ID: 1118632495

View in Genome Browser
Species Human (GRCh38)
Location 14:67718514-67718536
Sequence CAGTGTTAGCCCTGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118632486_1118632495 21 Left 1118632486 14:67718470-67718492 CCCAGCTCTGCTTCATAGCATGT 0: 1
1: 0
2: 2
3: 13
4: 201
Right 1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG 0: 1
1: 0
2: 5
3: 32
4: 249
1118632488_1118632495 -7 Left 1118632488 14:67718498-67718520 CCACACATCCCTGCCTCAGTGTT 0: 1
1: 0
2: 3
3: 39
4: 361
Right 1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG 0: 1
1: 0
2: 5
3: 32
4: 249
1118632487_1118632495 20 Left 1118632487 14:67718471-67718493 CCAGCTCTGCTTCATAGCATGTG 0: 1
1: 1
2: 0
3: 10
4: 175
Right 1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG 0: 1
1: 0
2: 5
3: 32
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118632495 Original CRISPR CAGTGTTAGCCCTGGGAGGA TGG Intronic
900972776 1:6000676-6000698 CAGTGATATCCCTGGGAGAAAGG + Intronic
901773933 1:11546143-11546165 CAGTGACAGCTCAGGGAGGAGGG - Intergenic
902563752 1:17296057-17296079 CAGAGTTAGCCCAAGGAGCAAGG - Intergenic
904278186 1:29397744-29397766 GAGGGTTAGCCCTGGGAGCCTGG - Intergenic
904410377 1:30321521-30321543 TAGGGTGAGCCCTGGGAGGGGGG - Intergenic
904604888 1:31692798-31692820 CAGTCATTGCCCTGGGAGTAGGG + Exonic
905132901 1:35774829-35774851 CAGTGTTTCCCCAGGGACGAAGG - Intergenic
906509971 1:46405360-46405382 GAGTCCTGGCCCTGGGAGGAGGG - Exonic
914454742 1:147825209-147825231 CAGACTTAGCCCTGGGAAGATGG + Intergenic
914802796 1:150973449-150973471 CAGATTTTCCCCTGGGAGGAAGG - Intronic
914951711 1:152121155-152121177 CACTGTTAGCTCTGGGCAGAGGG + Intergenic
915119163 1:153617731-153617753 CAGTGACAGCCCTGGGAGGCTGG + Intergenic
915327215 1:155086639-155086661 CACTTCTAGCCATGGGAGGAGGG - Exonic
916498762 1:165368693-165368715 CAGGGTTAGACCTCGGAGTAAGG - Intergenic
919560758 1:199115521-199115543 CAATGTTAGGCCTGGGAGCCTGG - Intergenic
919849227 1:201661318-201661340 CAGTGAGAGGCTTGGGAGGAAGG - Intronic
920377330 1:205516198-205516220 CACAGTTCTCCCTGGGAGGAGGG + Intronic
920404306 1:205697486-205697508 CAAAGGTAGCCCTGGGAGGAGGG + Intergenic
920606429 1:207392465-207392487 AAGTGTTAGCCCTATGAGTATGG + Intergenic
920815856 1:209331337-209331359 CAATGTGAGGCCTTGGAGGACGG - Intergenic
921153035 1:212416715-212416737 TCGTGTTAACCCTGTGAGGATGG - Intergenic
921675147 1:217968387-217968409 CAGAGTGAGTCCTGGGAGGTGGG - Intergenic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
923000948 1:230005975-230005997 CAGTGTTATCCCAGGCAGGATGG - Intergenic
923342801 1:233021994-233022016 CAGGGTTAGGCCAGGGAGGATGG + Intronic
923695909 1:236251336-236251358 AATGGTTAGCTCTGGGAGGAAGG + Intronic
923945371 1:238880759-238880781 CAGAGCTACCCCTGGGAAGAAGG + Intergenic
1062939033 10:1408013-1408035 CAGTGTGAGCCCTTGGAAGGTGG - Intronic
1063500952 10:6553845-6553867 CAAGGTTATCCCTGGGAGGCAGG + Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1066047529 10:31606347-31606369 CAGTGACAGCCATGGGAGAAAGG - Intergenic
1066221945 10:33343806-33343828 CACTGTTAGCCAGGTGAGGAAGG + Intergenic
1067099622 10:43325144-43325166 CAGTGTGAGCCATGGGTGGTGGG + Intergenic
1067161486 10:43828659-43828681 CAGTTTTTGTCCTGGGAGTAGGG + Intergenic
1067163279 10:43845040-43845062 AAATGTAAGCCTTGGGAGGAAGG - Intergenic
1070691616 10:78531388-78531410 CAGGTTTCGTCCTGGGAGGAAGG + Intergenic
1070788285 10:79174966-79174988 CAGAGAGAGGCCTGGGAGGAAGG - Intronic
1070819524 10:79346813-79346835 CAGTGTGGGTCCTAGGAGGAGGG + Intergenic
1071555832 10:86600680-86600702 GTGTATTAGCCCTGGGAAGAGGG + Intergenic
1072189912 10:93070650-93070672 CAGTGTCAGCCCAGGTTGGAAGG - Intergenic
1072417387 10:95260541-95260563 CACTGTGTGCACTGGGAGGAAGG + Intronic
1072961146 10:99930415-99930437 GAGTCTCAGCCCTGGGACGAAGG - Intronic
1073119769 10:101114417-101114439 AAATGTCAGCCCTGGGGGGAGGG - Intronic
1075808908 10:125210151-125210173 CAGTGCAGGCCCTGGGAGGGAGG + Intergenic
1075956903 10:126532147-126532169 CAGACTTAGCCCTGGCAGGTTGG - Intronic
1079011079 11:16828818-16828840 CAGAGTTAGCCCTGGGACTTGGG + Intronic
1081047831 11:38297806-38297828 CAGTGTTAGCACTTTGAGCAGGG + Intergenic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081968762 11:47184939-47184961 CTGTGTTTGCTCTGGGAGGCCGG - Intronic
1082708120 11:56518699-56518721 CTGTGTCAGCCCATGGAGGAAGG + Intergenic
1083341683 11:61962357-61962379 TTGAGTTTGCCCTGGGAGGATGG - Exonic
1083777322 11:64900619-64900641 CAGTTCTTGCCCTGGGAAGAGGG + Exonic
1084665994 11:70576664-70576686 CAGAGTTAGGCCTGGGAGTGTGG - Intronic
1085120430 11:73964185-73964207 CTGTCTTTGCACTGGGAGGAAGG + Intronic
1088834843 11:113568830-113568852 CAGTGATAGCCCTCGGGGGAGGG - Intergenic
1089641900 11:119853313-119853335 TAGAGGTGGCCCTGGGAGGAGGG - Intergenic
1089769669 11:120794049-120794071 CAGTGTTAGGGCTGAGAGCAAGG + Intronic
1090626131 11:128610563-128610585 CAGAGGTAGTTCTGGGAGGAGGG - Intergenic
1091193848 11:133715690-133715712 CTGTGGCAGCCCTCGGAGGATGG + Intergenic
1094526121 12:31232399-31232421 CACTGCCAGCCCTCGGAGGAGGG - Intergenic
1095974524 12:47930068-47930090 CATTCTTGGCCCTGGGAGCAGGG - Intronic
1096587234 12:52630647-52630669 CAGTGGTAGCCTTTGGAGGGGGG - Intergenic
1097704489 12:62853624-62853646 CAGTGTTGGCCTTTGGATGACGG - Intronic
1098896738 12:76071285-76071307 GCCTGTTAGCCCTGGGAGGGTGG - Intronic
1100005497 12:89890602-89890624 CAGAGTTAACCTTGGGAGGCAGG + Intergenic
1100930748 12:99607091-99607113 CAGAGTTAGGCCAGGGAGGATGG + Intronic
1102332504 12:112046303-112046325 CAGTGTTTCCCCTCAGAGGAGGG + Intronic
1102520294 12:113473845-113473867 CAGTGCTAGGCCTGAGAGGAAGG - Intergenic
1104313415 12:127675327-127675349 CAGAGTCGGTCCTGGGAGGAGGG + Intergenic
1104587755 12:130061268-130061290 CACTGTGAGCCCTGAGTGGATGG + Intergenic
1104752747 12:131250455-131250477 CAGTCTTAGCCCTTTGAGCATGG + Intergenic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1114278079 14:21165887-21165909 CTGTGCTATCCCAGGGAGGAGGG + Intergenic
1114324623 14:21576035-21576057 CAATGGTAGCCCTGGGCTGAAGG + Intergenic
1114664384 14:24369332-24369354 CAGAGTTGGACCTGGGAAGATGG - Intronic
1114673452 14:24426888-24426910 CAGTGAGAGAGCTGGGAGGAAGG + Exonic
1114850363 14:26376142-26376164 CAGGGATAGCACTGGGAGTAAGG + Intergenic
1116098419 14:40403103-40403125 CAGTGTCAGCACTGGGTTGAAGG - Intergenic
1118128674 14:62937842-62937864 CAGTGTGTGCCTGGGGAGGAGGG + Intronic
1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG + Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1122138581 14:99648702-99648724 CAGTCAGAGCCCTGGGAGCATGG + Intronic
1122374080 14:101247150-101247172 CAGTGAGAGAGCTGGGAGGATGG - Intergenic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1122992062 14:105241126-105241148 CAGAGTCAGCCCCGGGAGGCTGG + Intronic
1126947371 15:53836858-53836880 CAGTTTTAACCCTATGAGGATGG + Intergenic
1128065179 15:64760098-64760120 CTGTGTGTGCCCTGGAAGGAGGG - Intronic
1128115152 15:65100655-65100677 CTGTGTTTTCCTTGGGAGGAGGG - Intronic
1128142257 15:65310489-65310511 TAATGTTAGCCACGGGAGGATGG - Intergenic
1129262682 15:74377456-74377478 CAGGCTTAACCATGGGAGGAGGG - Intergenic
1130532138 15:84755518-84755540 CTGAGTTAGCCCTGGGATGTAGG - Intronic
1131351182 15:91701393-91701415 CAGTGTTACCCCCTGAAGGAAGG + Intergenic
1132513408 16:354729-354751 CAGTGATGGCCCTGGGAGGTGGG - Intergenic
1132899619 16:2246126-2246148 CAGTGTCAGGCCCAGGAGGATGG - Intronic
1132945005 16:2527761-2527783 CAGGTGCAGCCCTGGGAGGAGGG - Exonic
1132945885 16:2531249-2531271 CAGGGCTAGCCCTGGGTGGTGGG + Exonic
1133503942 16:6391812-6391834 CAGTGTGAGCTCTTCGAGGATGG - Intronic
1135141199 16:19923575-19923597 CAGGTTTTGCCCAGGGAGGATGG + Intergenic
1135163505 16:20117932-20117954 TCTTGTTAGCCCTGTGAGGACGG - Intergenic
1136541180 16:30928337-30928359 CAGAGTTATCCCTGGGACGGGGG + Intronic
1137768754 16:50997686-50997708 AAGCATTAGTCCTGGGAGGATGG - Intergenic
1137843220 16:51660328-51660350 CAGTGTTAGACCTGAGCTGAAGG + Intergenic
1138809039 16:60127442-60127464 CAGAGTCAGCCCTAGGGGGAAGG - Intergenic
1140138311 16:72228400-72228422 AGGTGTTAGCCTTGGGAAGATGG - Intergenic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1142429630 16:90019228-90019250 AAGGGTGAGCCCTGGGGGGAGGG + Intronic
1143391160 17:6560088-6560110 TTGTGTTTGGCCTGGGAGGATGG - Intergenic
1143582556 17:7835386-7835408 CAGGAAGAGCCCTGGGAGGAAGG + Intergenic
1144033553 17:11343193-11343215 CAGTGTTAGCCTCTGGAGGAAGG + Intronic
1144939540 17:18928546-18928568 CAGTGCTACCCCTGGGAGCCTGG + Intronic
1145914552 17:28563960-28563982 CAGTGTTAGGTCTGGGAAGGTGG - Intronic
1146266140 17:31454094-31454116 CAGTCTCTGCCCTGGGAGAATGG - Intronic
1147554004 17:41464759-41464781 CTGTGTTCATCCTGGGAGGAGGG + Intronic
1148496052 17:48054245-48054267 CAGTGAGAGCCCTGGGGGAAGGG - Intronic
1148547660 17:48529936-48529958 CAGAGCCAGCCCCGGGAGGAGGG - Intronic
1148580257 17:48738615-48738637 CAGTGCAAGGCCGGGGAGGATGG - Intergenic
1148870671 17:50657211-50657233 CAGGTTTAGCCCTGATAGGAGGG + Intronic
1149127065 17:53247753-53247775 TAGTGGTAGCCCTGTGAAGAGGG + Intergenic
1149300792 17:55303257-55303279 CCATGGCAGCCCTGGGAGGAGGG + Intronic
1150505898 17:65698880-65698902 CAGTGCAAGCCCAGGGAAGAGGG + Intronic
1154330286 18:13423845-13423867 CAGTGTTAGGCCTGGTGCGATGG + Intronic
1160134616 18:76261873-76261895 CAGTGGGAGCGCTGGGAGGGAGG + Intergenic
1161556219 19:4944292-4944314 CAGCGTGAGCCCTGGCAGGCGGG - Intronic
1161800983 19:6416682-6416704 CAGTGATGGCCCAGGGAAGAGGG + Intronic
1162029160 19:7909947-7909969 CCGTGCCAGCCCTGGGAGGAGGG + Intronic
1162364206 19:10238122-10238144 CAGTGGAGGCCCAGGGAGGATGG - Intergenic
1162509465 19:11109093-11109115 CATTTTTAGGCCTGGCAGGATGG + Intronic
1162584628 19:11551489-11551511 CCCTGTTATCCCCGGGAGGAGGG + Intronic
1163128241 19:15256008-15256030 CAGAGCAAGCCCTGGAAGGAGGG + Intronic
1163568059 19:18063514-18063536 CAGTGTCAGACCAGGGAGAAGGG + Intronic
1164745795 19:30611927-30611949 CAGTGGCAGCCCTGGGAGTTAGG + Intronic
1166214990 19:41329000-41329022 CAGTGATTGTCCTGGGAGGAAGG - Intronic
1167481648 19:49735749-49735771 CAGTGTTGGACCAGGGAGGATGG + Intergenic
1167948761 19:53010038-53010060 CAGGGTTTGTCCTAGGAGGATGG - Intergenic
1168289236 19:55348993-55349015 CAGCGGTGGCCCTGGGAGGCGGG + Intergenic
1168329834 19:55561290-55561312 AAGTGTGAGCACTGGGAGGCAGG + Intergenic
1168703815 19:58456773-58456795 CAGTGTTACCTCTTTGAGGATGG - Exonic
925891657 2:8439524-8439546 GAGGGTGAGCCCCGGGAGGAAGG + Intergenic
925983860 2:9199118-9199140 CAGTGGGAGCTCTGGGAGCAAGG - Intergenic
926137189 2:10344675-10344697 CAGAGCAAGTCCTGGGAGGAAGG - Intronic
926512906 2:13804474-13804496 CAGTGTTTACCTTGGGAGGATGG + Intergenic
927252650 2:21011738-21011760 CAGTGATAGCTCTGTGAGGGCGG + Exonic
927874240 2:26644062-26644084 AAGAGTTAGGCCTGGAAGGAAGG + Intergenic
928986802 2:37190006-37190028 CAGTGTGAGTCATGGGAGGGTGG - Intronic
930277339 2:49327918-49327940 CATTGTTAGGGGTGGGAGGAAGG + Intergenic
932735130 2:74249119-74249141 CATTGTTATAACTGGGAGGAGGG - Intronic
932966635 2:76483243-76483265 GAGTGTTAGCCTTTTGAGGATGG - Intergenic
933730735 2:85454511-85454533 TAGTGTTGGCCTTGGGTGGACGG - Intergenic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
935257898 2:101328583-101328605 CAGAGGTAACGCTGGGAGGAAGG + Intergenic
935634140 2:105237100-105237122 CAGTTTCAGCGCTGGGAGGAAGG + Intergenic
936027574 2:109045413-109045435 GACTGTTAGCCCAGCGAGGAAGG + Intergenic
937276413 2:120686909-120686931 GAGTGGAGGCCCTGGGAGGAGGG + Intergenic
937276674 2:120689149-120689171 GAGTGTTAGTCCATGGAGGATGG + Intergenic
942657098 2:178225538-178225560 CAGTCAGAGCCCTGGGAGGTAGG + Intronic
943180233 2:184530993-184531015 CAGTGTGAGGCCTGGGAGCTGGG - Intergenic
945985793 2:216352470-216352492 AAATGTCACCCCTGGGAGGAAGG - Intronic
946187808 2:217991074-217991096 CAGAGTCAGCCCTGGGTAGAAGG + Intronic
946854306 2:223937885-223937907 AAGTGTTATGCCTGGGAGGAAGG - Intronic
947053800 2:226077407-226077429 CAGTGTTTGGGCTGGGAGGTGGG - Intergenic
947395795 2:229685884-229685906 CAGTGTGAGGCATCGGAGGAGGG + Intronic
948560722 2:238849328-238849350 CAGGGTTTGCCTGGGGAGGACGG + Intronic
948874230 2:240818798-240818820 CAGTGCCAGCCCTGCGAGGCAGG + Intronic
948890222 2:240903757-240903779 CAGGGTTTGCCCACGGAGGAGGG - Intergenic
1168790368 20:572134-572156 GAGTCTCAGCGCTGGGAGGAGGG + Intergenic
1168841790 20:914450-914472 CATGGTTAGCCCTGGGAGGAGGG + Intronic
1173590636 20:44222141-44222163 CCTGGTTAGCCCTGGGAGGCAGG + Intergenic
1175524058 20:59621443-59621465 CAGTGTCAGGGCTGGGAGCATGG + Intronic
1175914235 20:62418379-62418401 CAGTGTGGTCCCTGTGAGGAGGG + Intronic
1176062036 20:63176671-63176693 CTGGGTTGGCCCTAGGAGGAAGG + Intergenic
1176131122 20:63497276-63497298 CAGCCTTGGCCCTGGGGGGAAGG + Intronic
1176411548 21:6451881-6451903 CAGTGACAGCCCTGACAGGAGGG - Intergenic
1176912444 21:14582402-14582424 TAGTGTTAGCACGAGGAGGAAGG - Exonic
1178692478 21:34761185-34761207 CAGTGCTAACCCTAGGAGGCGGG + Intergenic
1179617950 21:42593810-42593832 CAGAAGGAGCCCTGGGAGGAGGG - Intergenic
1179687042 21:43060203-43060225 CAGTGACAGCCCTGACAGGAGGG - Intronic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181774216 22:25148104-25148126 CAGCTTTGGCCCTGGGAAGAAGG + Intronic
1182092287 22:27604038-27604060 CAGTGCCAGCCCAGGGAGGGGGG - Intergenic
1182762567 22:32734530-32734552 CAGACATCGCCCTGGGAGGATGG + Intronic
1182767905 22:32772028-32772050 CAGTTTTAGCCCAGAGAGGATGG + Intronic
1183080880 22:35455588-35455610 CAGTCTGAGCCCTGGGATGCTGG + Intergenic
1183417144 22:37689001-37689023 CAGTCTCAGCCCTGGGAGGAAGG + Intronic
1183417165 22:37689084-37689106 CACTGCCAGCCCTGGGAAGAAGG + Intronic
1183699895 22:39445349-39445371 GAGGGTTGGCCCTGTGAGGAAGG + Intergenic
1184353118 22:43958065-43958087 TCTTGTTAGCCCTGTGAGGATGG + Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
1184694405 22:46131553-46131575 CAGTGTGGGCCATGGAAGGAGGG + Intergenic
1185209341 22:49560582-49560604 CATTGCTAGCCCTGGGATGCTGG + Intronic
949838981 3:8300024-8300046 ATGTGTTAGGGCTGGGAGGAGGG - Intergenic
951757221 3:26104161-26104183 CAGTATTAGGCCTGGGAAGTGGG - Intergenic
953475003 3:43197951-43197973 CAGTGGTTGCCTTGGGAGGTGGG + Intergenic
954409984 3:50366328-50366350 CAGAGTAAGTCCTAGGAGGAAGG + Exonic
957043679 3:75357358-75357380 CAGGGTCAGCCCAGCGAGGACGG + Intergenic
962975108 3:140439285-140439307 CAGTGAGAGGCCAGGGAGGAGGG + Intronic
967880673 3:194299083-194299105 CAGGACTAGCCCTGGGAGCAAGG + Intergenic
967891938 3:194369802-194369824 CAGTGTTGGCCCTGGGAGGGGGG + Intergenic
968004806 3:195235208-195235230 CACAGTTAGAGCTGGGAGGATGG - Intronic
968921915 4:3526768-3526790 CTGTGTTGGGCCTGGGAGGAAGG + Intronic
969717067 4:8872905-8872927 CGGGGCTGGCCCTGGGAGGATGG - Intergenic
970318947 4:14856619-14856641 CGCTGTTTGTCCTGGGAGGAGGG + Intergenic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
979304942 4:119131700-119131722 CAGTGCTAACTCTGGGAGGAAGG - Intergenic
981568944 4:146131521-146131543 CAGTGAGAGCACTGGGAGGTAGG - Intergenic
981635760 4:146877205-146877227 CAGTGTTATGTCTGGGAGGTAGG + Intronic
983054311 4:163083765-163083787 CAGTGGCAGAGCTGGGAGGAGGG + Intergenic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
985581227 5:696175-696197 CACTGGAAGCCCTGGGTGGAAGG + Intergenic
985595852 5:787507-787529 CACTGGAAGCCCTGGGTGGAAGG + Intergenic
985898237 5:2763395-2763417 CAGTGTTAGCAGTGGGATGTGGG - Intergenic
986313729 5:6572597-6572619 CTGTGTGAGCCCCGGGATGAAGG + Intergenic
986450355 5:7857475-7857497 CAGGGTTGGCCCAGGGAGGGAGG - Intronic
987067651 5:14305214-14305236 CAGGGTTAGCCCAGGCAGGCAGG + Intronic
988008608 5:25452835-25452857 CAGTTTTCTCCCTTGGAGGATGG - Intergenic
990291016 5:54351703-54351725 CAATCTTAGCCCCTGGAGGATGG + Intergenic
991202289 5:64008475-64008497 CAGTTTGTGCACTGGGAGGATGG + Intergenic
992407816 5:76476221-76476243 CAGAGGCAGGCCTGGGAGGAAGG + Intronic
995177787 5:109198582-109198604 AAGTGTCAGCCCTGGGAGAAAGG - Intergenic
996595142 5:125192312-125192334 CTGTCATAGCCCTGGGAGTAGGG + Intergenic
996831321 5:127743582-127743604 AGGTGGTGGCCCTGGGAGGATGG - Intergenic
997800510 5:136856230-136856252 GAATTTTAACCCTGGGAGGACGG + Intergenic
998692499 5:144602432-144602454 CAGTGTTAGCCATGGAGGGCTGG + Intergenic
999291759 5:150430424-150430446 CAGGATTTGCCGTGGGAGGAAGG + Intergenic
999785070 5:154883378-154883400 GAGAGTTGGCCCTGGGACGACGG - Intergenic
1000266943 5:159647021-159647043 CAGCTTGAGCCCTGGCAGGAAGG - Intergenic
1000608704 5:163351945-163351967 CAGTGGCAGGCCTAGGAGGAAGG + Intergenic
1001044182 5:168358913-168358935 CAGTGGTTGCCTGGGGAGGAGGG - Intronic
1001650299 5:173311176-173311198 CAGAGGGAGCCCTGGCAGGAAGG + Intergenic
1004208688 6:13615700-13615722 GCGTTTTATCCCTGGGAGGAAGG - Exonic
1005889141 6:30122046-30122068 TATTGTTAACCCTGTGAGGATGG - Intergenic
1006901755 6:37507345-37507367 CATAGTTAGCCCAGGGAGGAAGG + Intergenic
1007196125 6:40062244-40062266 TAGTGCTAACCCTGTGAGGATGG - Intergenic
1007787180 6:44287378-44287400 CTGTCTTGGCCCTGGGTGGAAGG + Intronic
1008036884 6:46754507-46754529 CAGTTATAGCTCTGAGAGGATGG + Intronic
1009905572 6:69867113-69867135 CGGTGTTAGCCCTGGAAGCGAGG + Intronic
1012540091 6:100352504-100352526 CCCTGTTAACCCTGTGAGGATGG + Intergenic
1017122690 6:151039232-151039254 CAGTGTTGGCACAGGGAGAAGGG + Intronic
1019255236 7:45633-45655 GAGTGTGAGCCCTGCGAGGAAGG - Intergenic
1019409170 7:899167-899189 CAGTGGTGGCCCTGGGTGGACGG + Exonic
1019463317 7:1172822-1172844 CAGTGCTAGCCCGGGGTGGCGGG + Intergenic
1019638636 7:2090461-2090483 CAGTGCTTGCACTGGGAGGCTGG - Intronic
1020011760 7:4809181-4809203 CAGTGACAGCCCGGGGAGGCGGG - Intronic
1022232079 7:28423845-28423867 ATGTGGTCGCCCTGGGAGGAGGG - Intronic
1022346315 7:29518011-29518033 CAGTGATAGACCTGTGAGGTTGG - Intergenic
1022594318 7:31697419-31697441 CCGTGGAAGCCTTGGGAGGAGGG - Intronic
1023307809 7:38849559-38849581 CAGAGTTTGGCCTGGGAGGTTGG - Intronic
1029461874 7:100699387-100699409 AGGTCTGAGCCCTGGGAGGATGG - Intergenic
1031292782 7:119958920-119958942 TCTTGTTAGCCCTGTGAGGATGG + Intergenic
1031682643 7:124693298-124693320 CAGTGTTGGCCATGTGAGGAAGG + Intergenic
1032086539 7:128886794-128886816 CAGCCTTAGGCCTGGCAGGAAGG + Intronic
1032288708 7:130566645-130566667 CAATTTTAGGCCTGGGAGGGAGG + Intronic
1033584746 7:142765862-142765884 CTGAGTTAGCCCTGTGAGAAGGG + Intergenic
1034521617 7:151625055-151625077 CATTGTAAGCTCTGTGAGGATGG - Intronic
1034541671 7:151762486-151762508 CAGTGTCAGTTCTGTGAGGATGG + Intronic
1034911389 7:155001931-155001953 CAGAGTTAGGCCTGGAAGGGCGG - Intronic
1036679420 8:10860157-10860179 CCGTGTTAGCCAAGGGAAGAGGG - Intergenic
1038481336 8:27903841-27903863 CGGTCTTGGCTCTGGGAGGATGG - Intronic
1039558710 8:38495916-38495938 CAATGCTGGCTCTGGGAGGAGGG + Intergenic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1044698344 8:94944971-94944993 CAGTTTTAGCAATGGGGGGAGGG - Intronic
1046777421 8:118179054-118179076 CATTGCCAGCCATGGGAGGAGGG - Intergenic
1049192651 8:141297110-141297132 CAGTGAGGGCCTTGGGAGGAGGG + Intronic
1049557931 8:143292709-143292731 CTGCGTCAGCCCTGGGTGGAGGG + Intronic
1051545381 9:18268537-18268559 CATTGTCAGCCCAGAGAGGATGG - Intergenic
1052792829 9:32892207-32892229 CAGCGGTAGCCCAGGAAGGAGGG - Intergenic
1053381958 9:37655956-37655978 CAGTGAAATCCCTGGGATGAGGG - Intronic
1056108519 9:83371784-83371806 CAGAGTTTGCCCTTGAAGGATGG + Intronic
1056311034 9:85341147-85341169 CAGTGTGAGCCCTGGGGTGGAGG + Intergenic
1057127026 9:92625007-92625029 AACAGTTAACCCTGGGAGGAAGG + Intronic
1057193431 9:93100009-93100031 CACTGTGAGCCCCTGGAGGATGG + Intronic
1060296879 9:122348892-122348914 GAATGTGAACCCTGGGAGGAAGG + Intergenic
1060567441 9:124605736-124605758 CAGGGTTAGCCCTTCGATGATGG + Intronic
1060745070 9:126125985-126126007 CTGTATCAGCCCTGGGAGGGGGG - Intergenic
1061022799 9:128027094-128027116 CAGGTCGAGCCCTGGGAGGAGGG - Intergenic
1061572400 9:131485849-131485871 CAGCGTCAGACCTAGGAGGAGGG - Intronic
1062525140 9:136975180-136975202 CAGTCCTAGCCGGGGGAGGAGGG + Intergenic
1062572322 9:137191377-137191399 CAGTGCCAGCTCTGGGAGGCTGG + Intergenic
1186519102 X:10189653-10189675 CACTGTTAGTCCAGCGAGGAAGG - Intronic
1186740286 X:12509984-12510006 CAGTGTTAGCTCTGTGATGGTGG + Intronic
1190245850 X:48689462-48689484 CAGTGCTAGCCCTGGGAGCCAGG - Intronic
1190370922 X:49739886-49739908 CAGTGTGAACCCTGGGTGAAGGG + Intergenic
1191972260 X:66829596-66829618 CAGTTTTAGCCCAGGGAGGATGG - Intergenic
1195661737 X:107385464-107385486 CAGTGTTATCGATGGGAGGAGGG - Intergenic
1198252484 X:134893569-134893591 CAGTGTTAGCTCTAGGAGGGTGG - Intronic
1199697260 X:150351599-150351621 CAGGGTGAGTCCTGGGAGGTGGG + Intergenic