ID: 1118628739

View in Genome Browser
Species Human (GRCh38)
Location 14:67683591-67683613
Sequence CTTTTGATTAGAGGCAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118628739_1118628742 -9 Left 1118628739 14:67683591-67683613 CCCTGTTTGCCTCTAATCAAAAG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1118628742 14:67683605-67683627 AATCAAAAGAGTAAAAATGAAGG 0: 1
1: 0
2: 5
3: 115
4: 1103
1118628739_1118628743 -8 Left 1118628739 14:67683591-67683613 CCCTGTTTGCCTCTAATCAAAAG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1118628743 14:67683606-67683628 ATCAAAAGAGTAAAAATGAAGGG 0: 1
1: 1
2: 8
3: 87
4: 1040
1118628739_1118628746 4 Left 1118628739 14:67683591-67683613 CCCTGTTTGCCTCTAATCAAAAG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1118628746 14:67683618-67683640 AAAATGAAGGGATAGGAGGAAGG 0: 1
1: 0
2: 10
3: 120
4: 1269
1118628739_1118628745 0 Left 1118628739 14:67683591-67683613 CCCTGTTTGCCTCTAATCAAAAG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1118628745 14:67683614-67683636 AGTAAAAATGAAGGGATAGGAGG 0: 1
1: 0
2: 4
3: 38
4: 440
1118628739_1118628744 -3 Left 1118628739 14:67683591-67683613 CCCTGTTTGCCTCTAATCAAAAG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 1118628744 14:67683611-67683633 AAGAGTAAAAATGAAGGGATAGG 0: 1
1: 0
2: 3
3: 70
4: 797

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118628739 Original CRISPR CTTTTGATTAGAGGCAAACA GGG (reversed) Intronic
901539888 1:9909336-9909358 CTCTTGATTTGCGGCCAACACGG + Intronic
902134742 1:14295243-14295265 CTTGAGCCTAGAGGCAAACATGG - Intergenic
903253058 1:22070762-22070784 CTTTTAAAAAGAGGCAAAGAAGG - Intronic
904218819 1:28947483-28947505 CTTTTTATTAGATGCAACCAGGG + Intronic
906754353 1:48294692-48294714 CTTTTGAGAATAGGAAAACAAGG - Intergenic
907547796 1:55277323-55277345 CTTTTGTTGAGAGGCAACCATGG + Intergenic
909861478 1:80611167-80611189 CCTTTGATTAGAGTCAAGCCTGG + Intergenic
910030604 1:82717267-82717289 TTTTTGATTAGTTGCAAATAAGG - Intergenic
912350983 1:109012805-109012827 CAGTTGATTAGTGGCAAAGACGG + Intronic
915572688 1:156753223-156753245 CTTGTGATAAGAGGCACACCAGG + Intronic
918170031 1:181987655-181987677 CTTTTGATGGGAGGCAGACAAGG - Intergenic
918188185 1:182145953-182145975 CTTTTGATTAGACACAAGTAAGG - Intergenic
918249266 1:182686964-182686986 CTTTTGAGAAGAGTCAAATACGG + Intergenic
918712770 1:187751613-187751635 GTTTTGATTATAGGCATTCAGGG - Intergenic
923604839 1:235433664-235433686 CTTTTGATTGGAGAGAATCATGG + Intronic
924317682 1:242815463-242815485 CTTTGGATCAGAGGGAAGCATGG + Intergenic
1063206974 10:3841847-3841869 CTTTTCATTGGAAGCAAAGAAGG - Intergenic
1063398251 10:5714122-5714144 CTTTTGTTTAAAGGCAAAATTGG + Intronic
1064867002 10:19892009-19892031 CTTTTCATTAAAGTAAAACAAGG + Intronic
1066047526 10:31606315-31606337 TTTTTGATTTGAGGCCAAGAAGG + Intergenic
1067959557 10:50833114-50833136 CAATTGATTAGAGGCTGACATGG + Intronic
1068452849 10:57214143-57214165 GTTTTCATTAAAGGCAAAAAAGG - Intergenic
1072093149 10:92149306-92149328 ATTTTGGTTAGAGGACAACATGG - Intronic
1072113364 10:92345089-92345111 CTTTGCACTAGAGGCAAAAATGG - Intronic
1082209478 11:49480699-49480721 CTTTTGATTAGACCCAACTAGGG - Intergenic
1086203227 11:84228232-84228254 TTTTTGGTTAGAGTCAATCATGG + Intronic
1086640201 11:89144841-89144863 CTTTTGATTAGACTCAACTAGGG + Intergenic
1088055953 11:105578208-105578230 CTTTTGATTCCAGTCAAAGAAGG - Intergenic
1088209521 11:107439057-107439079 ATTTTGATTATAGACACACAGGG - Intronic
1088498495 11:110457606-110457628 CTTTTGATTGGAGTCAATGAAGG + Intronic
1090369980 11:126243455-126243477 TTTTTTTTTAGAGGCAGACAGGG - Intronic
1090974655 11:131671094-131671116 CTTTTGCTTGGAGAGAAACAGGG - Intronic
1091145525 11:133276149-133276171 TTTTTTATTAGTGGCAAAGAGGG + Intronic
1096011786 12:48223576-48223598 CTTTTGCTGAAAGCCAAACATGG + Intergenic
1098866017 12:75764485-75764507 CTTTTGTTTAGAGTCCAAAATGG + Intergenic
1099012085 12:77303413-77303435 TTATTGATTAGTGGCAAAGAAGG + Intergenic
1099245511 12:80189021-80189043 CATTAAATTAGAGGGAAACATGG - Intergenic
1099661356 12:85567715-85567737 CTTTAGATTAAAGTCAAATAGGG - Intergenic
1100116017 12:91305330-91305352 CTTTTTATTTCAGGCAAACCAGG - Intergenic
1100120245 12:91361235-91361257 AGTGTGATTAGAGCCAAACAGGG - Intergenic
1100736133 12:97534516-97534538 CTTTTTATTAGAGAAAATCATGG + Intergenic
1102457439 12:113079387-113079409 CCTTTTATTATGGGCAAACAAGG + Intronic
1102692481 12:114772256-114772278 CTTTTGGTCAGAGGAAAATAAGG + Intergenic
1103156879 12:118693034-118693056 CTTTAAATAAGAGGCAGACATGG - Intergenic
1106558569 13:30830326-30830348 CTTTTGATGAGAGGCTGAGAAGG - Intergenic
1107947613 13:45433574-45433596 CTCTTTATCAGAGGCAAAAATGG - Intergenic
1108074316 13:46663588-46663610 ACTTTGATGAGAAGCAAACAGGG + Intronic
1109801483 13:67383848-67383870 CTTTATATTAGAGGCTGACAAGG + Intergenic
1111462559 13:88565754-88565776 CTTTTGAATTGAGTCAAGCATGG - Intergenic
1112307473 13:98288110-98288132 CTTTTGATGATAGGAATACATGG + Intronic
1112721773 13:102253880-102253902 CTTGTGATTAGAAGTAAACTGGG + Intronic
1114863632 14:26558924-26558946 CTTCTGATTAGAAGAACACAAGG + Intronic
1115189023 14:30726833-30726855 CTTTTCATTAAAGGCAAATCGGG + Intronic
1115927068 14:38447940-38447962 CTCTTGTTGAGAGGCCAACATGG + Intergenic
1115937182 14:38565503-38565525 GTTTTGATTAAAGGGAAAAAAGG + Intergenic
1116440191 14:44942193-44942215 CTTTTGATTAGATGATTACATGG - Intronic
1118120650 14:62837501-62837523 TTTATGCTTAGAGGAAAACATGG - Intronic
1118628739 14:67683591-67683613 CTTTTGATTAGAGGCAAACAGGG - Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1125977718 15:43970327-43970349 CTTTGGATTGGAGGCAGAAAAGG + Intronic
1128725851 15:69988102-69988124 CCTTTGCTTAGAGGCAGACCTGG - Intergenic
1131256830 15:90868544-90868566 CTTTATATGACAGGCAAACAGGG - Intergenic
1133085449 16:3358803-3358825 CTTTTGATTCTAGCCAAAGAGGG + Intergenic
1133344472 16:5060622-5060644 CTATTGATTAGGGGAAAAAATGG - Intronic
1134162798 16:11905523-11905545 CTTTAAATTAGAGGCACACATGG + Intronic
1142270767 16:89088325-89088347 CATTTGATTAAAGGAAAACACGG - Intergenic
1144994654 17:19259217-19259239 CTTTTGGTGATAGGGAAACATGG + Intronic
1148190951 17:45678289-45678311 CTTTTGCTTTTAGGCAATCAAGG + Intergenic
1148645332 17:49216989-49217011 CTTGTATTTAGATGCAAACAGGG - Intronic
1149230773 17:54531523-54531545 GTTTAGATAAGAGGCAAAGAAGG + Intergenic
1149517240 17:57289981-57290003 CTTTTGCTTAGAACCAAAGAAGG + Intronic
1153131778 18:1861793-1861815 TTCTTGATTAGATGCAAACAAGG - Intergenic
1156573416 18:38284182-38284204 CTGTGGGTTAAAGGCAAACATGG - Intergenic
1157685814 18:49641406-49641428 TTTTTGATTGGAGGGAAAAATGG + Intergenic
1157929681 18:51807979-51808001 CTTTTGAAATGAGGCAAAGATGG + Intergenic
1158066303 18:53413436-53413458 CCTTTTATTAGAGACAAAAATGG - Intronic
1159580884 18:70233245-70233267 CTTTTGAGTACTGGAAAACAAGG - Intergenic
1159696877 18:71570755-71570777 TTATTGATAAGAGCCAAACAAGG + Intergenic
1160808436 19:1002589-1002611 CTTGTGCTTAGAGCCAAACCAGG - Intronic
926367240 2:12144629-12144651 CTTATGTTTAGAAGCATACAAGG + Intergenic
926747326 2:16169457-16169479 CTTTTGATGAGAGGAATACCAGG + Intergenic
926832061 2:16974421-16974443 CTTGTGAATAGAAGCAAACGTGG - Intergenic
927557317 2:24044720-24044742 CTTTTTATTAGGGTAAAACAAGG + Intronic
928459327 2:31456183-31456205 CTTTTGATTAATGGGAAAAAAGG - Intergenic
928727131 2:34187373-34187395 ATTTTGTATAGAGGAAAACATGG + Intergenic
932124073 2:69127520-69127542 CTTTTGAGCAGAGGAAAACATGG + Intronic
935462530 2:103355025-103355047 TTTTTGATTGAAGGCAAACAGGG - Intergenic
935735365 2:106102658-106102680 CTGTTGTTTCGAGGCAATCATGG + Intronic
936773354 2:115941830-115941852 GTCTTGATCATAGGCAAACATGG - Intergenic
938743635 2:134256675-134256697 CTTATGATTACAGGCATATAAGG - Intronic
940925264 2:159356815-159356837 CTGGTGATAACAGGCAAACAAGG + Intronic
941049116 2:160711865-160711887 CTTTTGATTAGTGGCTTGCATGG + Intergenic
944418062 2:199498415-199498437 CTCTTAATTATAGACAAACAAGG + Intergenic
944979345 2:205096935-205096957 TTGTTGATTTCAGGCAAACAGGG - Intronic
945196980 2:207245811-207245833 CTCTTGATTAGATGTAAAGATGG - Intergenic
945985598 2:216351018-216351040 CTATGGATTAGAGGCAGACTTGG - Intronic
947783040 2:232787339-232787361 CTGTTGAGTAAAGGCACACAGGG + Intronic
948038711 2:234881479-234881501 ATTTTGAGTAAAGGCAAAAATGG - Intergenic
1169912289 20:10656795-10656817 CTTTTCATTAGAAGAAAAAAAGG + Intronic
1169965800 20:11215880-11215902 TTTTTGATTAGAGGGACCCAGGG - Intergenic
1170058451 20:12233212-12233234 CTTTTGATTTTAGGCAACCTGGG + Intergenic
1170272014 20:14537936-14537958 CATTTGAGAAGAGGCAAAGAAGG - Intronic
1171099060 20:22365273-22365295 CTTTTTCTTAGAAGGAAACATGG - Intergenic
1175567983 20:59995892-59995914 CTCTTCATTGGAGACAAACAGGG + Exonic
1178240415 21:30893467-30893489 CTTTTAATTACATGCAAATAAGG - Intergenic
1180243842 21:46532536-46532558 CTATTCATTAGAGGAAAAAATGG - Intronic
1184322924 22:43756809-43756831 CTTTTGGATAGAGGCCCACAAGG + Intronic
949593801 3:5522666-5522688 CTTTTGAGTAGAGTCTTACAGGG + Intergenic
951375261 3:21906938-21906960 CTCTTGAGTAGTGGGAAACAGGG - Intronic
952657583 3:35804390-35804412 GTTTTAATTAAAGGCAAACTAGG + Intergenic
955498953 3:59564994-59565016 CTTTTAATAAGTTGCAAACAAGG - Intergenic
958410278 3:93807739-93807761 CTTCTGATACCAGGCAAACAGGG - Intergenic
959999884 3:112720084-112720106 CTTTTGATGAGACACAAACCTGG - Intergenic
961354470 3:126327314-126327336 CTTTTCCTCCGAGGCAAACAGGG + Intergenic
962359789 3:134728694-134728716 CTTTTGCTTTAAGGTAAACACGG + Intronic
963277453 3:143347038-143347060 CTTTTTATTTGAGGCTTACATGG - Intronic
964448086 3:156781608-156781630 CTTTTGAGTAGAGTCACACAAGG + Intergenic
966004039 3:174986792-174986814 CTTTTGAATAGTGGTAGACAAGG + Intronic
966692614 3:182757048-182757070 CTGTTGATTTGAGGAAAATAAGG + Intergenic
967911856 3:194549097-194549119 CTTTGAATGAGAGGCCAACAAGG + Intergenic
969316160 4:6382475-6382497 GTTTTGAATAGAGGGACACAGGG - Intronic
969406255 4:6994367-6994389 CTTTTCATTAGAGAAAAACTAGG + Intronic
971845997 4:31918137-31918159 GTTTTTATTTGAGGCAGACAGGG - Intergenic
973579484 4:52327656-52327678 CATTTTATTAGAGGCAGAAAAGG - Intergenic
976603414 4:86960111-86960133 TTTTTAATTAAAGGAAAACAGGG + Intronic
979712021 4:123790958-123790980 CTTTTTATTAGTAGGAAACATGG - Intergenic
979810364 4:125028941-125028963 CTACTGAATAGAGCCAAACATGG + Intergenic
980851349 4:138387107-138387129 AAGTTGATTAGAGGCAAATATGG - Intergenic
980963491 4:139499087-139499109 CTTCTGACTATAGTCAAACAAGG - Intronic
982418796 4:155169072-155169094 CTTTTGACTAGAGGAAAACAAGG - Intergenic
982955719 4:161763745-161763767 CTTTTGATTAGAGGAGCACTGGG - Intronic
984913946 4:184703270-184703292 CTTTTGCTAACAGGCAAAGAGGG - Intronic
986142596 5:5045639-5045661 CTTTAGATCAGAAACAAACATGG + Intergenic
987369677 5:17181704-17181726 CTTTCAATCAGATGCAAACATGG + Intronic
988358351 5:30204572-30204594 CTGTTGGATAGAGGCAAAGAAGG - Intergenic
991705683 5:69356142-69356164 ATTTTGTTTAGAGGGAAACTTGG + Intronic
993482421 5:88440248-88440270 CTCTGGATTAGAGGAAACCAAGG - Intergenic
994923808 5:106087390-106087412 CTTTAAATTAGATGGAAACAAGG - Intergenic
995530722 5:113089418-113089440 CATTTGATTAGAGGAGAAAATGG + Intronic
996627646 5:125588988-125589010 GTTTTGTTTAGAAGCAAAGAGGG - Intergenic
998324935 5:141272029-141272051 CTTTTGAATAGCTGCAAACCTGG + Intergenic
999014656 5:148088529-148088551 CTTTTGATTCTAGGAAAACCGGG + Exonic
1000175971 5:158754790-158754812 CTTTTGTTTAGAGCAAAATAAGG - Intronic
1000533101 5:162448131-162448153 CTTGTCATTTGAGGCAAACATGG - Intergenic
1002653265 5:180720259-180720281 CTTTTGATTAAAGATAAATAAGG + Intergenic
1002702185 5:181131869-181131891 CTTTTGATCATGTGCAAACAAGG + Intergenic
1003535266 6:6970616-6970638 GTTTTGATGAGAGGCACACAGGG - Intergenic
1006047813 6:31312670-31312692 CTGTTGATTGGAGTCAAACCTGG + Intronic
1008486051 6:52037265-52037287 TTTTTGACTAGAAGGAAACATGG + Intronic
1008874548 6:56311542-56311564 ATTTTTATAACAGGCAAACAGGG + Intronic
1010334913 6:74669317-74669339 TTTCTTATTAGAGGCAAACGTGG + Intergenic
1011206724 6:84906949-84906971 CTTTTGATAAGAGGAAAATTTGG + Intergenic
1011322055 6:86106236-86106258 CTTTTTATTACAGGTAAAGATGG - Intergenic
1011874611 6:91942241-91942263 CTATTGAGTAGAGACAAAGAAGG - Intergenic
1013505237 6:110793683-110793705 CTATGGATTAGAGGAACACAAGG - Intronic
1016858008 6:148691515-148691537 CTTTTGAGTAGAGGCGAAATTGG - Intergenic
1017328002 6:153161919-153161941 CTTTTGAATAGAGACAGATAGGG + Intergenic
1018442844 6:163828896-163828918 CTATTGATTAAAGGCCCACAGGG - Intergenic
1019023553 6:168939525-168939547 CTTTTGGTTAAAGCTAAACAAGG - Intergenic
1020378314 7:7513476-7513498 CTTTTGATCAGAGGCATAGCTGG - Intronic
1020398891 7:7751677-7751699 CCTCTGATTACAGGTAAACAGGG - Intronic
1020833112 7:13115312-13115334 CCTTTGCTTAAAGGCAAACATGG - Intergenic
1024555727 7:50602080-50602102 CCTTCCACTAGAGGCAAACAAGG - Intronic
1027677168 7:81174340-81174362 CTTTTCATTTCAGGCAAATAAGG - Intergenic
1030947486 7:115741804-115741826 CTTTTGAGAAGAGGCCAGCAGGG - Intergenic
1033876771 7:145829896-145829918 ATTTTGAATAGAAGTAAACAAGG - Intergenic
1038239872 8:25798540-25798562 GTGTTTATTAGAGGCAGACAAGG - Intergenic
1038396445 8:27249141-27249163 GTTTTGATTGGAGGCAGACGTGG + Intronic
1039821987 8:41142541-41142563 TTTTTGATTGTAGGCAAGCAGGG + Intergenic
1040979154 8:53227668-53227690 ATCTGGAGTAGAGGCAAACATGG + Exonic
1042795997 8:72664055-72664077 CTTTAGATTAAAGTAAAACAGGG + Intronic
1043077289 8:75718024-75718046 ATTTTTATTAGGGGCAGACATGG + Intergenic
1043120897 8:76322346-76322368 CTTTTTATTAGAGGCATAAAAGG + Intergenic
1046014717 8:108590908-108590930 CTGGTGATATGAGGCAAACAGGG + Intergenic
1055271577 9:74566208-74566230 CTTTTGATGAAAGGCAATAATGG - Intronic
1058314815 9:103552761-103552783 ATTTTTATTAGATGCAAAGAAGG + Intergenic
1060380916 9:123171020-123171042 CTTTTGAATAGAGGAAGCCAAGG + Intronic
1061395768 9:130342615-130342637 CTTTTGATTAGGGGCAATCCAGG + Intronic
1185527697 X:792484-792506 CTGTTGGTGAGAGGAAAACAGGG - Intergenic
1188324494 X:28784279-28784301 TTTTTGATTAGAGTGAAAAATGG + Intronic
1188740253 X:33769348-33769370 CTTTTGATTAGAATGAAAAATGG - Intergenic
1195097773 X:101522244-101522266 ATTTTTATTAGAGGCAAAGAAGG - Intronic
1195260571 X:103127585-103127607 ATTTTGATCATAGGCAAAGAGGG - Intergenic
1196724194 X:118881280-118881302 CTTTTGATTATAGCCATACTAGG + Intergenic
1198004846 X:132482504-132482526 CTTAAGTTTAGAGGCAGACATGG + Intronic
1198112431 X:133513687-133513709 CCTTGGATTAGAAGCAATCATGG - Intergenic
1201221162 Y:11771976-11771998 CTTTGGATCAGAGGGAAGCATGG + Intergenic