTTCATAGACTGAAAGTGAAGGG - Intergenic
1071962199 10:90818003-90818025 ATCTATAGACAGAAAGTGAATGG + Intronic
1072472752 10:95729183-95729205 ATTTAAGGACAGAAAGAGAAAGG - Intronic
1072827560 10:98623110-98623132 ATTTAAAGGCAGTTAGAGAAAGG + Intronic
1072867165 10:99075881-99075903 ATACATAGGCTAAAAGTGAAGGG - Intronic
1073136684 10:101224342-101224364 AATAAAAGGCAGAAGGGGAAGGG + Intergenic
1073864439 10:107785987-107786009 ACTCATAGGCTGAAAGTGAGAGG - Intergenic
1074392183 10:113067642-113067664 ATTCTAAGGCATAAAGGGGAAGG + Intronic
1074459452 10:113624137-113624159 ATTCACATGCAGAAAGGGAAAGG - Intronic
1074546932 10:114408491-114408513 AGTTGAAGGGAGAAAGTGAAAGG + Intergenic
1074733372 10:116401275-116401297 ATTGCAAGGAAGAAAGTGGAAGG + Intergenic
1075252912 10:120897918-120897940 TTTAAAAGCCAGAAAGTGATTGG - Intronic
1075586795 10:123664466-123664488 AGTGAAAGCCAGAAAGAGAAGGG - Intergenic
1076147742 10:128138014-128138036 ATCAATAGGTAGAAAGTGAAAGG + Intergenic
1076479623 10:130776383-130776405 CAACAAAGGCAGAAAGTGAAGGG - Intergenic
1077063626 11:628130-628152 ATCCACAGACAGAAAGTGGACGG - Intergenic
1078275164 11:9837682-9837704 ATAAAAAGGTAGAAAGTAAAAGG - Intronic
1078501263 11:11880232-11880254 ATTCAAAGACAGTGAATGAACGG + Exonic
1078509415 11:11974480-11974502 ATCCCCTGGCAGAAAGTGAAAGG + Intronic
1078694554 11:13618272-13618294 ACCCATAGGCTGAAAGTGAAGGG - Intergenic
1079414730 11:20223180-20223202 ATTTATAGGCAGAAAGACAAAGG - Intergenic
1079640528 11:22799292-22799314 ATTAAAAGACAGAAAAGGAAGGG + Intronic
1079642324 11:22821612-22821634 TTTTCAAGGCAGAAAGTAAAAGG - Exonic
1079803879 11:24904889-24904911 ATGCATAGACTGAAAGTGAAGGG + Intronic
1079825579 11:25187972-25187994 AATCAAATGCAGAAAATAAAAGG - Intergenic
1079845763 11:25465477-25465499 ACACAAATGCTGAAAGTGAAAGG + Intergenic
1080093817 11:28380425-28380447 ATTAAAAGGCATAAAGTGTTGGG - Intergenic
1080118736 11:28650004-28650026 ATTCAAAGTCAGAAAGCAAGAGG + Intergenic
1080491578 11:32770253-32770275 GTTCAAAGGTAGAAACTGCAAGG + Intronic
1081023135 11:37972153-37972175 AGTCAATGACAGAAAGTGAGAGG - Intergenic
1081386453 11:42478789-42478811 ATTCAAAGGGAGGAGGTGAGAGG - Intergenic
1081685226 11:45037785-45037807 GGGCAAAGGCAGAAACTGAATGG - Intergenic
1082705214 11:56486521-56486543 AGACAAAGGTAGAAAGTGGAAGG + Intergenic
1083094427 11:60234936-60234958 AAACACAGGCTGAAAGTGAAGGG + Intronic
1084295217 11:68208973-68208995 TTTCCAAGGGGGAAAGTGAAGGG + Intronic
1085994201 11:81891794-81891816 ATCTAAAGACAGAAAATGAAAGG - Intergenic
1086648312 11:89253159-89253181 CTATAAAGGAAGAAAGTGAAAGG - Intronic
1086761734 11:90639629-90639651 ATCAAAAGGCACAAAGAGAAGGG + Intergenic
1086774723 11:90816075-90816097 ATTCTGTGGCAGAAAGTGAATGG + Intergenic
1087070666 11:94076919-94076941 ATTCAAAGAGAGAAACAGAATGG - Intronic
1087209599 11:95433309-95433331 TTTCAGAGGAAGGAAGTGAAGGG - Intergenic
1087237792 11:95739377-95739399 ATTAAAAGACAGATGGTGAAGGG - Intergenic
1087253754 11:95932810-95932832 ATTCATAGTCTGAAAGTGAAAGG + Intergenic
1087294675 11:96357106-96357128 ACTCAAAGGCACACAGTGAGAGG + Intronic
1087565354 11:99848969-99848991 TTTAAAAGGCAAAAAGTAAAAGG - Intronic
1087586315 11:100126648-100126670 ATACATAGGCTGAAAGTAAAGGG - Intronic
1087681440 11:101222663-101222685 ATGCATAGGCTAAAAGTGAAGGG - Intergenic
1087773140 11:102232565-102232587 ATTCAAACTCAAAAAGGGAAAGG - Exonic
1087850927 11:103028431-103028453 ATACAAAGACAGAAACTAAAAGG + Intergenic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1087866572 11:103235198-103235220 AATTAAAGGCAGATTGTGAAAGG - Intronic
1088121704 11:106377788-106377810 AATCAAATGCAGATAGTGAAGGG + Intergenic
1088171242 11:106999355-106999377 ATACCAAGGCAGAAACTGATAGG + Intronic
1088703612 11:112438900-112438922 ACACACAGGCTGAAAGTGAAAGG - Intergenic
1089107901 11:116029947-116029969 ATTCCATGGCAGAAGGTGGAAGG - Intergenic
1089854127 11:121526206-121526228 ATTCAATGGGAGAGAGAGAAGGG - Intronic
1090016180 11:123088333-123088355 ATTCAAAGACTGAAAGTAAGGGG + Intronic
1090484782 11:127103401-127103423 ATTTAAAAAAAGAAAGTGAAGGG + Intergenic
1090809695 11:130225978-130226000 ATTCAAAGTCAGAAAATGTTGGG - Intergenic
1091083910 11:132701509-132701531 AAACATAGGCTGAAAGTGAAAGG - Intronic
1091415069 12:275629-275651 AGTCCAAGGAAGAAAGTGAAGGG + Intergenic
1091432536 12:448685-448707 ATTCACAGACTGAAAGGGAAAGG + Intergenic
1091462328 12:653819-653841 ATTGAAAGGCAGAAATTGTCAGG + Intronic
1092510058 12:9145036-9145058 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1093409657 12:18849198-18849220 CTTCAAAGGCAGAATGTCATAGG - Intergenic
1093803584 12:23404216-23404238 ATACATAAGCTGAAAGTGAAGGG + Intergenic
1094402706 12:30079458-30079480 TTTCAAAGGCAGATTCTGAAGGG + Intergenic
1094405726 12:30114277-30114299 ACCGAAAGGCAGAAAGTTAAAGG - Intergenic
1094612022 12:32003612-32003634 ATAAAAAGGGAAAAAGTGAAAGG - Intergenic
1094632550 12:32190373-32190395 ATACATAGGCTGAAAGTAAAGGG + Intronic
1095304453 12:40623264-40623286 ATTCAAATGTAGAATGTTAAAGG - Intergenic
1095741439 12:45611021-45611043 ATTCGAAGTCAGAAATTGCATGG - Intergenic
1096128599 12:49138903-49138925 TTCCAAAGGCAGAAAGCAAAGGG - Intergenic
1096220651 12:49826606-49826628 ATTCAATGTCAAAAAGTGGAAGG + Intronic
1096733809 12:53636557-53636579 ATTTATAGGCTGAAAGTAAAAGG - Intronic
1096778337 12:53977302-53977324 ATACAAAGACAGAAAGAGGAGGG - Exonic
1097311761 12:58126838-58126860 ATTCAAAGGCAGGAAGTTAGGGG - Intergenic
1097478460 12:60089518-60089540 ATTCAACTGCAGAAAATCAAAGG - Intergenic
1097764304 12:63506843-63506865 ACACATAGGCTGAAAGTGAATGG + Intergenic
1097811270 12:64021842-64021864 ATTCATTGGCTAAAAGTGAAAGG + Intronic
1098413938 12:70212285-70212307 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1098565668 12:71932917-71932939 TTTCATAGACAGAAAGTGAGAGG - Intergenic
1098601498 12:72336693-72336715 ATCCCATGGCAGAAAGTGGAAGG + Intronic
1098735278 12:74093958-74093980 ATCCATAGACTGAAAGTGAAGGG - Intergenic
1098886156 12:75962644-75962666 AGACAAAGGCAGAGAGTGAAAGG + Intergenic
1099217577 12:79872010-79872032 ATTTCAAGGCAGAAACTGTATGG - Intronic
1099389067 12:82056036-82056058 CTTCAAAGGTAGGAAGGGAAAGG - Intergenic
1099513775 12:83570393-83570415 TTTCCATGGCAGAAAGTGGAAGG + Intergenic
1099554431 12:84092614-84092636 ATTCATAGGCAGACAGGGACAGG - Intergenic
1099697650 12:86042264-86042286 ATTAAAAGGCACAAAGTGGCAGG - Intronic
1100760930 12:97806108-97806130 ATTCAAAGGCATTTAGTGAGGGG + Intergenic
1100933866 12:99640537-99640559 ATCCCAAGGCAGAAGGTGAGAGG - Intronic
1101032093 12:100670771-100670793 ATTCAAAGGCGCAAAGCAAATGG - Intergenic
1101275242 12:103192523-103192545 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1101468501 12:104972955-104972977 ATTAAAAAGCAGAAAGTAAAAGG - Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102183225 12:110928569-110928591 ATTGTAAGGGAGAAAGGGAAAGG + Intergenic
1103870883 12:124090728-124090750 ATTCAGCTGCAGAAAGTGAATGG + Intronic
1104248152 12:127062518-127062540 ACTCAGAGACAGAAAGTTAAGGG + Intergenic
1105299827 13:19123079-19123101 ATACATAGACTGAAAGTGAAGGG - Intergenic
1105698894 13:22919532-22919554 ATTCAAGGGTGGAAAGGGAAGGG - Intergenic
1105880745 13:24604616-24604638 ATCCACAGGCTGAAAGTAAAGGG - Intergenic
1106236276 13:27863237-27863259 TTTCTAAGGCAGAATGAGAAAGG + Intergenic
1106399810 13:29418855-29418877 ATTCAAAAGCTGAGAGAGAATGG - Intronic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1107156818 13:37177085-37177107 GTTAAAAGACATAAAGTGAAAGG + Intergenic
1107484821 13:40815658-40815680 CTTAAAAGGCAAAAAGTGACAGG + Intergenic
1107484829 13:40815745-40815767 ATCCACAGGCTGAAAGTAAAGGG + Intergenic
1107556349 13:41519543-41519565 ATGCAAAGGCAGAACGCGGAAGG - Intergenic
1108005621 13:45943089-45943111 ATCCCATGGCAGAAAGTGGAAGG - Intergenic
1108149432 13:47517187-47517209 GTTCAAAGTCAGAAAGAGAAGGG + Intergenic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108833040 13:54502768-54502790 ATACATAGGCTGAAAATGAAAGG - Intergenic
1109074983 13:57823368-57823390 ATTCCTAGGCAGACAGTGACAGG + Intergenic
1109807413 13:67461641-67461663 ATTAAAAGACAAAAAGTGAATGG + Intergenic
1110017338 13:70424229-70424251 ATTTTAAGGCAGAATTTGAAAGG + Intergenic
1110747670 13:79073947-79073969 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1111073709 13:83204922-83204944 ATTCCATGGCAGAAAGTGAAAGG + Intergenic
1111240348 13:85465552-85465574 ATAAAATGGCAGAATGTGAAAGG - Intergenic
1112144016 13:96678092-96678114 ATTCCCTGGCAGAAAGTGGAAGG + Intronic
1112337648 13:98527956-98527978 ACTCAACGGCAGAAAGCAAAAGG + Intronic
1112448774 13:99490783-99490805 ATTCAAAGGCAAAAAGGTATTGG + Intergenic
1112843048 13:103603668-103603690 ATTCAGAGTCAGAAAGTAGAAGG + Intergenic
1113036611 13:106056778-106056800 GTTAAAAGTAAGAAAGTGAAAGG + Intergenic
1113236865 13:108286195-108286217 AATCAGAGACAGAAAGTGATGGG - Intronic
1113353216 13:109550015-109550037 ATTCAAAGGCACAAACTTGAGGG - Intergenic
1113675919 13:112207883-112207905 AATGAAACCCAGAAAGTGAAAGG - Intergenic
1113873247 13:113577532-113577554 ACTCATAGGTTGAAAGTGAAAGG + Intergenic
1114267917 14:21083577-21083599 GTTCAAAGCCAGAAAGTAAAGGG + Intronic
1114390012 14:22297468-22297490 GTTCAAAGGCAGAATGTGCCAGG - Intergenic
1114991359 14:28294133-28294155 AATCAAAGACAGAAGGTTAAAGG - Intergenic
1115423179 14:33221783-33221805 AGTCAAAGGCAGAAATGGATGGG - Intronic
1115483931 14:33890761-33890783 ATATATAGGCTGAAAGTGAAAGG + Intergenic
1116340360 14:43714999-43715021 ATACATAGGCTGAAATTGAAGGG + Intergenic
1116384650 14:44315635-44315657 ATTCTAATGCACAAAGAGAAAGG + Intergenic
1116400156 14:44497002-44497024 TTTGAAAGGTAGAGAGTGAAAGG + Intergenic
1116551993 14:46252224-46252246 ATTTAAAAACAGAAAGAGAATGG - Intergenic
1116921270 14:50578383-50578405 ATACAAAGGCAGACAAGGAAAGG + Intronic
1116988911 14:51252309-51252331 ATTGAAAGGTATAAAGTAAAGGG + Intronic
1117132599 14:52701120-52701142 ATTCAATGACAGAAATTGTATGG - Intergenic
1117916800 14:60686192-60686214 ATACAGAGTCAGAAAGTAAAAGG + Intergenic
1118100689 14:62598599-62598621 ATACAAAGACTGAAAGTGAAAGG + Intergenic
1118626963 14:67668424-67668446 ATTCAAAGGCAGAAAGTGAATGG + Intronic
1119109072 14:71954806-71954828 ATTCTAATGGAGAAAGTAAATGG - Intronic
1119913560 14:78373702-78373724 AATGCAAGGCAGAAAGGGAATGG + Intronic
1120516144 14:85472664-85472686 ATGAAAAGGCAGAAAATAAATGG + Intergenic
1120982273 14:90300840-90300862 AAACAAAGGCAGAAAGGGGATGG + Intronic
1121183774 14:91948948-91948970 ATTCAAAGTCAGATAGTGACTGG + Intergenic
1121420984 14:93814069-93814091 ATTCCATGGCAGAAGGTGGAAGG + Intergenic
1122612242 14:102993488-102993510 AGTGAAAGGCAGAAAGAGAGAGG + Intronic
1123508904 15:20975361-20975383 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123566126 15:21549110-21549132 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123602386 15:21986397-21986419 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1123873183 15:24596916-24596938 ATTCAAAGGCTTAGAATGAATGG - Intergenic
1123897424 15:24842359-24842381 ATTCTCAGGCAGTAAGTTAAAGG + Intronic
1124389433 15:29240552-29240574 ATCCCATGGCAGAAGGTGAAAGG - Intronic
1124397909 15:29320933-29320955 ATTAAAAGGCAAAAAGAGAATGG + Intronic
1125254465 15:37746993-37747015 ATCCAAAGGCTCAAAGTAAAGGG + Intergenic
1125460123 15:39898465-39898487 AAGCAAAGACAGAGAGTGAAAGG + Intronic
1125996838 15:44169927-44169949 ATACACAGGCAATAAGTGAAAGG - Intronic
1126297693 15:47159435-47159457 ATTGAAAGGCAGAAAGAAAAAGG + Intergenic
1126652345 15:50937562-50937584 AGTGTAAGGCAGAATGTGAAGGG + Intronic
1126745324 15:51820055-51820077 ATACATAGGCTGAAAATGAAGGG + Intergenic
1126920693 15:53520081-53520103 TTTCATAGGCAGAAAGCAAAAGG - Intronic
1127060212 15:55174803-55174825 ATTCAATGGCAGAAAAGCAAAGG + Intergenic
1127195836 15:56584456-56584478 CTACATAGGCTGAAAGTGAAGGG - Intergenic
1127468494 15:59268412-59268434 ATTCAAAGGCATTAATTCAAAGG + Intronic
1127759333 15:62122352-62122374 ATTCAAAAAGAGGAAGTGAAGGG + Intergenic
1127877707 15:63124984-63125006 ATTTAAAGGCAGTAAGTTGATGG + Intronic
1128221690 15:65973738-65973760 ATTCTGTGGCAGAAAGTCAATGG + Intronic
1129463202 15:75710191-75710213 ACTGAAAGGCAGAATGTGAGGGG - Intronic
1129628638 15:77233226-77233248 AATGGAAGGTAGAAAGTGAAGGG - Intronic
1129721683 15:77881210-77881232 ACTGAAAGGCAGAATGTGAGGGG + Intergenic
1130077822 15:80704901-80704923 ATTGCAAGCCTGAAAGTGAAAGG + Intronic
1130145762 15:81272742-81272764 GTTCAGAAGCAGAAAGTGATTGG + Intronic
1130274061 15:82467421-82467443 ACCCAAAGGCAGAACATGAAGGG + Intergenic
1130466409 15:84194795-84194817 ACCCAAAGGCAGAACATGAAGGG + Intergenic
1130497855 15:84478741-84478763 ACCCAAAGGCAGAACATGAAGGG - Intergenic
1130588703 15:85199388-85199410 ACCCAAAGGCAGAACATGAAGGG + Intergenic
1131321542 15:91397948-91397970 ACACAAAGGCTGAAAGTAAAGGG - Intergenic
1131720022 15:95157763-95157785 ATTCACAGCCAGAAGTTGAATGG - Intergenic
1202974493 15_KI270727v1_random:276200-276222 GCCCAAAGGCTGAAAGTGAAGGG - Intergenic
1132992437 16:2803002-2803024 ACACACAGGCTGAAAGTGAAAGG - Intergenic
1133571947 16:7049691-7049713 ATTAAAAAGCAGCAAGTGGAGGG - Intronic
1135046724 16:19162030-19162052 GTTCAAGGGAAGAAGGTGAAAGG + Intronic
1135480941 16:22819899-22819921 AATCAAAGGCAGAAGGTAAGGGG + Intronic
1135541565 16:23333938-23333960 ATTCAAGGGCAGACAGGGTAGGG - Intronic
1135650298 16:24200631-24200653 ATCCCATGGCAGAAGGTGAAGGG + Intronic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136731812 16:32421122-32421144 ACACAAAGGTTGAAAGTGAAAGG - Intergenic
1136751783 16:32643127-32643149 ATTCAAAGAGAGAATCTGAATGG + Intergenic
1136944406 16:34629971-34629993 AATCGAATGCAGAAATTGAATGG - Intergenic
1136944441 16:34630415-34630437 AATCAAACGCAGAAATTGAATGG - Intergenic
1136950487 16:34711820-34711842 AATCAAATGGAGAAATTGAATGG - Intergenic
1136954320 16:34762838-34762860 AATCAAATGAAGAAATTGAATGG - Intergenic
1137091306 16:36194813-36194835 AATCAAATGGAGAAATTGAATGG - Intergenic
1137218046 16:46418549-46418571 AATCAAATGGAGAAATTGAATGG + Intergenic
1137257502 16:46789032-46789054 ACACAAAGGCTGAAAGTGAAGGG + Intronic
1137485134 16:48884228-48884250 CTTCCAAGGTAGGAAGTGAAGGG - Intergenic
1137626787 16:49914108-49914130 GATCAAAGGCAAAAAATGAAAGG + Intergenic
1137703392 16:50515762-50515784 ACACATAGGCTGAAAGTGAAAGG - Intergenic
1137822577 16:51460031-51460053 ATTCAAAGGGAGAGAGAGAGAGG - Intergenic
1138905753 16:61330177-61330199 ACTTACAGGCTGAAAGTGAATGG - Intergenic
1140169524 16:72589118-72589140 ATTCCCAGGTAGTAAGTGAAAGG + Intergenic
1140859937 16:79009761-79009783 TTTCAAAGGAAGAAATGGAATGG + Intronic
1141057271 16:80830254-80830276 ATTCAAAGCAAGAAAATGATGGG - Intergenic
1141869037 16:86772021-86772043 TTTCAACGGCAGGAAGGGAATGG + Intergenic
1202994578 16_KI270728v1_random:96132-96154 ACACAAAGGTTGAAAGTGAAAGG + Intergenic
1203021265 16_KI270728v1_random:408474-408496 ACACAAAGGTTGAAAGTGAAAGG + Intergenic
1203053919 16_KI270728v1_random:902381-902403 ATTCAAAGAGAGAATCTGAATGG + Intergenic
1143257243 17:5569396-5569418 ATTCATAGGCTCAAAGTAAAGGG + Intronic
1143458052 17:7080441-7080463 ATGTAGAGGCAGGAAGTGAAAGG - Intergenic
1143462877 17:7115027-7115049 ATTCGGAGGCAGGAAGTGAGAGG - Intronic
1143694333 17:8600280-8600302 TATACAAGGCAGAAAGTGAAGGG + Intronic
1144522324 17:15961720-15961742 ATCCCATGGCAGAAAGTGAGAGG + Intronic
1144794914 17:17884543-17884565 ATTCAAAGGCAGCAGCAGAAGGG + Intronic
1144837055 17:18162003-18162025 ATTCAGAGGCAGGAAGGGTAAGG - Intronic
1144967383 17:19086438-19086460 ATTCAAAGGCAGGGAGTATAGGG + Intergenic
1144980536 17:19165628-19165650 ATTCAAAGGCAGGGAGTATAGGG - Intergenic
1144987686 17:19212605-19212627 ATTCAAAGGCAGGGAGTATAGGG + Intergenic
1145722309 17:27084356-27084378 ATACATAGACTGAAAGTGAAGGG + Intergenic
1145883248 17:28366713-28366735 AGTGAAGGGCAGAAACTGAAAGG - Intronic
1146328582 17:31908480-31908502 ATTGGAAGGCAGAATGAGAAGGG - Intergenic
1146430316 17:32787172-32787194 ATTAAAAGACATAAAGAGAATGG + Intronic
1146587595 17:34095810-34095832 GTTCATAGACAGAAAGTGAAGGG + Intronic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1148217937 17:45844075-45844097 ATGGAGAGGAAGAAAGTGAAGGG - Intergenic
1148676476 17:49448507-49448529 ATGCATGGGCAGGAAGTGAAAGG + Intronic
1149143579 17:53462787-53462809 ACCCAAAGGCAGAACCTGAAAGG + Intergenic
1149189186 17:54038118-54038140 ATTCACAGGCAAAAAGTAAAGGG - Intergenic
1149344285 17:55718535-55718557 ATAAAAAATCAGAAAGTGAATGG - Intergenic
1149615468 17:57993921-57993943 ATGAAAGGGGAGAAAGTGAAAGG - Intronic
1149731321 17:58949360-58949382 ATACACAGACTGAAAGTGAAGGG - Intronic
1150031845 17:61746465-61746487 ACCCATAGGCTGAAAGTGAAGGG + Intronic
1150512066 17:65764632-65764654 ATACATAGGCTGAAAGTGAAGGG - Intronic
1150512205 17:65766657-65766679 ATACATAGGCTGAAAGTGAAGGG + Intronic
1152405319 17:80095053-80095075 ATCCACAGGCAGACAGTGCAAGG - Intronic
1152493117 17:80651198-80651220 CTTCTAAGTCAGAAAGTGGAAGG + Intronic
1156140802 18:34108472-34108494 ACACATAGGCTGAAAGTGAAAGG + Intronic
1156217534 18:35015117-35015139 AAGTAAAGTCAGAAAGTGAAGGG - Intronic
1157205365 18:45693589-45693611 ATTCATAGGCTCAAAGTAAAGGG + Intergenic
1157244186 18:46039082-46039104 TTTGTAAGGCAGTAAGTGAAAGG - Intronic
1157839206 18:50939703-50939725 AATTAAAGGCAGAGAGAGAATGG + Intronic
1157908687 18:51594792-51594814 ATTCAAAGGCAGGAAGAGTGAGG + Intergenic
1158157136 18:54438720-54438742 ATGCAAAGGCAGAAGTAGAAAGG - Intergenic
1158931761 18:62329984-62330006 ACTCAAAGGCTGAAAGTCGACGG - Intronic
1158985661 18:62813808-62813830 ATTAAAATGCTGAAAGGGAAAGG - Intronic
1159257778 18:65970616-65970638 ATTACAAGCCAAAAAGTGAATGG + Intergenic
1159258663 18:65981194-65981216 AAGGAAAGGCAGAAAGAGAAAGG - Intergenic
1162869406 19:13574259-13574281 ATCCAAAGGGAGAGAGAGAAAGG + Intronic
1163399563 19:17083956-17083978 ATTTAAATACACAAAGTGAATGG + Intronic
1165039063 19:33056025-33056047 ATTGAAAGGCCCAAAATGAAAGG - Intronic
1165599401 19:37040611-37040633 ATTCAAACTCAAAAAGAGAAAGG + Intronic
1166385451 19:42378146-42378168 TTTCAACAGCAGAAATTGAATGG + Intronic
1202698440 1_KI270712v1_random:143301-143323 ATTCATAGACAGAAATAGAATGG - Intergenic
925550861 2:5072900-5072922 ATTATAAGGCAGAAAATGAGGGG + Intergenic
925645014 2:6027040-6027062 ACAGAAAGGCAGAAAGAGAAAGG - Intergenic
925872232 2:8281511-8281533 ATTTAAAAGCAGTAAATGAATGG + Intergenic
925909055 2:8560306-8560328 ATACAGAAGCTGAAAGTGAAGGG + Intergenic
926942451 2:18152611-18152633 ATGCAAACACAGAAAGAGAAAGG - Intronic
926963687 2:18387036-18387058 ATCCAAGGGCAGAAGGAGAAGGG - Intergenic
927518213 2:23684120-23684142 AATCAAACCCAGAAATTGAAAGG - Intronic
927736629 2:25529296-25529318 ATTCAAATGCAGAAAGCGAGCGG + Intronic
927796424 2:26052883-26052905 ACACCAAGGCAGAAAGTGAGGGG - Intronic
927873108 2:26636545-26636567 ATTACAAGGAAGATAGTGAAGGG - Intronic
927960755 2:27239397-27239419 TTTGAAGGGCAGAAAGTGAAGGG + Exonic
928487224 2:31745085-31745107 ATTCAAAGACAGGAATGGAATGG - Intergenic
928491822 2:31792340-31792362 ACTCAGAAGCAGAAAGTCAATGG + Intergenic
928773426 2:34729973-34729995 ATGAAAAGTCAGAGAGTGAAAGG - Intergenic
928871928 2:35990459-35990481 ATCCAAGGGCAGAAAATAAATGG + Intergenic
929234360 2:39590720-39590742 ATTTTAAGGGAGAAAGAGAAAGG + Intergenic
929326499 2:40617996-40618018 ATTGGAAGGGAGAAAGTGAGAGG - Intergenic
929373576 2:41256603-41256625 ATGGAAAGAAAGAAAGTGAAAGG + Intergenic
929386955 2:41420449-41420471 ACTCCAAGGCAGAAACTAAAGGG - Intergenic
930333880 2:50020865-50020887 ACTCAAAAGTAGAAAGAGAAAGG - Intronic
930406486 2:50963360-50963382 AATGAAAGGAGGAAAGTGAAAGG - Intronic
930421526 2:51159197-51159219 ATTCAAATGTAAAAAGTGCATGG - Intergenic
930513240 2:52372843-52372865 TTTGAAAGGAAAAAAGTGAAAGG + Intergenic
931377125 2:61717782-61717804 ATTCAAAGGCAGCAATGGCAAGG + Intergenic
931390363 2:61837224-61837246 ATTCAATGGGAGCAAGTCAAAGG + Intronic
932201571 2:69832618-69832640 ATACACAGGTAAAAAGTGAAAGG - Intronic
932843200 2:75104188-75104210 ACACAAAGACTGAAAGTGAAGGG + Intronic
933007469 2:77014234-77014256 AGGCAAAGGCAGATGGTGAAAGG + Intronic
933870342 2:86559798-86559820 ATTCATAGGCAGGAAGAGGATGG + Intronic
934189340 2:89772108-89772130 ATTCAAAGGAACAAAATAAACGG - Intergenic
934279689 2:91601083-91601105 ATTCATAGACAGAAATAGAATGG - Intergenic
934313908 2:91898143-91898165 ACACAAAGGTTGAAAGTGAAAGG + Intergenic
935550443 2:104447549-104447571 ATTCAGAGGAAGAGAGAGAAAGG + Intergenic
935913642 2:107925164-107925186 ATTTAAAGGCAGGAAAAGAAGGG + Intergenic
936998035 2:118435768-118435790 AGACAAAGGCAGAAAGAGAGAGG + Intergenic
937451647 2:122007247-122007269 TTTCAAAGGAAGAAAGCGGAGGG - Intergenic
937535165 2:122877308-122877330 ATTTTAAGTCAGAAAATGAATGG - Intergenic
937649319 2:124302476-124302498 ATCCCATGGCAGAATGTGAAGGG + Intronic
937891940 2:126945726-126945748 ATTGAAAGGCAAAAAGGGAGGGG - Intergenic
938201875 2:129378773-129378795 ATTCAAAGGCATCAAGTGCCTGG + Intergenic
938726574 2:134113999-134114021 ATTCAAAGGCAGCAAGTCCAGGG + Intergenic
938952767 2:136270861-136270883 ATACATAGGCTGAAAGTGGAGGG + Intergenic
939444424 2:142290425-142290447 ACTCCAAAGCAGAAAATGAAAGG + Intergenic
939688877 2:145233022-145233044 AAACAAAGGCAGATGGTGAAGGG - Intergenic
940013089 2:149075145-149075167 AATCAAAAGCATAAAGTTAATGG - Intronic
940086909 2:149870419-149870441 ATTAAAACACAGAAAGTAAATGG + Intergenic
940174731 2:150865455-150865477 ATCCCATGGCAGAAGGTGAAAGG + Intergenic
940280552 2:151984631-151984653 CATCAAAGGCTGAATGTGAAAGG - Intronic
941116988 2:161482914-161482936 ATACATAGGCTGAAAGTGAAGGG + Intronic
941166595 2:162089650-162089672 ATTCGAAGGCAGGAAGGGCAGGG - Intergenic
942519434 2:176787887-176787909 ATGCAAAGTCAGATAATGAACGG - Intergenic
942608475 2:177716452-177716474 ACATGAAGGCAGAAAGTGAAGGG - Intronic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
944269186 2:197761728-197761750 ACACATAGGCTGAAAGTGAAGGG + Intronic
944927416 2:204479407-204479429 ACTTAAAGGAAGAAAGGGAAAGG - Intergenic
944935887 2:204567402-204567424 ATTCATAGACAGAAAGTAAATGG - Intronic
945699049 2:213148682-213148704 ATTTAATGGCAGATACTGAAAGG - Intronic
946060827 2:216940074-216940096 TTTTTAAGGCAGAAATTGAAAGG + Intergenic
946491143 2:220150304-220150326 ATTCACAGTCTGAAAGTGTATGG - Intergenic
946500769 2:220245069-220245091 ACTCAAAGGAAGAAAGTGACTGG + Intergenic
946547012 2:220754892-220754914 ATTAAGAGACAGAAAGTGAGAGG + Intergenic
946705206 2:222451721-222451743 AATCAAAGGAAGGAAGAGAAGGG + Intronic
947264422 2:228261231-228261253 ATTGAAAAACAGAAAGGGAATGG + Intergenic
947738344 2:232471512-232471534 ACTCATAGACTGAAAGTGAAAGG - Intergenic
948235902 2:236390332-236390354 ACACATAGGCTGAAAGTGAAGGG - Intronic
948678298 2:239611959-239611981 ATTCAGAGTGAGGAAGTGAAAGG - Intergenic
948919748 2:241058079-241058101 ATACAAAGAATGAAAGTGAAAGG + Intronic
1168918846 20:1514196-1514218 ATTCAAAGGAAAAAAATAAATGG - Intergenic
1169282455 20:4279212-4279234 ATTCAAGGCAAGAAAGTCAAGGG - Intergenic
1170447086 20:16439453-16439475 ATTGTCAGGTAGAAAGTGAAGGG - Intronic
1171101383 20:22386572-22386594 AATAAAATGCAAAAAGTGAAAGG + Intergenic
1171281916 20:23908212-23908234 AATGAAAGACAGAAAGTTAAAGG - Intergenic
1171322712 20:24260486-24260508 ATTCACAGGCAGAAACTCAGAGG + Intergenic
1171464286 20:25316984-25317006 TTTCCAGGGCAGGAAGTGAAGGG - Intronic
1173055030 20:39603714-39603736 ATTCAGAGACAGAAAGTGGAAGG - Intergenic
1173223973 20:41151104-41151126 ATCCAAAGGAAGGAAGGGAAAGG - Intronic
1173835765 20:46124318-46124340 AATCAAATGCAAAAAGTTAATGG - Intronic
1173990463 20:47298662-47298684 AATAAAAGGAAGAAAGAGAAAGG + Intronic
1174188229 20:48722031-48722053 ACTCAAATGCAGAAACTCAACGG + Intronic
1175345246 20:58268416-58268438 AGTCAAGGGCAGAAAGGGACAGG + Intergenic
1175743242 20:61435528-61435550 ATTCAAAGACAGGGAGTGCAAGG + Intronic
1175845583 20:62057108-62057130 CTGCAAAGTCAGAAAATGAAAGG + Intronic
1176312037 21:5156567-5156589 ATTTAGAGGAAGAAAGTGAAGGG - Intergenic
1177081797 21:16648782-16648804 ATCCAAAGGCAGTAATTGAGGGG + Intergenic
1177488839 21:21794681-21794703 ATTCAGAGGGTGAAAGTGAAGGG + Intergenic
1177566062 21:22821875-22821897 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1177584136 21:23068183-23068205 ATCCAAAGGGGGAAAGCGAAGGG - Intergenic
1177698503 21:24605346-24605368 ATTCAAATGGAGAAAATGACAGG - Intergenic
1177817623 21:25994930-25994952 ATTCAATCACAGCAAGTGAAGGG - Intronic
1178156509 21:29860021-29860043 TTACAAAGGAAGAAAGTGCAGGG + Intronic
1178585847 21:33869986-33870008 TTACAAAGGCAGAAGGGGAAAGG - Intronic
1178789941 21:35690592-35690614 ATGCAAAGGGAAAATGTGAAGGG + Intronic
1179214498 21:39355079-39355101 AGACATAGGCTGAAAGTGAAGGG + Intergenic
1179225849 21:39452272-39452294 AATCAAATGCAGAAAGCAAAGGG - Intronic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1179845011 21:44105463-44105485 ATTTAGAGGAAGAAAGTGAAGGG + Exonic
1180028929 21:45188544-45188566 ATACATAGGCCGAAAGTGAAAGG - Intronic
1180593076 22:16956917-16956939 TTTAAAAGGCTCAAAGTGAAGGG - Intergenic
1181702024 22:24626872-24626894 AGTGATAGGCAGAGAGTGAATGG - Intronic
1182348594 22:29685037-29685059 ATGCAAAAGCTGATAGTGAATGG + Intronic
1182398883 22:30059077-30059099 ACACAAAGGCTGAAAATGAAAGG + Intergenic
1182618631 22:31605486-31605508 ATACAAAGGAAGGAAATGAAAGG - Intronic
1182906323 22:33940050-33940072 AGACAAAGGCAGAAAGAGAATGG + Intergenic
1183122848 22:35743996-35744018 AATTAAAGGCAGAAATTTAAAGG + Intronic
1184811498 22:46836755-46836777 ACACATAGGCTGAAAGTGAAGGG + Intronic
949569777 3:5282095-5282117 ATACATAGACTGAAAGTGAAGGG - Intergenic
949595709 3:5544734-5544756 ATGTATAGGCTGAAAGTGAAGGG - Intergenic
949621591 3:5818780-5818802 ATCCAAAGGCAGGAAATGAAGGG + Intergenic
950322935 3:12074190-12074212 ATAGAAAGGCTGAAAGTAAAGGG - Intronic
950563071 3:13746992-13747014 ATTCAATGGCAGAGATGGAATGG + Intergenic
951478763 3:23136650-23136672 ATTCAAATCAAGAAAGTGAGGGG + Intergenic
951988982 3:28654429-28654451 ATGCAAGGGCAGAAAAGGAAAGG + Intergenic
952061428 3:29515711-29515733 AGGCAAAGGCAGGAAGTGAAAGG - Intronic
952273994 3:31859600-31859622 ATCCCATGGCAGAAAGTGAAAGG - Intronic
952670877 3:35966762-35966784 GTTCAAAAGAAGGAAGTGAAAGG + Intergenic
952874381 3:37931039-37931061 ACACATAGGCTGAAAGTGAAAGG - Intronic
953212439 3:40888047-40888069 CTTCAGCGGCAGAAAGTCAAAGG - Intergenic
953224673 3:41007464-41007486 ACACATAGGCTGAAAGTGAAGGG - Intergenic
954535149 3:51354358-51354380 CTTCAAAGGAAGAAAGAGAGAGG - Intronic
955062031 3:55501161-55501183 AATCAAATGCAGAAACTGATTGG + Intergenic
955119833 3:56046823-56046845 TTTGAAAGGAAGAAAATGAAAGG - Intronic
955427312 3:58805462-58805484 ATTAAAAGACAGAAAGAGATAGG - Intronic
955699480 3:61669857-61669879 ATTCAAAGGCAGCACGTGTCTGG - Intronic
956226162 3:66961675-66961697 ATACAAATACAGAAAGGGAAAGG - Intergenic
956241403 3:67134770-67134792 ATTCCAATGAAGACAGTGAAAGG - Intergenic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956516704 3:70057275-70057297 ATTCAAAAGTAGAGAGGGAAGGG - Intergenic
956768091 3:72501623-72501645 ATGCCAAGGCAGTTAGTGAAAGG + Intergenic
957264117 3:77939048-77939070 AAGCAAAGGCAGAAATTAAATGG - Intergenic
957619551 3:82577790-82577812 AGTCATAGGAAGAAAGTGATAGG + Intergenic
957782942 3:84843093-84843115 ATGCAAAGGCAGAAACTTCAGGG + Intergenic
958075943 3:88678814-88678836 CTTCAAAGGGAAAAAATGAATGG + Intergenic
958450151 3:94262886-94262908 ATTAAAAGGGAAAAAGAGAATGG - Intergenic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
958770121 3:98415675-98415697 ATACAAGGACTGAAAGTGAAGGG + Intergenic
958799364 3:98737762-98737784 ATCCAAAGGCTGAAAGTAAAGGG + Intronic
959026944 3:101250306-101250328 ATTAAAGTCCAGAAAGTGAAAGG + Intronic
959047382 3:101489433-101489455 ATTCACAGGCTCAAAGTAAAGGG + Intronic
959147182 3:102562739-102562761 ATACAAAGTCTAAAAGTGAAGGG - Intergenic
959395138 3:105827603-105827625 AGCCAAAGGCAGAAAGGGGAGGG + Intronic
959630578 3:108502850-108502872 CTTGAAATACAGAAAGTGAAGGG - Intronic
959919026 3:111850288-111850310 ACTCAAAGGGAGAAGGTGAGGGG + Intronic
960655686 3:120001459-120001481 AATCATGGGCAGAAGGTGAAGGG - Intronic
960680957 3:120247014-120247036 AATCGAAGGCACAAAGGGAAGGG + Intronic
960777351 3:121272487-121272509 ACACATAGGCTGAAAGTGAAGGG - Intronic
960777405 3:121273600-121273622 ATTCAGAGGAAGAGAGAGAAAGG - Intronic
960822292 3:121748049-121748071 AATCAAAGGGAGAAAAAGAAAGG + Intronic
960922712 3:122763958-122763980 TTTAACAGGCAGAAATTGAAGGG - Intronic
961522804 3:127477069-127477091 AATCAAAGGCAGAGAGAGCATGG + Intergenic
961747361 3:129073089-129073111 ATTCCAAGACAGAAAGTGGGTGG + Intergenic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962489184 3:135874992-135875014 ACACATAGGCTGAAAGTGAAGGG + Intergenic
962538599 3:136354900-136354922 ATACAAAGGCAGAAAGTGAAAGG + Intronic
962543194 3:136404200-136404222 AATCCAAGGCAGAAAGAGTATGG - Intronic
963299357 3:143581547-143581569 ATGCAAAGAAAGAAAGAGAAAGG - Intronic
963553946 3:146761651-146761673 ATTCCATGGCAGAAGTTGAAAGG + Intergenic
963573017 3:147021016-147021038 ATACACAGACTGAAAGTGAAGGG + Intergenic
963976882 3:151490165-151490187 ACACATAGGCTGAAAGTGAAGGG + Intergenic
965144223 3:164878909-164878931 ATTCATAGGCAGACAGGGACAGG + Intergenic
965680766 3:171248911-171248933 ATTCAAAGGCTGAAAGAAAAAGG - Intronic
966457164 3:180130396-180130418 ATTCCAAGGGAGAAAATAAAAGG + Intergenic
969141841 4:5081970-5081992 ATGCAAAGACAGAAAGGCAAGGG - Intronic
969314806 4:6375435-6375457 AGGCAGAGGCAGAAAGAGAATGG - Intronic
969346869 4:6575513-6575535 GTTCAGAGGCAGGAAGTGACTGG - Intronic
970297829 4:14650210-14650232 ATTCAAAGGGAGAATGTTAGAGG - Intergenic
970620948 4:17817677-17817699 AATCAAAGTAAGAAACTGAAGGG - Intronic
970721447 4:18994027-18994049 ATTCTATGGCAGAAGATGAAAGG - Intergenic
971784301 4:31080981-31081003 GATCCATGGCAGAAAGTGAAAGG - Intronic
971984705 4:33806995-33807017 ATCCCATGGCAGAAGGTGAAAGG - Intergenic
972195818 4:36652736-36652758 ATTCAAAAGCAGCAGGTGTATGG - Intergenic
972834395 4:42851739-42851761 ATACACAGGCTGAAAGTGAAGGG - Intergenic
973014357 4:45118990-45119012 AAATAATGGCAGAAAGTGAAGGG + Intergenic
973144619 4:46810100-46810122 ATACAGAGGCTGAAAGTGAAGGG - Intronic
973579578 4:52329262-52329284 ACTCACAGACTGAAAGTGAAGGG - Intergenic
974162883 4:58162890-58162912 ATTCAAAGGCTAAAAGGCAATGG - Intergenic
974461084 4:62188746-62188768 ATTCAAAGGAAGAAGGAAAATGG + Intergenic
974542758 4:63259789-63259811 ATTCAATGGCAGATATTGGAAGG - Intergenic
974796337 4:66755808-66755830 ATCCCATGGCAGAAGGTGAAAGG - Intergenic
974963668 4:68734471-68734493 ATACATAGACTGAAAGTGAAGGG - Intergenic
975224344 4:71853595-71853617 ACACATAGGCAGAAAGTAAAGGG - Intergenic
975448553 4:74497812-74497834 ATACATAGGCTGAAAGTAAAAGG - Intergenic
976176599 4:82360305-82360327 TTTAAAATGCAGAAAGTGATGGG + Intronic
976361972 4:84190345-84190367 ATTGAAACCCAGAAATTGAAGGG + Intergenic
976390346 4:84499115-84499137 AGTCAAAGGCTGAGAGTGAGAGG - Intergenic
976521598 4:86034206-86034228 ATTCAAAGGGTGAAAGTCACAGG - Intronic
976891539 4:90053883-90053905 ATTCGAAGGCAGGAATAGAAGGG + Intergenic
976936086 4:90635629-90635651 ATTTCAAGGAAGAAAGTTAAAGG - Intronic
977114732 4:93009446-93009468 ATACAAAGCCAGAACCTGAATGG + Intronic
977706780 4:100080435-100080457 ATCCAATGGCAGAAGGTGTAAGG + Intergenic
977872515 4:102109018-102109040 ACACACAGGCTGAAAGTGAAAGG + Intergenic
977946119 4:102916217-102916239 ACACAAAGGTTGAAAGTGAAAGG + Intronic
978524560 4:109652556-109652578 ATCCCATGGCAGAAGGTGAAAGG + Intronic
978889021 4:113800203-113800225 ATCAAATGGCATAAAGTGAAAGG - Intergenic
979535852 4:121819798-121819820 AGTCAAAGGAAGTAAATGAAAGG + Intronic
979746898 4:124226825-124226847 ATACATAGTCTGAAAGTGAAGGG + Intergenic
980455833 4:133041601-133041623 ACACAAAAGCTGAAAGTGAAGGG + Intergenic
980465064 4:133164486-133164508 ATTTCAAGGCAAAAAGTGAAGGG + Intronic
981301606 4:143192889-143192911 ATGGAAAGGCAGAAATGGAAAGG + Intronic
981505690 4:145496816-145496838 CTTCAAAGGGAGAAAGTGGTAGG - Intronic
981686019 4:147455905-147455927 GATCAAATGCAGACAGTGAATGG - Intergenic
982165779 4:152612459-152612481 GTTCAAAGACAGAAAGTCCAGGG - Intergenic
982267179 4:153548697-153548719 AGGTAAAGGCAGAAAGTGGAGGG + Intronic
982408753 4:155048628-155048650 AATCAAAGGCAAAAAAAGAAAGG - Intergenic
982787285 4:159550491-159550513 ATCCCAAGGAAGAAAGTGAAAGG + Intergenic
983050431 4:163039958-163039980 AGTCAATGGCAGGAAGGGAATGG + Intergenic
983543066 4:168933289-168933311 ACACAAAGACTGAAAGTGAAGGG + Intronic
983666108 4:170186062-170186084 ATGCATAGACTGAAAGTGAAGGG - Intergenic
983936533 4:173506706-173506728 CTTCAAATCCAGGAAGTGAAGGG - Intergenic
984037604 4:174689838-174689860 ATTCATAGGCTCAAAGTAAAGGG + Intronic
984321711 4:178205839-178205861 ATATAAATGTAGAAAGTGAAAGG + Intergenic
984386238 4:179061951-179061973 AGACATAAGCAGAAAGTGAAGGG + Intergenic
984425255 4:179575716-179575738 ATACATAGGCTGAAAGTGATGGG + Intergenic
984613807 4:181872972-181872994 AATCAAAGTAAGAAAATGAAAGG - Intergenic
984898967 4:184567584-184567606 ATTCAAACTCAAAAAGAGAAAGG + Intergenic
985073092 4:186187680-186187702 ATCCCATGGCAGAAGGTGAAAGG - Intergenic
987269745 5:16294424-16294446 TTTTAAAGGCAAAATGTGAAAGG - Intergenic
987489598 5:18560803-18560825 ATTCAAATGCAGAAAAGAAAGGG + Intergenic
987928194 5:24367911-24367933 ATTCCTAGGCAGACAGTGACAGG - Intergenic
988879754 5:35488462-35488484 CTTCAAAGTCAGAGGGTGAAGGG - Intergenic
989089119 5:37711004-37711026 ATTCAGAGGGAGAGACTGAATGG + Intronic
989501011 5:42167904-42167926 ATTCAAAGGCAGAGATTGTCAGG - Intergenic
990280794 5:54248806-54248828 ATTCAAAGGAAGCAAGTCATGGG + Intronic
991165498 5:63562333-63562355 ATTCATAGGCAGATAGGGACAGG + Intergenic
992155038 5:73946621-73946643 TTTGAATGGCAGAAAGTCAAAGG + Intergenic
993139645 5:84015297-84015319 GTTCAAAGGAAGAATGAGAAAGG + Intronic
994243206 5:97448203-97448225 ATTCAAAGGCAGGAAGAGCCGGG - Intergenic
994643036 5:102433979-102434001 ATGAAAAGGTTGAAAGTGAAAGG - Intronic
994707182 5:103220856-103220878 AATTCAAGGAAGAAAGTGAAAGG + Intergenic
994946493 5:106399947-106399969 ATTCATAGGCAGAAGAGGAAAGG + Intergenic
995825057 5:116287440-116287462 ACACATAGGCTGAAAGTGAAAGG - Intronic
996262621 5:121492119-121492141 ACACAGAAGCAGAAAGTGAAAGG - Intergenic
996684431 5:126265399-126265421 ATTCCAAGGCAAACAGTGATGGG + Intergenic
996992167 5:129648517-129648539 AGTAAAGGGCAGAAACTGAAGGG - Intronic
998721881 5:144961545-144961567 ATTCAAAGGAAGGAAATGGATGG + Intergenic
998751525 5:145327479-145327501 ACACATAGGCTGAAAGTGAAGGG - Intergenic
999779306 5:154836192-154836214 ATTAAAAGTCAGAAAGTGGCCGG - Intronic
1000147946 5:158471541-158471563 ATGCAGTGACAGAAAGTGAAGGG - Intergenic
1000766542 5:165298467-165298489 ATCCAAAGGTAGAAAATGATTGG + Intergenic
1000892059 5:166812062-166812084 ATCCAAAGTCAGAAAATAAAAGG - Intergenic
1001240486 5:170065898-170065920 ACTCATAGACTGAAAGTGAAGGG + Intronic
1001372000 5:171214000-171214022 ATTCAAAGGTACGAAATGAAGGG + Intronic
1001696864 5:173676610-173676632 GTTCAAAGGCAAAAAGAGACTGG + Intergenic
1001908634 5:175495255-175495277 ATTCAGAGACAGAAAGTAGAGGG + Intronic
1001918558 5:175582277-175582299 TTTCAAAGGCAGAAAGGCAGAGG - Intergenic
1002556971 5:180049821-180049843 ATTCAGAGGCAGAAAGGAGAGGG - Intronic
1002657603 5:180763320-180763342 ACACAAAGGCTGAAAGTAAAGGG + Intergenic
1002986946 6:2199457-2199479 ATTTGAAGGCAGAAAGTAAATGG - Intronic
1003627444 6:7755129-7755151 ATTAAAAGGCAGAAATTGTTAGG - Intronic
1003769022 6:9276505-9276527 TCTCAATGTCAGAAAGTGAAGGG + Intergenic
1004170915 6:13294961-13294983 TTGCAAAGGCAGGAAGAGAAGGG + Intronic
1004244795 6:13964139-13964161 ATTAAAAGGTAGAACTTGAAAGG + Intronic
1004324400 6:14661429-14661451 AGTCAAAGAGTGAAAGTGAAGGG + Intergenic
1005208803 6:23436048-23436070 AAGCAAAGGTAGAGAGTGAAAGG - Intergenic
1005248616 6:23917920-23917942 AATCCAAGGCAGAAACTGCAGGG - Intergenic
1005671775 6:28113596-28113618 ATTCTATGGCAGAAGGTGGAGGG - Intergenic
1005943616 6:30579957-30579979 ACTCAAGGGCAAAAAGGGAAAGG + Exonic
1006843053 6:37043292-37043314 ATCCCATGGCAGAAAGTGGAAGG + Intergenic
1007925893 6:45649325-45649347 TTTCAAATGCAGAAACTGAGGGG - Intronic
1007948017 6:45843335-45843357 TTTCTAACGGAGAAAGTGAAGGG - Intergenic
1008244896 6:49159907-49159929 ATTCAAAATGAGAAAGTTAAAGG + Intergenic
1008408897 6:51150009-51150031 ATTAGATGGCAGAAAGTGAGAGG - Intergenic
1008641080 6:53463393-53463415 ATAAAAAGGGAGAAAGAGAAAGG + Intergenic
1008716233 6:54293490-54293512 ACCCATAGGCTGAAAGTGAAGGG - Intergenic
1008908828 6:56711135-56711157 ATTAAAATGCAAAAACTGAATGG + Intronic
1009860944 6:69331300-69331322 ATCCAAAAGGAGAAAGAGAAAGG - Intronic
1010365375 6:75044570-75044592 AAACACAGGCTGAAAGTGAAAGG + Intergenic
1010455173 6:76046054-76046076 ATTCAAAGTTACAAAGAGAAGGG + Intronic
1010795214 6:80110591-80110613 ATTCAAAGGCAAAAAGGTATTGG + Intronic
1011245340 6:85316175-85316197 ATTCTAAATAAGAAAGTGAATGG - Intergenic
1011400887 6:86960228-86960250 ATCCCAAGGCAAAAAGTGGAAGG + Intronic
1011498523 6:87962629-87962651 CTTCAAAGGCAGCAATGGAAAGG - Intergenic
1011811638 6:91138859-91138881 ATCCTATGGCAGAAAGTGGATGG - Intergenic
1012115343 6:95289840-95289862 ATTCAAAGGATAAAAATGAAAGG - Intergenic
1012253008 6:97000117-97000139 AATCAAAGCCAGAAAAGGAAAGG + Intronic
1012719006 6:102717327-102717349 ATCCATAGGCAGAAATTCAAAGG + Intergenic
1013442743 6:110187820-110187842 ATTAAAATGCAGTAAGTGAAGGG - Intronic
1013885161 6:114955565-114955587 ATGCATAGACTGAAAGTGAAAGG - Intergenic
1014563186 6:122915321-122915343 ACTCACAGGCTGAAAGTTAAGGG - Intergenic
1014833804 6:126134275-126134297 ATACATAGACTGAAAGTGAAGGG + Intergenic
1014852060 6:126353046-126353068 ATCAAAAGGCAGCAAGTAAATGG - Intergenic
1015138448 6:129901485-129901507 AGTCAAAGGCAGAGATTGGAAGG - Intergenic
1016092300 6:139994498-139994520 TTTGAGAGGCAGAAAGAGAATGG + Intergenic
1016192352 6:141286349-141286371 ACACATAGGCTGAAAGTGAAGGG - Intergenic
1016492942 6:144627383-144627405 ATTCAAAGACAGAAAGATAAGGG - Intronic
1016563217 6:145420797-145420819 ATCCCATGGCAGAAGGTGAAAGG + Intergenic
1016571558 6:145519302-145519324 ATTTAACTCCAGAAAGTGAATGG + Intronic
1016729308 6:147410466-147410488 ATTCAAACTCAAAAAGAGAAAGG - Intergenic
1016872099 6:148828043-148828065 ATTAAGATTCAGAAAGTGAATGG - Intronic
1016930410 6:149401342-149401364 ACACATAGGCAGAAAGTGAAGGG + Intronic
1017523273 6:155220580-155220602 ATCCAAAGACAGAAAGGAAAGGG - Intronic
1018008930 6:159650033-159650055 ACTCCCAGGCAGGAAGTGAAGGG + Intergenic
1018812340 6:167307134-167307156 GTTTAAAGTCAGAAAGAGAAGGG - Intronic
1020346879 7:7174978-7175000 ATTCAAAGGAACAAAATAAATGG - Intronic
1020364436 7:7365468-7365490 GCTCAAAGGCTGAAAGAGAATGG - Intronic
1020458770 7:8404493-8404515 ATTCATAGACAGAAAGTAGAAGG + Intergenic
1020479471 7:8640095-8640117 ATTAAAAGGCAGGTAGTGGATGG - Intronic
1020539815 7:9446986-9447008 ATTCAAAGCAAGTAAGAGAAAGG + Intergenic
1020623964 7:10555551-10555573 ACACATAGGCTGAAAGTGAAAGG + Intergenic
1020744041 7:12058492-12058514 ATACAAAGGCTAAAAGTGAAAGG + Intergenic
1020995022 7:15252454-15252476 CCTCAAAGCCAGAAAGGGAAAGG - Intronic
1021174133 7:17430524-17430546 ATTCAAGGGCAGAGATTCAATGG + Intergenic
1021283507 7:18749840-18749862 ATTCAAATGCAGAATGTTACTGG - Intronic
1021385809 7:20028345-20028367 AATCAATGGCAGAAGGTGAAGGG - Intergenic
1021866005 7:24958382-24958404 ATACAAAGGAAGAAAGTTAAAGG - Intronic
1021919260 7:25467388-25467410 ATTGAAAGGCAGCAATTTAAGGG + Intergenic
1022889703 7:34683659-34683681 ATTCCATGGCAGAAAGTGAGAGG + Intronic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1022993300 7:35729347-35729369 ACTGAAAAGCAGAAAGTGATGGG + Intergenic
1023070696 7:36429862-36429884 ATTCAAAGGAGTTAAGTGAATGG - Intronic
1023222568 7:37934391-37934413 AGTCAAAGACAGAAAGTGAAGGG + Intronic
1023529910 7:41141994-41142016 TTTTAAAGTCAGAAAGTGCAGGG - Intergenic
1023785466 7:43703713-43703735 ATCCATAGGCTCAAAGTGAAGGG - Intronic
1024236485 7:47402714-47402736 ATTTGAAGGCAGACAGGGAAAGG - Intronic
1024271422 7:47645123-47645145 ATTCAAAAGCAGCCAGTAAATGG - Intergenic
1024710873 7:52012997-52013019 ATCCCATGGCAGAAGGTGAATGG - Intergenic
1026120432 7:67532126-67532148 TTCCAAAGGGAGAAAGTGGAAGG + Intergenic
1026495748 7:70901185-70901207 ACACATAGGCTGAAAGTGAAAGG - Intergenic
1026710215 7:72731600-72731622 ATACACAGACTGAAAGTGAATGG + Intronic
1027239452 7:76317896-76317918 ATTCAGATGGAGAAACTGAAGGG + Intergenic
1027732132 7:81887699-81887721 ATTCAAAGCCAGAATTTGAATGG - Intergenic
1028178929 7:87693369-87693391 ATTCTTAGGCAAAAAATGAATGG + Intronic
1029595758 7:101536895-101536917 ATGTAAAGGCAGGAAGTGGAGGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030153685 7:106430515-106430537 AAGGCAAGGCAGAAAGTGAAGGG - Intergenic
1030454655 7:109758686-109758708 ATCCATAGGCACAAAGTAAAGGG - Intergenic
1030776517 7:113539733-113539755 ACACAGAGGCTGAAAGTGAAAGG + Intergenic
1031255898 7:119448640-119448662 CTTAAAAGACACAAAGTGAAAGG - Intergenic
1032389497 7:131546763-131546785 ACTCAAAGCCCCAAAGTGAAGGG + Intronic
1033177944 7:139143535-139143557 ATAGAAAGGTAGAAAGTAAAAGG - Intronic
1033488503 7:141816144-141816166 ATTCAAAGGCAGGCAGGAAAGGG - Intergenic
1034073776 7:148213022-148213044 ATTCCAAGGCAGATCATGAAGGG - Intronic
1034278659 7:149836588-149836610 ATTCAAAGGGGGATAGTGCAAGG - Intergenic
1034516726 7:151586796-151586818 ATTAAGAGGCACAAAGGGAAGGG - Intronic
1036057686 8:5276703-5276725 ATTTGAAGGCTGAAAGTAAAAGG - Intergenic
1036070048 8:5432143-5432165 ATACACAGGCTGAAAGTGAAAGG + Intergenic
1037312184 8:17567978-17568000 ATTCACAAGCAGAAACAGAAAGG - Exonic
1037584767 8:20268828-20268850 ATGGAAAGGCAGAAAGTGAAAGG + Intronic
1037636140 8:20702388-20702410 AAGCAAAGCCAGAAAGAGAAGGG + Intergenic
1037809330 8:22077285-22077307 AGCCAAAGCCACAAAGTGAATGG + Intronic
1038134043 8:24766675-24766697 ATTCAGAGGCAGAAGGGGAGGGG + Intergenic
1038184408 8:25259926-25259948 GTTCAAAGGCAGAAAGTCAAGGG - Intronic
1038602085 8:28954841-28954863 TTTCAAAGACATAAAATGAAAGG - Intronic
1038852590 8:31294763-31294785 ATTCAAGGGAAGAAAGTGAAAGG - Intergenic
1039138819 8:34359504-34359526 ATTCATAGGCTCAAAGTAAAGGG - Intergenic
1039908715 8:41807474-41807496 ATTCACAGGAAGAAGGTGAAAGG - Intronic
1040811957 8:51463400-51463422 ACTCAAAGGCTCAAAGTAAAAGG + Intronic
1040899138 8:52400270-52400292 ATACACAGGCTGAAAGTGAAGGG - Intronic
1040967211 8:53095139-53095161 ACATAAAGGCTGAAAGTGAAAGG + Intergenic
1041159267 8:55021279-55021301 AATCAAAAGCAGAAAGTAACAGG + Intergenic
1041523692 8:58782464-58782486 ATTTTAAGCCAGAATGTGAATGG + Intergenic
1041642579 8:60218940-60218962 ATACAAAGTCAGCAAGAGAAGGG + Intronic
1041959141 8:63592025-63592047 ACACACAGGCTGAAAGTGAAGGG - Intergenic
1041966697 8:63686577-63686599 ATTCAAATGCAGGACCTGAAGGG + Intergenic
1042592814 8:70414265-70414287 AGGCAGAGGCAGAAAGAGAAGGG - Intergenic
1042648234 8:71010783-71010805 ATGAAAATGCAGAAAGTAAAAGG - Intergenic
1042880341 8:73481143-73481165 ACTCAGAGGGAGAGAGTGAAAGG - Intronic
1043592418 8:81846434-81846456 ATTCAAAGGCAAAAAGGTATTGG - Intergenic
1043697573 8:83240072-83240094 ATCCAATGGCAGAAGGTGTAAGG + Intergenic
1044025449 8:87165616-87165638 ACACATAGGCTGAAAGTGAAGGG - Intronic
1044100562 8:88131787-88131809 ATTCCAATGAAGAAAGTGAGAGG - Intronic
1044451514 8:92340641-92340663 ATGCATAGGCTGAAAGTGAAGGG - Intergenic
1044489399 8:92794162-92794184 AATCAAATGCTGAAAGTGTAAGG + Intergenic
1044509875 8:93062536-93062558 AATCATAGGCTGAAAGTGAAAGG + Intergenic
1044597780 8:93975220-93975242 AGTTAGAGGAAGAAAGTGAATGG - Intergenic
1045454280 8:102360885-102360907 ATTCAAAGTAAGAAAATGACTGG + Intronic
1045498381 8:102727135-102727157 AATCAAAGGAGGACAGTGAAGGG + Intergenic
1045780535 8:105857666-105857688 ACACATAGGCAGAAAGTGAAGGG + Intergenic
1046779748 8:118202481-118202503 CTTCAAAGGCAGGAAGTGACTGG + Intronic
1046810048 8:118523684-118523706 ATTCAGAGCCAGCAAGTCAAGGG + Intronic
1047565009 8:126034596-126034618 ATTCAAAGGCTTAAAGAGACTGG - Intergenic
1048232213 8:132653950-132653972 ATTAAAAGGCAGAGATTGACAGG + Intronic
1048520102 8:135145967-135145989 ATCCATATGCAGAAAGAGAATGG - Intergenic
1049768187 8:144365257-144365279 AATCAAGGGCAGGAGGTGAAAGG - Intergenic
1050249822 9:3733108-3733130 TTCCAAAGTTAGAAAGTGAAAGG + Intergenic
1050251940 9:3753738-3753760 ATTCAAAGGCAAAAATTGAGAGG - Intergenic
1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG + Intergenic
1050756611 9:9012033-9012055 CTTTAAAGTCAGAAAGGGAAAGG - Intronic
1051151090 9:14079746-14079768 ATTCAAATGGAGAAAGTCATGGG - Intergenic
1051169116 9:14300944-14300966 ATTCAAAAGCAAAAAGTTAATGG + Intronic
1051960602 9:22757942-22757964 ATACATAGGCTGAAAGTGAAGGG - Intergenic
1052510962 9:29419976-29419998 ACACAAAGGCTGAAAGTGAAGGG + Intergenic
1052523272 9:29578775-29578797 ATTAAAAGGCAGACATTGACAGG + Intergenic
1053107909 9:35428653-35428675 ATACATAGGCTGAAAGTGAAGGG + Intergenic
1053181431 9:35974447-35974469 AAACACAGACAGAAAGTGAAGGG - Intergenic
1055228817 9:74035146-74035168 ATGCAAAGGCAGAAAGTGTTTGG + Intergenic
1055242521 9:74200905-74200927 ATTCAAAGGCACTTAGCGAAGGG + Intergenic
1055902201 9:81253761-81253783 AATCAAAGGTGGAAAATGAAGGG - Intergenic
1056327958 9:85496432-85496454 ACACAAAGGCTGAATGTGAAGGG + Intergenic
1056783587 9:89571459-89571481 ATTCAAAGTATGAAAATGAAGGG + Intergenic
1056952221 9:91050267-91050289 ATACATAGGCTGAAAGTAAAGGG + Intergenic
1057531478 9:95850711-95850733 CTCCAAAGGCAGAAAAGGAATGG + Intergenic
1057639544 9:96804147-96804169 ATACATAGGCCGAAAATGAAGGG + Intergenic
1059020114 9:110567477-110567499 ATTGAAAGAGAAAAAGTGAAAGG + Intronic
1059222813 9:112641614-112641636 ATTCAAAGGAAAAACGTGTAAGG - Intronic
1059946028 9:119409244-119409266 ATTGACAGGCAGAGAGAGAAAGG - Intergenic
1060025511 9:120167595-120167617 CTTCCAGGGCAGCAAGTGAATGG + Intergenic
1060258211 9:122051395-122051417 ATGCCAAGGCAGAAACTGCAGGG - Intronic
1062296399 9:135830338-135830360 ACACACAGGCTGAAAGTGAAGGG + Intronic
1185841047 X:3391523-3391545 ATGGAGAGGCAGAAAGTGACAGG + Intergenic
1186325203 X:8468125-8468147 GTTCACAGGCAAAAAGAGAAAGG + Intergenic
1186797314 X:13059394-13059416 AATCAAAAGCAGACAGTGATTGG - Intergenic
1186985244 X:15006037-15006059 ACACATAGGCTGAAAGTGAAGGG + Intergenic
1187397599 X:18931765-18931787 ATCCAAAGTCAGAAAGTCAGAGG + Intronic
1188049155 X:25463470-25463492 ACACACAGGCTGAAAGTGAAGGG - Intergenic
1188138285 X:26516799-26516821 ATACATAGGCTGCAAGTGAAGGG + Intergenic
1188387443 X:29578293-29578315 ATTCAAACTCACATAGTGAAGGG - Intronic
1188470640 X:30534503-30534525 ATGCAAAGGTTGAAAGTGAAAGG + Intergenic
1188821650 X:34782786-34782808 TATAAAAGGCAGAAAGTAAATGG + Intergenic
1188870217 X:35363253-35363275 ATTCAGAGGAAGAAAACGAAAGG - Intergenic
1189006102 X:36997001-36997023 ACACACAGGCTGAAAGTGAAAGG + Intergenic
1189116602 X:38349547-38349569 ATTCCATGGCAGAAGGTAAAGGG - Intronic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189329562 X:40135066-40135088 ATTCAAGGACAGCAAGAGAAAGG + Intronic
1189778030 X:44487763-44487785 AATAAAAGGAAGAAAGAGAAAGG + Intergenic
1190039571 X:47058929-47058951 ATTCAGAGGCAGAAAGTGATGGG + Exonic
1190283718 X:48948387-48948409 AAACAAAGGCAGAAAGAGAAAGG + Intronic
1191011732 X:55767084-55767106 ATTCAAATGCAAAAAATGACAGG + Intergenic
1192206879 X:69102188-69102210 TCTTAGAGGCAGAAAGTGAAAGG - Intergenic
1192395618 X:70778020-70778042 ACACATAGGCTGAAAGTGAAGGG + Intronic
1192896320 X:75446354-75446376 ATTCAAAGGCTTAAGGAGAATGG + Intronic
1192910913 X:75603131-75603153 TTTCAGAGTCAGAAAGTGAGTGG + Intergenic
1192953468 X:76043093-76043115 ATTCATAGGCATAAAGTAATGGG - Intergenic
1193067796 X:77277739-77277761 ATTCAAATTCAGAAAATGCATGG + Intergenic
1193614346 X:83669561-83669583 ATCCATAGGCTCAAAGTGAAGGG + Intergenic
1193919486 X:87407692-87407714 ATTCAAAGGCAGAAAAAGAGTGG - Intergenic
1193945678 X:87730440-87730462 ATTTAAATGGACAAAGTGAATGG + Intergenic
1194261123 X:91697483-91697505 ATGCATAGGCACAAAGTAAAGGG - Intergenic
1194951001 X:100125790-100125812 CTTCATAGGCAGATACTGAAAGG + Intergenic
1195070427 X:101273741-101273763 ATTTAAAGCCAGGAAGAGAATGG - Intronic
1195407183 X:104527604-104527626 ATACACAGACTGAAAGTGAAGGG + Intergenic
1195610485 X:106861591-106861613 ATCCAAAGGCTCAAAGTAAAAGG - Intronic
1195759236 X:108228028-108228050 GTTGAAGGGCAGAAAGAGAATGG + Intronic
1195845824 X:109227292-109227314 ATTAAAAGACAGATAGTGAAAGG + Intergenic
1196163911 X:112516847-112516869 ATACAAAGACCGAAAGTGAAGGG + Intergenic
1196174130 X:112621842-112621864 ATTCTGAGGCTGAAACTGAAGGG + Intergenic
1196698103 X:118635524-118635546 ATGCAAAGGCAGAGAGAAAAAGG + Intronic
1197022039 X:121702977-121702999 ACACATAGACAGAAAGTGAAGGG - Intergenic
1198199915 X:134405656-134405678 ATCCAAATGAAGAAAGTGAGTGG - Intronic
1198250509 X:134875204-134875226 ATTCAAGTGCAGAAAAGGAAGGG + Intergenic
1198529608 X:137538263-137538285 CTTTAAAGGTAGAAAGAGAAAGG - Intergenic
1198778180 X:140203931-140203953 TTTGAAAAGAAGAAAGTGAAAGG + Intergenic
1199200209 X:145078450-145078472 GCTCAAAGTCAGACAGTGAATGG - Intergenic
1199512682 X:148639942-148639964 ATTCTAATGCAGATAGAGAAAGG + Intronic
1200290350 X:154866025-154866047 ATACATAGGCTGAAAGTGAAGGG + Intronic
1200579772 Y:4936284-4936306 ATGCATAGGCACAAAGTAAAGGG - Intergenic
1201438337 Y:13983963-13983985 GTTCACAGGCAAAAAGAGAAAGG - Intergenic
1201762668 Y:17557446-17557468 ACAAAAAGGCAAAAAGTGAAGGG + Intergenic
1201838884 Y:18348543-18348565 ACAAAAAGGCAAAAAGTGAAGGG - Intergenic
1202096370 Y:21251695-21251717 AGACCAATGCAGAAAGTGAATGG - Intergenic