ID: 1118635219

View in Genome Browser
Species Human (GRCh38)
Location 14:67742704-67742726
Sequence CTTGGACATAGCTTGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118635219 Original CRISPR CTTGGACATAGCTTGATGCA TGG Intronic
902065187 1:13679894-13679916 CTTGGAAATAACTTGATCCTCGG + Intergenic
902415012 1:16233381-16233403 CTTGAGCGTAGCTTGATGCTAGG + Intronic
907754296 1:57295440-57295462 CTTAGACTTAGCTTCATCCAAGG + Intronic
913534491 1:119758297-119758319 CTTGATCATAGCTTACTGCATGG + Intronic
1066449316 10:35513695-35513717 CTTGGACATAACTAGCTGCGTGG - Intronic
1068757136 10:60668667-60668689 CTTGGACAAAGCTTTCTGGAGGG - Intronic
1069408555 10:68128117-68128139 CTTGGACATAGCTTCATTGGAGG + Intronic
1069728636 10:70597372-70597394 CATGTACATAGCTTGATAAAGGG - Exonic
1073539216 10:104304737-104304759 GTTGCACATGGCTTGATTCATGG + Intronic
1073978369 10:109125851-109125873 TTTTGAGATAGCTTGATGGATGG - Intergenic
1078362066 11:10676711-10676733 CTCGGACATGGCTGGATCCACGG - Intronic
1079555222 11:21752063-21752085 CTTGGCAAAAACTTGATGCATGG - Intergenic
1079875087 11:25846284-25846306 CTTGTACAAAGCTTGGGGCAAGG - Intergenic
1080918391 11:36683658-36683680 CTTGGAAATAGCTGGCTTCACGG - Intergenic
1086510160 11:87548385-87548407 CATTCACATAGCATGATGCAAGG - Intergenic
1086637773 11:89111000-89111022 CTTGGTCAAATCTTGAAGCATGG - Intergenic
1088256851 11:107911266-107911288 TTTGGCTATAGTTTGATGCAGGG + Intronic
1089062552 11:115637699-115637721 TTTGGAACTTGCTTGATGCATGG + Intergenic
1091093385 11:132793635-132793657 CTTAGACATAGCTTGAAAAAGGG + Intronic
1095830272 12:46578352-46578374 ATTGAACATAGCTTGCTGGATGG - Intergenic
1096656527 12:53096078-53096100 CTTGGTCAGAGCTTGTGGCAGGG + Intergenic
1101057901 12:100938160-100938182 CTTGGATATAGCTTTATACCTGG + Intronic
1101690852 12:107079438-107079460 TTTGGACATCGCTTGATACCAGG - Intronic
1101738498 12:107481715-107481737 CTTTGACACAGCTGGATCCAGGG + Intronic
1104233331 12:126906878-126906900 CTTTGAGATATCTTCATGCAGGG + Intergenic
1110695764 13:78486430-78486452 CTTTGACAGAGCTAAATGCAGGG - Intergenic
1111814688 13:93136450-93136472 CTTGAAAATAGTCTGATGCAAGG - Intergenic
1113951193 13:114071876-114071898 CTTGGAAGTAGCCAGATGCAAGG + Intronic
1115408350 14:33045024-33045046 CTTTGACACAGCTTGAGGGAAGG + Intronic
1118635219 14:67742704-67742726 CTTGGACATAGCTTGATGCATGG + Intronic
1119944326 14:78675832-78675854 GTTGGAAAATGCTTGATGCAAGG - Intronic
1123704376 15:22940356-22940378 CTTGGCCACAGCTAGCTGCAGGG - Intronic
1130785090 15:87087265-87087287 CTTGGACAGAACATGGTGCATGG + Intergenic
1133267814 16:4595172-4595194 CTAGGACTTAGCTGGATGAAGGG + Intronic
1133832979 16:9341324-9341346 ATTGGACACTGCTTGATGCTGGG + Intergenic
1136549186 16:30973347-30973369 CTTGGACTTAGGGTGTTGCAAGG + Intronic
1138029255 16:53546923-53546945 CATGGAGAAAGCTTGAGGCAGGG - Intergenic
1141319643 16:82995314-82995336 CATGGTCATACCTAGATGCAAGG - Intronic
1142424165 16:89992113-89992135 CGTGGTCACAGCTTGATGCTGGG - Intergenic
1147865219 17:43547397-43547419 CTTGGACATAGCTGCTTGCCTGG - Intronic
1150419470 17:65019074-65019096 CTTGGAAGTAGCTTCAGGCAGGG - Intronic
1157750737 18:50175871-50175893 GGTGGACTTAGCTTGGTGCAGGG - Intronic
1158664739 18:59422257-59422279 CTTGGGCATAGCTAGATTCCAGG - Intergenic
1160202634 18:76808148-76808170 CTAGAACAGAGCTTGAGGCAGGG + Intronic
1162016873 19:7850957-7850979 CTTGCACAAAGCTTTATGCTGGG + Intronic
1163488298 19:17602502-17602524 CCTGGACCTCGCTTTATGCAAGG - Exonic
1164694159 19:30231268-30231290 CTTGGAGATAGGCTGAGGCAGGG - Intronic
1165561136 19:36681011-36681033 CATGGACATATCTTTTTGCAGGG + Intergenic
1165976210 19:39679039-39679061 CTTGGTCAGAGATGGATGCAAGG + Intergenic
1167627890 19:50604616-50604638 CTTGTACATAACTGGATGCCTGG + Intergenic
925878493 2:8331683-8331705 CTTGGACATAGCATAGTGCAAGG + Intergenic
928582297 2:32721367-32721389 CTCGGAGATAGCTGGATTCAGGG + Intronic
929122875 2:38497901-38497923 CTTGCACATTGCTTAATGAATGG - Intergenic
930672029 2:54161325-54161347 ATTGGAAATAATTTGATGCACGG - Intronic
938102316 2:128505424-128505446 CTTGCTCATAGCTTGTAGCAGGG + Intergenic
941321165 2:164056704-164056726 CTTGAACATAGCTTTAAGGATGG + Intergenic
943356822 2:186866812-186866834 CTTTAGCATAGCTGGATGCAGGG + Intergenic
947450166 2:230200493-230200515 CTAGGAAAAAGCTTGATCCATGG + Intronic
1170031926 20:11953145-11953167 TTTGGTCATACCTGGATGCAAGG + Intergenic
1172936513 20:38624403-38624425 CTTGAACATAGCTGCATGCAGGG - Intronic
1173330478 20:42072037-42072059 CTTGGACAGAGCTAGTTACATGG - Intergenic
1174148110 20:48466623-48466645 CATGGTCACAGCTTGCTGCAAGG + Intergenic
1174362567 20:50038157-50038179 CTTGGGCATAGCTAAATGCCTGG + Intergenic
1175156919 20:56977437-56977459 CTTGGACCTAGGTGGCTGCAGGG - Intergenic
1176056447 20:63151511-63151533 CTTGGGCCCAGCTGGATGCAGGG + Intergenic
1177959211 21:27641094-27641116 CTGGAACATAGGTTGATGCTTGG - Intergenic
1178153392 21:29822534-29822556 CATGGAAACAGCTTGTTGCAAGG - Intronic
1178675350 21:34626765-34626787 CTTGTACACAGCATGATGCCAGG + Intergenic
1182379185 22:29872583-29872605 CTTGGAGCTCGCTTGGTGCAGGG + Intergenic
950677932 3:14565722-14565744 CTGGGACATAGCTCCCTGCAAGG - Intergenic
951358330 3:21695662-21695684 CCTGGGCATAGCTTGATGACTGG - Intronic
955061164 3:55492466-55492488 TATGGAGATAGCTTGATGAATGG + Intergenic
958086583 3:88816634-88816656 CATTGACTTAGCTTCATGCACGG - Intergenic
958799136 3:98735760-98735782 TTTGGAGTGAGCTTGATGCATGG + Intronic
960389141 3:117055367-117055389 CTGGGACAGAGCTAGATGCCTGG - Intronic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
970152215 4:13101648-13101670 CTTGGACAAACATTGAGGCAGGG + Intergenic
972310367 4:37876703-37876725 TTTGGATATGGCTTGAGGCAGGG - Intergenic
973149182 4:46866145-46866167 CTTGGACATGGCATCATGTACGG - Intronic
986689277 5:10300570-10300592 CATGGTCATAGCTTGAGGCCAGG + Intronic
990249664 5:53900293-53900315 CTTTGGCATAGCTTGATTCAGGG - Intronic
991613564 5:68472919-68472941 CTTGGACATAGCTCTATTCCAGG + Intergenic
992127112 5:73653579-73653601 CTTGCACATAGCTACATGGAAGG + Intronic
999410235 5:151344055-151344077 CTGGGACACAGCTTGGTGCGGGG - Intronic
1000842061 5:166232241-166232263 CTTGGAAATATTTTGATGCATGG + Intergenic
1004282706 6:14294452-14294474 CTTGGACACAGCTTGATGACTGG - Intergenic
1015495063 6:133872868-133872890 CTTGTACATTACTTGATACATGG + Intergenic
1021939089 7:25661910-25661932 CTAGGGTATAGCTTGATGAAAGG + Intergenic
1038122524 8:24633483-24633505 CTTGGACATGGCAAGATGAAAGG - Intergenic
1038518860 8:28211784-28211806 CTTGAATAGAGTTTGATGCAAGG + Intergenic
1039947599 8:42143433-42143455 CTGGAATATAGCTTGATGCCTGG + Intergenic
1049634717 8:143681443-143681465 CTGTGTCATAGCTTCATGCAGGG - Intergenic
1050009231 9:1169336-1169358 AATGGAGATAGTTTGATGCAGGG + Intergenic
1056260898 9:84847424-84847446 CTTGTATGTGGCTTGATGCAAGG + Intronic
1058461570 9:105188796-105188818 CTGGGCCATAGCTTTGTGCAGGG + Intergenic
1058515651 9:105771595-105771617 CTTGGTCATAGCTTGACTTAAGG - Intronic
1059128660 9:111721062-111721084 CTTGGAGATAGTTTGATCCTTGG + Intronic
1060624195 9:125095590-125095612 CATGGCCATACCTGGATGCAAGG - Intronic
1061887934 9:133602137-133602159 CTTGGGCATGGCTGGAGGCAGGG - Intergenic
1062461492 9:136664323-136664345 CTTGGTCCTACCTTGGTGCATGG - Intronic
1187486259 X:19707098-19707120 CTGGGACATGGCTTGAGGCACGG + Intronic
1191934934 X:66417172-66417194 CTTGAATATATCTTGCTGCAGGG + Intergenic
1196713703 X:118790862-118790884 CTTAGACATAACCTAATGCAGGG + Intronic
1199196867 X:145041956-145041978 CCTGGACATACCTGCATGCAGGG + Intergenic