ID: 1118636977

View in Genome Browser
Species Human (GRCh38)
Location 14:67756961-67756983
Sequence ATGGAGACACAGACTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 624}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118636977_1118636978 -6 Left 1118636977 14:67756961-67756983 CCTTTCTCAGTCTGTGTCTCCAT 0: 1
1: 0
2: 2
3: 68
4: 624
Right 1118636978 14:67756978-67757000 CTCCATTCTTTTAGTTGTTCAGG 0: 1
1: 1
2: 14
3: 71
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118636977 Original CRISPR ATGGAGACACAGACTGAGAA AGG (reversed) Intronic
900317150 1:2062892-2062914 ATGGAGACAGAGGCTGAGTCTGG - Intronic
900746089 1:4361714-4361736 GTGGAGACAGAGACCGAGATGGG + Intergenic
900905371 1:5553168-5553190 TTGAAGACAGAGACTGAGGAAGG + Intergenic
901303422 1:8215900-8215922 ACAGAGACACAGACCGAGACAGG + Intergenic
902243020 1:15101292-15101314 AGGGAGACAGAGAGAGAGAAAGG - Intronic
902951926 1:19891446-19891468 ATGGGGAGAGAGACTGATAAAGG + Intronic
902992756 1:20200792-20200814 ATGGAATCACAGACTGAGGATGG + Intergenic
903321768 1:22547609-22547631 ATGGAGAGAGAGACGGAGAGAGG - Intergenic
903390745 1:22962055-22962077 AAGGAGACAGAGGCTCAGAAAGG - Intronic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
904207084 1:28862474-28862496 ATGGACACAAAGGCTGAAAAGGG + Intronic
905093567 1:35449626-35449648 ATGGAGAAACAAACTCAGAGAGG - Intronic
905714298 1:40134869-40134891 AAGGAGACAGAGAAGGAGAAGGG - Intergenic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
906383171 1:45345676-45345698 ATGAAGAAACAGACTCAGAGAGG + Intronic
906516867 1:46444574-46444596 ATGGAGGCACAGACAGATTAAGG + Intergenic
906775344 1:48524385-48524407 CTGGAGACAGAGTCTGAAAAGGG + Intergenic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
907739240 1:57148105-57148127 ATGGAGAGACAGCTTGAAAATGG + Intronic
907787974 1:57632572-57632594 AGGCAGACACAGACAGAGGAAGG + Intronic
907977965 1:59451562-59451584 AGAGACACACAGAGTGAGAAAGG + Intronic
908156673 1:61360414-61360436 AGGGAGACACAGGCTCAGAGAGG - Intronic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
910631367 1:89358393-89358415 AGGGAGACAGAGACAGAGAGAGG - Intergenic
911038440 1:93573502-93573524 ATGGAGACAAAGAGGGAAAATGG - Intronic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912474632 1:109927787-109927809 ATAGAGGCAGAGACTGAGATAGG + Intronic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
912577389 1:110685960-110685982 ATGGAGAGAGGGACAGAGAATGG - Intergenic
913030145 1:114893258-114893280 ATAGAGATACAGACAGAGATAGG - Intronic
914863228 1:151403878-151403900 ATGAAGACTCAAACTGGGAATGG + Exonic
914899391 1:151703773-151703795 ATCGAGAGAGAGACAGAGAAGGG + Intronic
914957184 1:152173266-152173288 ATGAAGACCCAGATAGAGAAAGG - Intergenic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
914988742 1:152480520-152480542 ATGGAGAGAGAGACTGGGAAAGG - Intergenic
915000285 1:152583193-152583215 ATGGAGACAGAAACTCAGAAAGG + Intronic
915006101 1:152638475-152638497 ATTGAGACAAACACTAAGAATGG - Intergenic
915801660 1:158800039-158800061 ACTTAGAAACAGACTGAGAATGG - Intergenic
917161713 1:172064474-172064496 AGGGTGACACAAACTGAGCAGGG + Intronic
917243550 1:172975255-172975277 GGGGAGACAGAGACTGAGAAGGG - Intergenic
918256174 1:182749953-182749975 ATGAAGAAACAGACTAAGAGAGG - Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918658671 1:187062047-187062069 ATGGAGATAGAGACAGGGAAAGG - Intergenic
919059901 1:192619239-192619261 ATGGAAATAAAGATTGAGAATGG - Intergenic
919306905 1:195853100-195853122 AGAGAGAGACAGACAGAGAATGG - Intergenic
919717153 1:200790592-200790614 ATGGAGAGACAGACAGGCAAAGG - Intronic
919752483 1:201047000-201047022 ATGGAGACATAGAGGGAAAAAGG - Intronic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
920648990 1:207822936-207822958 ATGGAGACACAGAGAGCGCAAGG + Intergenic
923647469 1:235838815-235838837 ATCTACACACAGACTAAGAAGGG - Intronic
924000012 1:239540144-239540166 ATGAGGACACATTCTGAGAAAGG - Intronic
924010948 1:239664801-239664823 AGGAAGACCCACACTGAGAACGG - Intronic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924561241 1:245157176-245157198 ACACACACACAGACTGAGAAGGG - Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924833369 1:247622375-247622397 ATGGAGACACAGCCAGTCAACGG - Intergenic
1063647449 10:7899228-7899250 ATGGAGGGACCGAATGAGAACGG - Intronic
1063741413 10:8825595-8825617 GTGTAGAAAAAGACTGAGAAGGG + Intergenic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1065192920 10:23231219-23231241 ATTGCAAGACAGACTGAGAAAGG - Intronic
1065385527 10:25129927-25129949 ATGGGGACAGAAACTGGGAAGGG + Intergenic
1067067963 10:43114244-43114266 ATGGAGACAGAGGCTCAGAGAGG - Intronic
1067222157 10:44352221-44352243 AGGGAGACAAAGAGTGAGGAGGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067558721 10:47289644-47289666 AAGGAGCCACAGCTTGAGAAGGG - Intergenic
1067723463 10:48748328-48748350 AAGGAAACAAAGGCTGAGAAAGG + Intronic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1068123601 10:52810864-52810886 TTGGAGTCACAGTCTTAGAAGGG + Intergenic
1068867098 10:61905535-61905557 ATGGGGACATAGACTCGGAAAGG + Intronic
1069426064 10:68289633-68289655 AAGGAGAAAGAGACTTAGAAAGG + Intronic
1069680667 10:70283308-70283330 ATAGAGACAGACACTGAGAGAGG - Intronic
1069682706 10:70296636-70296658 CTGGAGACACAGTCAGAGCACGG + Intergenic
1070355610 10:75637384-75637406 ATGGAGGCAGAGACAGAGAGGGG + Intronic
1072188395 10:93062467-93062489 CTGGAGACTCAGACCTAGAAAGG + Intronic
1072268808 10:93755537-93755559 ATGAAGACACAGCCGAAGAAAGG - Intergenic
1072324894 10:94288232-94288254 TTGGAGACTCAGAATGAGAGTGG - Intronic
1072555413 10:96511064-96511086 ATGGAGACCCACACCAAGAAGGG + Intronic
1072760688 10:98054078-98054100 AGAGAGAAACAGACTGAGAGAGG - Intergenic
1073186019 10:101615469-101615491 AATGAGACACAGGCTGAGGAGGG + Intronic
1074345070 10:112677129-112677151 ACGGACAGACAGACTGAGAATGG + Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074493071 10:113956054-113956076 CTGGAGACAGAGGCAGAGAATGG - Intergenic
1074769872 10:116726337-116726359 AGGGAGACAGAGACAGAGGAAGG - Intronic
1074826536 10:117219002-117219024 ATGGAGTCACAAACTAACAAGGG + Intergenic
1075007142 10:118839337-118839359 ATGGTGACTCAGACTTAGGAGGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075498908 10:122954156-122954178 ATGGAGACGCGGACCGAGGACGG - Exonic
1076294352 10:129373102-129373124 ATGAAGAGACAGACTGAGCTTGG - Intergenic
1077300616 11:1845053-1845075 ATGGAGACAGAGACAGACAGAGG + Intergenic
1077392806 11:2307817-2307839 ATGGAGACCCAGGCAGAGTATGG + Intronic
1077546321 11:3171752-3171774 TTTGAGACACAGACACAGAAAGG - Intergenic
1078261962 11:9717921-9717943 ATTGAGCCACAGGCTGTGAAGGG + Intronic
1078394921 11:10972559-10972581 AGAGAGAAACAAACTGAGAATGG + Intergenic
1078867748 11:15313508-15313530 AGGGAGAAAAAGACAGAGAAGGG - Intergenic
1079120470 11:17680485-17680507 CTGAAGGCACAGACTGAGATTGG - Intergenic
1079422633 11:20308312-20308334 ATAAAGAAACAGACAGAGAAAGG + Intergenic
1079570378 11:21935623-21935645 AGGGAGACTGAGACTGAAAATGG + Intergenic
1080005898 11:27406076-27406098 ATGGGGACACAGACTGGGATAGG - Intronic
1080397878 11:31906596-31906618 AGGGAGAGACAGAAAGAGAAGGG + Intronic
1081090338 11:38857059-38857081 ATGAAGACACAGACTATGATGGG + Intergenic
1081512358 11:43788828-43788850 ATGGAGCCCCACACTTAGAAGGG + Intronic
1081614067 11:44580003-44580025 AGGGAGCCACAGACAGAGATAGG + Intronic
1081696052 11:45109838-45109860 ATGGAACCAGAGACTCAGAAAGG - Intronic
1081893225 11:46562606-46562628 GTGGAGACACTTATTGAGAAGGG + Intronic
1082062180 11:47870527-47870549 AGAGAGAGACAGACAGAGAAGGG - Intergenic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1082792981 11:57359982-57360004 ATGGAAAAACAGACTCAGAGAGG + Intronic
1082806496 11:57454984-57455006 ATGGAGAAACAGGCTCAGAGAGG - Intergenic
1083161630 11:60857973-60857995 CTGGAAACAAGGACTGAGAAGGG - Intergenic
1083254404 11:61487276-61487298 TTTGAGAAACAGACTGAGACTGG + Intronic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1084475520 11:69386516-69386538 ATGGAGGCTCAGAGAGAGAATGG - Intergenic
1084596840 11:70121690-70121712 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084596888 11:70122101-70122123 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084596920 11:70122375-70122397 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084596934 11:70122514-70122536 ATAGAGAGACAGACAGAGAGAGG - Intronic
1084629971 11:70341697-70341719 ATGGAGACAAGGTCTAAGAATGG + Intronic
1085041463 11:73328802-73328824 GAGGAGGCACAGACTGAGACAGG + Intronic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1086402063 11:86469185-86469207 ACTGAGACCCAGACAGAGAAAGG - Intronic
1086957761 11:92951222-92951244 ATGGAGAGACAGGCTGGGCATGG + Intergenic
1086999933 11:93407428-93407450 ATGGGGACACATTCTGAAAAAGG - Intronic
1088765261 11:112969295-112969317 ATGGAAACTGAGACTGAGAAAGG + Intronic
1088888431 11:114025955-114025977 ACAGAGACAGAAACTGAGAAAGG - Intergenic
1089128451 11:116193680-116193702 AAGGAGACAAAGGCAGAGAAAGG - Intergenic
1089150781 11:116362422-116362444 AAGGAGAGACAGACTGGGAGTGG + Intergenic
1089749369 11:120639531-120639553 ATGGAGTCACTTACTGAGACAGG - Intronic
1089843026 11:121435215-121435237 ATGGAGAGAGAGATTGAGAGAGG - Intergenic
1090129329 11:124123327-124123349 ATGAAGAGACAGAGTGAGAGAGG - Intronic
1091073454 11:132591211-132591233 ATGGCGCCACAGACAGAGACGGG + Intronic
1091797901 12:3307702-3307724 ATCGGGACACAGACAGAGAATGG + Intergenic
1091831133 12:3551885-3551907 GAGGAGACAGAGACAGAGAAAGG + Intronic
1092859707 12:12709972-12709994 ATGGGAACAGAGTCTGAGAAGGG + Intergenic
1093225319 12:16476149-16476171 ATGCAGCCAAAGACTAAGAAAGG + Intronic
1093511487 12:19934750-19934772 ATGGAGAGAGAGAGTGAGAGAGG + Intergenic
1093553758 12:20446812-20446834 AGGGAGACACAAACTGATAAAGG + Intronic
1093919089 12:24839227-24839249 AAGGAAAGCCAGACTGAGAATGG + Intronic
1094728615 12:33148541-33148563 ATGAAGAAACAGATAGAGAAAGG + Intergenic
1095208098 12:39461330-39461352 AGGGAGACAGAGACAGAGAGAGG - Intergenic
1095514961 12:42995338-42995360 ATGGAGACAAATACAGAGGAAGG + Intergenic
1096479025 12:51925806-51925828 ATGCAGAAACAGACTTACAAGGG + Intergenic
1096613988 12:52821463-52821485 ATTGAGACACAGACAGGGAAGGG + Exonic
1096863503 12:54547278-54547300 AAGGAGCCACAGAGTGAAAAAGG + Exonic
1097099089 12:56573649-56573671 AGGGTGGCACAAACTGAGAAAGG - Intronic
1097290954 12:57914522-57914544 ATGAAGACACAGACTTAGAGGGG + Intergenic
1097660698 12:62427519-62427541 ATGGAGACAGACCCAGAGAAAGG - Intergenic
1098170878 12:67745917-67745939 AAAGAGAAACAGACAGAGAAGGG - Intergenic
1098414669 12:70219573-70219595 ATAGAGACACAGACACACAAGGG - Intergenic
1099725116 12:86416104-86416126 ATAGAGACAGAGATTGAAAATGG + Intronic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1099996162 12:89781356-89781378 CTCTATACACAGACTGAGAAGGG - Intergenic
1100477795 12:94949899-94949921 AGGGAGACAGAGAGAGAGAAAGG + Intronic
1100850705 12:98707763-98707785 AGGCAGAGAAAGACTGAGAAAGG + Intronic
1101846668 12:108368358-108368380 ATGGAGAAACAGGCCCAGAAGGG + Intergenic
1102465972 12:113131027-113131049 TCGGAGGCACAGACAGAGAAGGG + Intronic
1102819403 12:115895115-115895137 ATGAAAACACACCCTGAGAAAGG - Intergenic
1103040105 12:117687914-117687936 CTGGAGACCCAGGCTCAGAAAGG - Intronic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1103263144 12:119606321-119606343 ACAGAGACAGAGACAGAGAAGGG + Intronic
1103744774 12:123115048-123115070 ATGGAGACCCAGCCTCAGAAGGG - Intronic
1104062480 12:125280501-125280523 ATGGACACTCAGATTGAGCAAGG - Intronic
1104308325 12:127630739-127630761 ATGCTTACACAGACAGAGAAGGG - Intergenic
1104795029 12:131511331-131511353 CAGGAGACACAGACTCAGAAAGG + Intergenic
1104987960 12:132607788-132607810 AGGGAGACAGAGACAGAGAGAGG - Intronic
1106361594 13:29036227-29036249 ATGGAGGAACAAACTGAGAGTGG - Intronic
1106888713 13:34218990-34219012 CTTGAGACACAGACAGAAAATGG + Intergenic
1107120083 13:36786697-36786719 GTGAAGGCAAAGACTGAGAAAGG + Intergenic
1108322873 13:49304218-49304240 GTGGAGACCTAGACTGAGCATGG + Intergenic
1109253004 13:60043453-60043475 AGGGAGGCAAAGAATGAGAAAGG + Intronic
1110647078 13:77900116-77900138 AGGGGGACACAGACAGAGACAGG - Intronic
1111659286 13:91189498-91189520 ATGGAGTAACAGAGAGAGAAAGG + Intergenic
1112035869 13:95496109-95496131 ATGCAGACACAGCCTGAGAAAGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112924546 13:104657552-104657574 AGGGAGAGACAGAGGGAGAAAGG - Intergenic
1113192405 13:107764457-107764479 ATGTAGACAGAGAGAGAGAAAGG + Intronic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1113399240 13:109976081-109976103 TTGGGACCACAGACTGAGAAGGG - Intergenic
1114389759 14:22294301-22294323 AAGCAGACACAGACTGGGAGTGG - Intergenic
1114729300 14:24974365-24974387 ACGGGGACACTGACAGAGAATGG - Intronic
1115316908 14:32034491-32034513 ATTGAGACAAACACTGAGCAAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116268265 14:42725341-42725363 ATAGAGACAGAGACAGAGATAGG - Intergenic
1116853468 14:49931294-49931316 ATGTAGACACGGACATAGAAAGG - Intergenic
1118164382 14:63321634-63321656 ATGGAGACACTGACAGAGCCTGG + Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119176856 14:72574831-72574853 GTGGGCACAGAGACTGAGAAAGG + Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1120421570 14:84292624-84292646 ATGAAGACACAGGCAGAGACTGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123400883 15:19984780-19984802 ATGGAGACAGAGAGAGAGAAAGG - Intergenic
1124789273 15:32712065-32712087 AAGGAAACAAAGACTGGGAAGGG + Intergenic
1126179619 15:45772348-45772370 ATGGAGACACACACAGAGGTGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126680338 15:51196189-51196211 CTGGAGACACAGCCTTAGATAGG + Intergenic
1126689720 15:51279970-51279992 AAGGAGAAACAGAGAGAGAAGGG + Intronic
1127054441 15:55117131-55117153 ATCAAGCTACAGACTGAGAATGG + Intergenic
1127317036 15:57806814-57806836 AAGGAGAAACAGACTCATAAAGG - Intergenic
1127886596 15:63206913-63206935 AGGATGACAAAGACTGAGAAAGG - Intronic
1128372585 15:67051161-67051183 ATGTACACACACACTGACAAAGG - Intergenic
1128453938 15:67822496-67822518 ACGGAGAGACCGACTGAGACAGG + Intronic
1128467312 15:67923681-67923703 ATAACCACACAGACTGAGAATGG - Intergenic
1128676865 15:69616028-69616050 AGGGAGACAGAGACTGACATGGG + Intergenic
1128705869 15:69837095-69837117 ATGGAGACTGAGGCTCAGAAAGG + Intergenic
1128929594 15:71692170-71692192 ATCTAGGCACAGACTGATAAAGG + Intronic
1129002863 15:72348314-72348336 CTGTTGACACAGGCTGAGAAAGG + Intronic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129820778 15:78600399-78600421 AGGGAGACACTGACTGGCAAGGG + Intronic
1130347417 15:83061037-83061059 ATGGAGATACATTCTAAGAAAGG + Intronic
1130789566 15:87139088-87139110 AGAGAGACAGAGACTGAGAGGGG + Intergenic
1130930065 15:88419387-88419409 ATGGAAACTCAGAATGACAAAGG + Intergenic
1131442547 15:92469871-92469893 ATGGTGAGGAAGACTGAGAAAGG - Intergenic
1131541954 15:93281906-93281928 ACGTAGGCACACACTGAGAATGG + Intergenic
1131578822 15:93620026-93620048 ACGGAGACAGAGATTGAGAGAGG + Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1133059473 16:3165109-3165131 ATGGGGACACAGATTGAGTTGGG - Intergenic
1133070900 16:3246300-3246322 ATGGAGCTGCAGACTGGGAAGGG - Intronic
1133547512 16:6822106-6822128 TGGGGGAGACAGACTGAGAAAGG + Intronic
1133595120 16:7283555-7283577 ATGGAGATACAGAATGTCAAGGG - Intronic
1133868869 16:9669375-9669397 ATGGAGCCTAAGGCTGAGAAGGG + Intronic
1134263283 16:12671362-12671384 AAGGAAACAGAGATTGAGAATGG + Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134379585 16:13711547-13711569 ATGATGACACATACTGAGACAGG - Intergenic
1134865904 16:17606877-17606899 AAGGAGGCACAGATTCAGAAAGG + Intergenic
1135954502 16:26944994-26945016 ATGGATACAAAGACTCAGAAAGG - Intergenic
1135968636 16:27055937-27055959 GAGGAAACCCAGACTGAGAAAGG + Intergenic
1136469893 16:30473086-30473108 GTGGAGGCAAAGACAGAGAAGGG + Intronic
1137755998 16:50902739-50902761 GTGGAGACACAGAATGCAAAGGG + Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138982298 16:62284267-62284289 ATGGAAACTGAGACTCAGAAAGG - Intergenic
1139663114 16:68435645-68435667 AGGGAGACACAGGCCAAGAAGGG + Intronic
1140032642 16:71350794-71350816 AAGCAGACACTGACTGAGATGGG - Intergenic
1140455309 16:75101951-75101973 AGGGTGACACAAACTGAGAAGGG - Intronic
1140810725 16:78574761-78574783 ATAGAAACAGAGAGTGAGAATGG + Intronic
1140985940 16:80158011-80158033 ATGGAGACAGGGACTGAGCCAGG + Intergenic
1141008832 16:80377837-80377859 ATGGAAACACAGAAAGGGAAGGG + Intergenic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143520673 17:7442569-7442591 AAGGAGACAAAGACCCAGAAAGG - Intronic
1143592548 17:7894346-7894368 ATGGAGAGAGAGAGGGAGAAGGG - Intronic
1143914893 17:10283413-10283435 AGAGAGAGACAGACAGAGAAAGG + Intergenic
1144132407 17:12259664-12259686 AGGAAGTCACAGACTGGGAAGGG + Intergenic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1145095941 17:20026473-20026495 ATGGGGTCACAGAATTAGAAGGG - Intronic
1145158132 17:20556418-20556440 ATGGAGAGAGAGACAGAGACAGG + Intergenic
1147253635 17:39168362-39168384 ATAAAGACCCAGACTGGGAATGG - Intergenic
1147451169 17:40505412-40505434 GTGAAGACACAGACTGAGACTGG - Intergenic
1148001556 17:44390520-44390542 ATGGAAACACACACTAAGGATGG + Intergenic
1148005704 17:44427723-44427745 ATGAAGCCACATACTAAGAATGG + Intronic
1148769712 17:50059902-50059924 AGGGAGAGAGAGAATGAGAAAGG - Intronic
1150361109 17:64534921-64534943 AGGGACACGGAGACTGAGAATGG - Intronic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1151439916 17:74121716-74121738 AGGGAGACAGAGAATGAGACAGG + Intergenic
1151814719 17:76466173-76466195 ATGGAGCCACAGTCTATGAAGGG + Exonic
1152990314 18:357785-357807 ATGGGGATACATTCTGAGAATGG + Intronic
1155484946 18:26331409-26331431 ATGGAGATACAAACTTAAAAGGG - Intronic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1156509223 18:37621504-37621526 ATGGATACATAGACGGAGAATGG - Intergenic
1157489663 18:48113927-48113949 ATGGAGACACAGAGTGAATGGGG - Intronic
1157616548 18:48990853-48990875 ATGGTGACACATACCGAGCATGG - Intergenic
1157655262 18:49380746-49380768 ATGAAGAGACAGGCTCAGAAAGG + Intronic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158933280 18:62341813-62341835 GAGGAGACTCAGGCTGAGAATGG + Intronic
1159026547 18:63187673-63187695 ATGGAGACAGAGGCTTGGAATGG + Intronic
1159396096 18:67858398-67858420 ATGAAGACAGAGACAGAGATTGG + Intergenic
1159548732 18:69872803-69872825 ATGGATACAGATTCTGAGAAGGG - Intronic
1159856476 18:73595773-73595795 ATGAAGACGCAGGCTGAGACTGG + Intergenic
1160468955 18:79109208-79109230 ATGTAGAGAAAGACTCAGAATGG - Intronic
1160957674 19:1701075-1701097 ACAGAGACACAGACAGAGAGAGG - Intergenic
1161347254 19:3774579-3774601 ACAGAGACAGAGACAGAGAAAGG + Intergenic
1161657296 19:5524110-5524132 AGAGAGACAAAGACAGAGAAGGG - Intergenic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1162028201 19:7905942-7905964 ATGGGGACACACACAGAGCATGG - Intronic
1162066872 19:8131295-8131317 ATGGAGGGACAGAGTGAGACGGG + Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162721125 19:12663650-12663672 ATGGTGCCACACACTCAGAAGGG - Intronic
1163183097 19:15617825-15617847 ATGCCCACACAGACTGGGAAGGG + Intronic
1163238991 19:16047519-16047541 AGGGAGACACAGAGAGAGAGAGG - Intergenic
1163501445 19:17678822-17678844 ATGCTGACAGAGGCTGAGAAAGG + Intronic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1164336798 19:24331495-24331517 ATTGAGGCACAGAGTGAAAAAGG + Intergenic
1164445077 19:28310040-28310062 AAGGAGACATGGACTCAGAAAGG - Intergenic
1165001191 19:32763840-32763862 ATGGACAGAGAGACTCAGAATGG - Intronic
1165068505 19:33242048-33242070 ATACAGACCCAGACTGAGGACGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166157115 19:40922043-40922065 AGGGAGACAGAAACTGAGACTGG - Intergenic
1166187809 19:41153143-41153165 TCTGAGACACTGACTGAGAAGGG + Intergenic
1166198106 19:41219656-41219678 AGGGAGAGAAAGACTGAGAGAGG + Intronic
1166305626 19:41935572-41935594 ATGGAGAGACAGACGGACATCGG + Intergenic
1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG + Intronic
1166763675 19:45239857-45239879 GTGGAGAAACAGGCTGAGAGGGG + Intronic
1166880687 19:45928212-45928234 ATGCAGACACGGACAGAGACAGG + Intergenic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167475941 19:49701044-49701066 ACGGAGACACAGAGAGAGAGGGG - Intronic
1167631291 19:50627805-50627827 ATGGAGAGAGAAAATGAGAAGGG + Intronic
1167640744 19:50679988-50680010 ATGGAGAGACAGAGAGACAATGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167890937 19:52538713-52538735 ATGGAGAGAGAAAGTGAGAAAGG + Intronic
1168115810 19:54220957-54220979 AGGGAGAGACAGACAGAGACAGG - Intronic
1168118790 19:54240705-54240727 AGGGAGAGACAGACAGAGACAGG - Intronic
1168121615 19:54255157-54255179 AGGGAGAGACAGACAGAGACAGG - Intronic
1168133737 19:54337272-54337294 AGGGAGAGACAGACAGAGACAGG - Intronic
1168172141 19:54596039-54596061 AGGGAGAGACAGACAGAGACAGG + Intronic
1168176859 19:54632864-54632886 AGGGAGAGACAGACAGAGACAGG + Intronic
1168185678 19:54698049-54698071 AGGGAGAGACAGACAGAGACAGG + Intronic
1168187648 19:54709955-54709977 ACGGAGAGACAGACAGAGACAGG + Intergenic
1168276795 19:55283451-55283473 AGGGAGACAGAGACAGAGAGGGG - Intronic
1168307670 19:55444196-55444218 AGGGAGATACAGGCTGAGAAAGG + Intergenic
1168456663 19:56516791-56516813 CTGAAGACACAAACTGAAAATGG + Intronic
925562675 2:5214677-5214699 TTAGAGACACAGGGTGAGAATGG - Intergenic
926310038 2:11668743-11668765 ATGGAGACAGACACTTCGAAAGG + Intronic
926446189 2:12945880-12945902 AGGGAGACACAGAGAGAGAGAGG - Intergenic
926728014 2:16013628-16013650 ATTCAGACAGAGACTGAGAGAGG + Intergenic
926942451 2:18152611-18152633 ATGCAAACACAGAAAGAGAAAGG - Intronic
927095893 2:19747375-19747397 ACAGAGACAGAGACAGAGAAGGG + Intergenic
927316846 2:21693243-21693265 ATGGAGCCAAAGTCTGATAAGGG - Intergenic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
930352057 2:50269093-50269115 ATGGGGAAACAGACTTAGACAGG + Intronic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931400251 2:61925001-61925023 ATGGAGAGACAGACGGTCAAGGG + Intronic
932336128 2:70932464-70932486 ATGGATCGACAGACAGAGAATGG - Intronic
932822079 2:74909989-74910011 ATCGAGAAAAAGAGTGAGAAAGG - Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933992783 2:87645663-87645685 ATGGAGACAGAGGCAGAGATTGG + Intergenic
934502815 2:94872904-94872926 ATGGAGACACTGACAGTGCACGG + Intronic
934522780 2:95030431-95030453 ACGGAGACAGAGACAGAGAGTGG - Intronic
934612844 2:95753586-95753608 AAGGAGAGACAGACAGAGAGGGG + Intergenic
934616763 2:95776165-95776187 ATGGAGAGACAAAATGGGAATGG - Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934644127 2:96048395-96048417 ATGGAGAGACAAAATGGGAATGG + Intergenic
934648064 2:96070836-96070858 AAGGAGAGACAGACAGAGAGGGG - Intergenic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
934841438 2:97626659-97626681 AAGGAGAGACAGACAGAGAGGGG - Intergenic
934960771 2:98670717-98670739 AGGAAGACAGAGACAGAGAAAGG - Intronic
935028618 2:99301422-99301444 AAGGAGAGAGAGAGTGAGAAGGG + Intronic
935029369 2:99307083-99307105 AAGGAGAGAGAGAGTGAGAAGGG - Intronic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
935902621 2:107808726-107808748 ATGTAAACACAGACTCAAAAGGG - Intergenic
936301073 2:111305216-111305238 ATGGAGACAGAGGCAGAGATTGG - Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
936703705 2:115044301-115044323 AAGGAGAAACAGAGAGAGAAGGG + Intronic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
938590562 2:132732057-132732079 ATAGAGAGACAGAGAGAGAAGGG + Intronic
939273915 2:139975050-139975072 ATGCAGACAAAGACACAGAAAGG + Intergenic
939719964 2:145636187-145636209 ATGAGGACACATTCTGAGAAAGG - Intergenic
940015091 2:149095910-149095932 ATGCACACACAGACAGAGAGAGG + Intronic
940828890 2:158445408-158445430 ATTGTGATTCAGACTGAGAAAGG - Intronic
941894101 2:170612257-170612279 ATGCAGACACACACTAGGAATGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942377719 2:175354438-175354460 GTGGTGACACAAACTGAGACGGG - Intergenic
942819207 2:180091268-180091290 ATGGGGATACATTCTGAGAAAGG - Intergenic
943338502 2:186647641-186647663 ATGTAAAAAGAGACTGAGAAAGG + Intronic
943458183 2:188134692-188134714 AAGGAGAAAGAGACTGAGAGAGG + Intergenic
943465696 2:188226636-188226658 GTGAAGACACAGAATGAAAATGG + Intergenic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944377985 2:199070567-199070589 AAGGAGACCCAGACTCAGAGAGG - Intergenic
944755501 2:202757332-202757354 TTGGGGACACGGACTGGGAACGG - Exonic
945580263 2:211585646-211585668 ATATAGACACTGACTTAGAATGG + Intronic
946123317 2:217536241-217536263 AAAGAAACAGAGACTGAGAAAGG - Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946669546 2:222088205-222088227 ATGCACACACAGATTGAGAGAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
948087114 2:235260279-235260301 ATAGATACACAGACTGTCAAAGG - Intergenic
948255670 2:236566883-236566905 AGGGAGAGACAGAGAGAGAAAGG - Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
1168855142 20:1002640-1002662 AAGGAGGAACAGACAGAGAAAGG - Intergenic
1168862414 20:1055287-1055309 ATGGTGACAGGGACTGAGAAAGG - Intergenic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169603989 20:7294596-7294618 AAGGAGATACAAACTGAGCAGGG - Intergenic
1170771529 20:19337009-19337031 ATGAAGAAACAGACTCAGAGAGG - Intronic
1170793904 20:19530174-19530196 ATGGAGACACAGCATGAAAGGGG + Intronic
1170815571 20:19711071-19711093 ATGCAGACACACACAGACAAAGG + Intronic
1171896685 20:30815194-30815216 ATAGAGAGAGAGACAGAGAAGGG + Intergenic
1172190580 20:33059771-33059793 AGGGAGGCAGAGGCTGAGAAGGG + Intronic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1173173135 20:40743343-40743365 GTGGGGACACAGTCTCAGAAAGG - Intergenic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1173970814 20:47150787-47150809 AAGGAGGCAGAGACAGAGAAGGG + Intronic
1174060813 20:47831630-47831652 CTGGACACACAGACAGAGAGGGG - Intergenic
1174071085 20:47899740-47899762 CTGGACACACAGACAGAGAGGGG + Intergenic
1174103989 20:48149102-48149124 AGGGAGACACAGACACAGAGGGG - Intergenic
1174231409 20:49048123-49048145 AGAGAGACACACACAGAGAAAGG - Intronic
1174897432 20:54465699-54465721 ATGGAGAAAGAGACTAAAAAGGG + Intergenic
1175515171 20:59565056-59565078 ATGGAGAGACAGACAGACAGAGG + Intergenic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176065875 20:63194458-63194480 AAGGAAACACAAAATGAGAACGG - Intergenic
1176121239 20:63455512-63455534 ATGCAGTCACAGACTGAGCATGG + Intronic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1176667050 21:9697297-9697319 GTGGCAACACAGGCTGAGAATGG + Intergenic
1177294452 21:19156609-19156631 AAGGAGAGACAGAGAGAGAATGG + Intergenic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179046232 21:37847808-37847830 ATAGAGACAGAGAATGAGACTGG + Intronic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1180080509 21:45485671-45485693 GTGGAGACCCAGACCTAGAAGGG + Intronic
1181427074 22:22850695-22850717 AGGGTGACACAGATTGGGAAGGG - Intronic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182103738 22:27674447-27674469 ATGGAAACACAGACAGAGCCAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182509516 22:30809001-30809023 GTGAAGACACAGACAGAGAGGGG + Intronic
1183004744 22:34891774-34891796 ATGGGCACACAGACTGAGGGTGG - Intergenic
1183306551 22:37086045-37086067 AGGAAGACAGAGACTGCGAATGG + Intronic
1183543523 22:38443479-38443501 GAGGAGTCACAGACTGAGATGGG - Intronic
1183701533 22:39453932-39453954 AAGGAGACACCGCCTGAGATTGG + Intergenic
1184014148 22:41772943-41772965 AGGAAGACCCAGGCTGAGAAAGG - Intronic
1184074019 22:42164728-42164750 ATGGAGACAAGGATTTAGAAAGG + Intronic
1184485190 22:44774060-44774082 ATGGAGACACGGGTTGAGACAGG + Intronic
1184641003 22:45870056-45870078 CTGGAGAAAGAGACTGACAAAGG - Intergenic
1184801706 22:46764741-46764763 ATGGAGACAGAAACAGAGATTGG + Intronic
1184848223 22:47102150-47102172 AAGGCGCCAGAGACTGAGAAAGG - Intronic
1184933797 22:47703519-47703541 ATGGAGACTCAGGCTGTGCATGG - Intergenic
1203239286 22_KI270732v1_random:40417-40439 ATGGAGGCAAAGACAGAGAGAGG - Intergenic
949109304 3:239389-239411 AGGGACAGACAGACTGAAAACGG - Intronic
949875287 3:8622718-8622740 GTGCAGACAGAGACAGAGAAGGG + Intronic
950135697 3:10579370-10579392 ACTTAGAAACAGACTGAGAAGGG + Intronic
950458591 3:13107481-13107503 ATGGAGAAACAGGCTCAGAGCGG + Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
952577830 3:34795833-34795855 ATGGAGACTCAGGCTTGGAAAGG - Intergenic
953114849 3:39982283-39982305 TTGCTGACACAGACTGTGAAAGG - Intronic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
954901360 3:54022695-54022717 AAGGAGACAGAGAGAGAGAAGGG + Intergenic
955208328 3:56917638-56917660 ATGGGGACAAAGTCTGAGAAGGG + Intronic
956498621 3:69856521-69856543 ATGGAATCACACAGTGAGAAGGG - Intronic
956995463 3:74822453-74822475 ATGGAGACCAAAAATGAGAAGGG - Intergenic
958168422 3:89907255-89907277 AGAGAGAGACAGATTGAGAAAGG - Intergenic
959584473 3:108013376-108013398 AAGGAAAGACAGACAGAGAAGGG + Intergenic
959840217 3:110966588-110966610 ATAGAGAGAAAGACTGAGAAGGG + Intergenic
961070636 3:123921538-123921560 AGGGAGAGACAGACTGAGTGGGG + Intronic
961328765 3:126126904-126126926 ATGGAGAGACAGACTCACAGTGG + Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
962132873 3:132701235-132701257 GAGAAGACACAGAATGAGAAAGG - Intronic
963049263 3:141127714-141127736 ATGGAGACACAGGCTGGAGAAGG + Intronic
964162470 3:153662109-153662131 ATGGAGCTACAGAGTGGGAATGG - Intergenic
964837341 3:160954111-160954133 ATGAAGAAACAGACTCAGAGAGG - Intronic
964936759 3:162098617-162098639 ATGGAGACCGAGTCTGAGGAGGG + Intergenic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968717658 4:2173527-2173549 ATAGACACAGAGACTGGGAAGGG - Intronic
969706063 4:8792444-8792466 ATGGACACACACACAGAGGAAGG + Intergenic
969829809 4:9786159-9786181 ATGGAGACCCAGCCTGAGCTGGG + Intronic
969974392 4:11083183-11083205 GAGGAGACAGAGACTCAGAATGG + Intergenic
970235888 4:13957638-13957660 AGGAAGACAGAGACAGAGAAAGG - Intergenic
970249602 4:14100316-14100338 ATGGAGACAAAGAGTGAGCAAGG + Intergenic
970581481 4:17477695-17477717 ATGCAGACTGGGACTGAGAAGGG + Intronic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971658771 4:29385035-29385057 ATGAAGACAGAGACAGAGATTGG - Intergenic
971700923 4:29974238-29974260 ATGAAGACACAGTGTAAGAAAGG - Intergenic
972926347 4:44013827-44013849 ATGGGGCCACAAACTGAGGATGG + Intergenic
973054430 4:45637472-45637494 ATGTAGACAGAGACAGAGATTGG + Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973847119 4:54924183-54924205 ATGAAGACAGAGACAGAGATTGG - Intergenic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
975176726 4:71298024-71298046 ATGGAAACAGAGCCTCAGAAAGG - Intronic
975251703 4:72187051-72187073 AGGGAGACATAGAAAGAGAACGG - Intergenic
975334631 4:73161749-73161771 ACAGAGACACAGAAAGAGAAGGG + Intronic
975879190 4:78882816-78882838 ATGAAGCCACAGAATGATAATGG + Intronic
978481273 4:109193539-109193561 GAAGAGACAGAGACTGAGAAAGG + Intronic
979132365 4:117063329-117063351 GGGGAGAGACAGAGTGAGAAGGG - Intergenic
979375323 4:119939706-119939728 ATGAAAACAGAGGCTGAGAAAGG + Intergenic
979383552 4:120036830-120036852 ATGGACACCCACAGTGAGAAGGG - Intergenic
979622189 4:122811132-122811154 AGGGAGACTGAGACTGAGACTGG - Intergenic
980278985 4:130693502-130693524 ATGGAGAGACCCATTGAGAAGGG - Intergenic
980402241 4:132306299-132306321 AGGGAGAGAAAGAGTGAGAAAGG + Intergenic
981058714 4:140395945-140395967 ATGAAGACACGGATGGAGAATGG - Exonic
982373157 4:154656640-154656662 AAGGAGACAAAGTCGGAGAAAGG - Intronic
982408668 4:155047812-155047834 TAGGAGCCACAGTCTGAGAATGG + Intergenic
982528931 4:156513809-156513831 TTGGAGATCCAGGCTGAGAAAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
985407963 4:189655040-189655062 GTGGCAACACAGGCTGAGAATGG - Intergenic
985605751 5:857318-857340 ATGGAGTCCCAGTCTGAGAAGGG - Intronic
985821377 5:2163178-2163200 ATGAGAACACAGTCTGAGAACGG - Intergenic
986157413 5:5190521-5190543 ATTGAGATACAGAGAGAGAAGGG - Intronic
986585133 5:9308553-9308575 CTGGAAACACAGTCTGAGATAGG - Intronic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
987266148 5:16257087-16257109 ATGGAGAGAGAGAGAGAGAAGGG + Intergenic
988261536 5:28892551-28892573 ATGGAGACACAGACGGGAAAGGG + Intergenic
990130370 5:52574755-52574777 ATAGAGAGACAGAGAGAGAAAGG - Intergenic
990517912 5:56547747-56547769 ACAGAGACAGAGACAGAGAAAGG + Intronic
990656614 5:57963693-57963715 ATGGAGACACAGAAAGGTAAAGG - Intergenic
990804291 5:59640876-59640898 ATGGAGTTACAGAATGATAATGG - Intronic
990878580 5:60516402-60516424 ATGGAGAGCCAGACAGAGACAGG - Intronic
990884892 5:60580099-60580121 AAGGAGACAGAGACAGAGTAAGG + Intergenic
990998401 5:61757018-61757040 ATGGTGCCAGAGTCTGAGAAGGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992625792 5:78634809-78634831 ATGGGAACACAGCCTGTGAAAGG - Intronic
992712716 5:79476485-79476507 CTGGAGACCCAGACTGGCAACGG - Intronic
993189349 5:84661525-84661547 ATGTAGAAACAGGCTCAGAAAGG + Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
994114391 5:96045906-96045928 ATGGAGACAGAAAGTGACAAGGG + Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995543872 5:113210518-113210540 ATTGAGAAAGGGACTGAGAATGG + Intronic
996058719 5:119009237-119009259 ATGCTGACTCAGACTGAGGATGG + Intergenic
997225190 5:132204535-132204557 ATGGTGGCACAGTCTGAAAATGG - Intronic
997908646 5:137845913-137845935 ATGGAGAAGCTGTCTGAGAAAGG + Intergenic
998131359 5:139652994-139653016 ACGGAGATACAGAAAGAGAAAGG - Intronic
998231110 5:140361980-140362002 AAGGAGACACAGAATATGAAAGG - Intronic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000315551 5:160087084-160087106 ATGGAGACACTGGCCGAGCACGG + Intronic
1000928516 5:167223352-167223374 ATAGATACAGAGACTGAGAAGGG - Intergenic
1002139179 5:177128382-177128404 ATGGAGACACAGGCTTGGAGAGG + Intergenic
1002147654 5:177197917-177197939 ATGGAGACAGAGACAGAGAAGGG + Intronic
1002561482 5:180085017-180085039 TTGGGGACAAAGACTGTGAAAGG - Intergenic
1003431996 6:6047492-6047514 ATGGAGAGACTAAATGAGAAGGG + Intergenic
1003524499 6:6886502-6886524 GTGTAGACACAGACAGAGATGGG - Intergenic
1006145170 6:31954649-31954671 ATCGAGACAGAGACAGAGAGCGG - Exonic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006538810 6:34722581-34722603 ATGGAGACACAGACTCAAAGAGG + Intergenic
1006841242 6:37029134-37029156 ATGAAGACACCGACTCAGAGAGG + Intergenic
1006915337 6:37590283-37590305 AGAGAGACAAAGACTGGGAACGG + Intergenic
1007053441 6:38857003-38857025 AGGGAGACAGAAAATGAGAAGGG - Intronic
1007509195 6:42362522-42362544 ATGGAGGGACAAACTGAGAATGG + Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007701413 6:43768595-43768617 GTGGAGGCATGGACTGAGAATGG - Intergenic
1008184960 6:48377345-48377367 AGAGAGACAGAGACAGAGAAAGG + Intergenic
1008899783 6:56597917-56597939 ATGTTGACAAAGACTCAGAAAGG - Exonic
1008921738 6:56850098-56850120 ATGGAGACTGAGAGTGAGCAGGG - Intronic
1009347916 6:62639554-62639576 ATGGAGACTCAGACCGTGTAGGG - Intergenic
1009499056 6:64388449-64388471 ATGGAAAAACAGACTGACATTGG + Intronic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010082609 6:71881714-71881736 GTGGAGACACAGGCAGAAAATGG - Intergenic
1011172620 6:84522724-84522746 AGGGAGAAAGAGCCTGAGAATGG - Intergenic
1012097793 6:94986561-94986583 ATCGAGAGACAGAACGAGAAAGG + Intergenic
1012265712 6:97139453-97139475 ATGTTGACATACACTGAGAAGGG - Exonic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013632888 6:112002064-112002086 TTGGAGAGGCAGACCGAGAATGG + Intergenic
1014675700 6:124362522-124362544 ATGGAGACAGAGAATAAGAAAGG - Intronic
1015474841 6:133648948-133648970 ATGGGGACTAAGACTCAGAAAGG - Intergenic
1015788702 6:136944841-136944863 AGAGAGAGAGAGACTGAGAAGGG - Intergenic
1016064280 6:139662854-139662876 CTTGAGACACAGAATTAGAAGGG + Intergenic
1016871599 6:148823024-148823046 ATGTGGACACACACTGAGAGTGG + Intronic
1018157572 6:161001754-161001776 ATGCGGAAACAGACTGAGAGAGG - Intronic
1018243769 6:161802704-161802726 ATGGAGACAAAGACTAAAACAGG - Intronic
1018279478 6:162170147-162170169 ATGGAGACAGAGAGTAAGAAAGG - Intronic
1018650191 6:165986558-165986580 AAGGAGAGAGAGACTGAGAGAGG - Intronic
1019013806 6:168864935-168864957 ATGGAGAAAGAGACAGAGAGAGG + Intergenic
1019362318 7:611266-611288 ATGGAGAGAGAGACAGAGAGAGG - Intronic
1019512325 7:1423941-1423963 AGGGAGAGACAGACTGAGCTGGG + Intergenic
1019653007 7:2170790-2170812 AAGGCGACACAGGCTGAGAAGGG + Intronic
1020448622 7:8297102-8297124 GTGGAGACCGAGACTGGGAATGG - Intergenic
1021314503 7:19130597-19130619 TTGAAGACACATTCTGAGAATGG - Intergenic
1021345271 7:19519714-19519736 ATTGAGACACAGAGGAAGAAAGG + Intergenic
1021489778 7:21207016-21207038 GTGGAGACACATCATGAGAAGGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021556494 7:21923932-21923954 ATGGAGACTCAGGCTGACAAAGG - Intronic
1021820361 7:24492121-24492143 ATGCAGACATAGCCTGAAAAAGG - Intergenic
1022231618 7:28419420-28419442 ATGCAGACAGAGACTGCAAATGG - Intronic
1022520162 7:31000984-31001006 ATTCAGACACAGACAGACAAAGG + Intergenic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1023090957 7:36616956-36616978 ATGGAGACACGGAGATAGAAAGG + Intronic
1023635369 7:42204199-42204221 ATGGAGGCAGAGAATGTGAATGG - Intronic
1023795658 7:43789799-43789821 ATGGAGACTCAGGGTGGGAAAGG - Intronic
1024644043 7:51356484-51356506 ATGGAGACAAAGCCAGAGCAGGG - Intergenic
1024711589 7:52021013-52021035 ATAGAGACAGAGACAGAGAGAGG + Intergenic
1024734459 7:52289379-52289401 ATGAAGGCACAGACTGGGAGAGG - Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1025248981 7:57338991-57339013 ATGGAGAGAAAGACAGAGACAGG - Intergenic
1026111844 7:67464718-67464740 AAGGCAACACAGAGTGAGAAGGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026513046 7:71043412-71043434 ATGGAGACACTGAGTGATTAAGG + Intergenic
1027122459 7:75531708-75531730 GGGGAGACACAGATTGGGAAAGG - Intergenic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1028003469 7:85531400-85531422 ATGAAGACAGAGGCTGAGACTGG - Intergenic
1028336047 7:89656720-89656742 AGGAAGATACAGACTGGGAAGGG + Intergenic
1028538868 7:91920551-91920573 AAGGAGAATCAGACTGGGAATGG + Intergenic
1028563026 7:92196420-92196442 ATAGAGACACAGAGAGAGATAGG - Intergenic
1029088821 7:98032360-98032382 ATGGACACACAGGCTGGCAAAGG - Intergenic
1030671662 7:112344976-112344998 ATGGAGACAATGAATGATAATGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032080366 7:128855529-128855551 AGGCAGACACACCCTGAGAAAGG - Intronic
1032697569 7:134350533-134350555 TTGGAGACAGAGACAGACAATGG + Intergenic
1033459092 7:141529222-141529244 ATGGAGACACAGACACACGAGGG - Intergenic
1033684580 7:143626674-143626696 AGGGAGACAGAGACTGACCATGG - Intronic
1033687756 7:143705893-143705915 AGGGAGACAGAGACTGACCATGG - Intronic
1033700031 7:143830949-143830971 AGGGAGACAGAGACTGACCATGG + Intergenic
1033761276 7:144439086-144439108 AGGGAGACAGAGCTTGAGAAAGG + Intergenic
1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG + Intronic
1034872842 7:154699072-154699094 AAGCAGACACTGTCTGAGAAGGG + Intronic
1035111240 7:156483768-156483790 GGGGAGAGACACACTGAGAAGGG + Intergenic
1035638646 8:1165266-1165288 AGGGAGACAGAGACAGAGATGGG + Intergenic
1036010568 8:4717290-4717312 ATGGAGAGAGAGAGAGAGAAGGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1037785639 8:21901478-21901500 ATGGAGGCACAGACAGGGCATGG - Intergenic
1038333249 8:26626431-26626453 ATGGAGACACAGAATGGTAAAGG - Intronic
1038413683 8:27377587-27377609 AAGGAGACACTGGCTCAGAAAGG - Intronic
1038416560 8:27400703-27400725 ATTGAGATCCAGACAGAGAAAGG + Intronic
1038848874 8:31255040-31255062 AGGAAGACACAGTTTGAGAAAGG - Intergenic
1039020531 8:33199915-33199937 ATAGAAATAGAGACTGAGAAGGG + Intergenic
1039109623 8:34027641-34027663 ATGGAGAGACAGACTGGTGAGGG - Intergenic
1039942797 8:42105592-42105614 AGGGAGATACAAAATGAGAAGGG + Intergenic
1039971194 8:42323068-42323090 ATGAAGACAGAGACAGAGACTGG - Intronic
1039975666 8:42362755-42362777 ATGAAGTCACACACTCAGAATGG - Intronic
1040311074 8:46237164-46237186 ATGGAGCCACAGACTGTCATGGG + Intergenic
1041192800 8:55370284-55370306 AAGGTGACAAAGGCTGAGAATGG + Intronic
1041389213 8:57334149-57334171 AAGGAAGCACAGACGGAGAATGG - Intergenic
1041626258 8:60030773-60030795 ATGTAGGCCCAGACTGGGAAGGG + Intergenic
1041717417 8:60944694-60944716 ATGGAGGGAGAGACTCAGAAAGG + Intergenic
1041741148 8:61158311-61158333 CTGGAGGAACAGACTGGGAAGGG + Intronic
1042171938 8:66000092-66000114 AAGGAGACACAGACAGAGGGAGG - Intergenic
1043264208 8:78242562-78242584 ATGCAGATACAGCCTGAGAGGGG - Intergenic
1043969004 8:86509462-86509484 GTGGAAACACAGACTGCAAAGGG + Intronic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1044746676 8:95377618-95377640 ATGGAGACAGAGACGAAGACTGG - Intergenic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1046245336 8:111552827-111552849 ATTGAGAGAGACACTGAGAAGGG - Intergenic
1046638161 8:116695734-116695756 GTGGAGTCAGAGACTGAGCAAGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046918088 8:119698875-119698897 ATGGAGAGACAGAAACAGAAGGG - Intergenic
1047019563 8:120760525-120760547 CTGGAGACCCAGCCTGAGAGAGG + Intronic
1047120648 8:121900550-121900572 ATCCAGTCAGAGACTGAGAAGGG - Intergenic
1047601548 8:126430571-126430593 TTGGAGACACAGTCTGATCAAGG - Intergenic
1047843436 8:128779424-128779446 AGGTAGACACAGACTGATAATGG - Intergenic
1048115059 8:131511700-131511722 ATGAAGACAAAGAAAGAGAAAGG + Intergenic
1048386041 8:133913395-133913417 ATGGAGCCACAGACTGAAGTTGG - Intergenic
1048509458 8:135049165-135049187 ATGGAGACACAGAGTTAGTCTGG - Intergenic
1048928326 8:139290746-139290768 CTGGAGACACTGTCTCAGAAAGG + Intergenic
1049251855 8:141593445-141593467 ATGGAGGTACAGGCTGGGAAGGG + Intergenic
1049790384 8:144469721-144469743 GTGGACACCCAGACTGGGAAGGG - Intronic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050800033 9:9599284-9599306 AGGGAGACTCAGCCTTAGAAAGG + Intronic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052566303 9:30156869-30156891 ATAGAGACACAGACATACAAAGG + Intergenic
1052709526 9:32036652-32036674 GAGGAGACACAGAATGAGACAGG + Intergenic
1053556119 9:39138676-39138698 AGGAAGACCCAGACAGAGAAGGG - Intronic
1054110513 9:61102615-61102637 AGGAAGACCCAGACAGAGAAGGG - Intergenic
1054610344 9:67228510-67228532 AGGAAGACCCAGACAGAGAAGGG + Intergenic
1055577257 9:77672281-77672303 ATGGAGCCGAATACTGAGAATGG + Intergenic
1056151350 9:83792742-83792764 AGGGAGACAGAGACAGAGACTGG + Intronic
1057741848 9:97718924-97718946 ATTGAGACCCAGACTGGGAAAGG - Intergenic
1057851544 9:98570545-98570567 ATGGAGACAGAGCATGGGAAAGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058935235 9:109763822-109763844 ATGGAGACAGAGGCAGAGATTGG - Intronic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059672790 9:116507347-116507369 ATGGAGAAACAGGCACAGAAGGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1059955866 9:119515413-119515435 GTGGAGACAGAGAGAGAGAAAGG + Intronic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1061022007 9:128022008-128022030 ATAGAGACAGAGACTAAGCACGG - Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061485551 9:130918838-130918860 AGAGAGAAACAGACTCAGAAAGG - Intronic
1061746417 9:132743398-132743420 ATGGAGACTGACTCTGAGAAAGG - Intronic
1062666910 9:137678829-137678851 ATGGACACAGGGACAGAGAAAGG + Intronic
1062701456 9:137907081-137907103 ATGGATACACACACAGCGAAAGG - Intronic
1203659046 Un_KI270753v1:24465-24487 GTGGCAACACAGGCTGAGAATGG - Intergenic
1185677109 X:1857984-1858006 ATGGAGACAGAGGCAGAGACTGG - Intergenic
1185735442 X:2492328-2492350 ATGGAGACAGAGGCCGAGACTGG + Intronic
1185856011 X:3535947-3535969 AGGCAGAGACAGACAGAGAAGGG - Intergenic
1185867401 X:3636255-3636277 GTGCAGACACAGGCTGCGAAGGG + Intronic
1185873359 X:3682613-3682635 AAGGAGACACAGACGCAGAGGGG + Intronic
1185918514 X:4063160-4063182 GTGGAGACAGAGACAGAGACTGG + Intergenic
1185948706 X:4406435-4406457 ATGGAGAGAGAGAATGAGAGAGG + Intergenic
1186162687 X:6794159-6794181 ATGGGGACACACTCTGAGAAAGG + Intergenic
1187768447 X:22668926-22668948 ATGGAGAAATAAACTGAGCAAGG - Intergenic
1187919517 X:24187308-24187330 AGAGAGACACAGAGAGAGAAAGG - Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188368415 X:29338714-29338736 ATGGAGAGACAGACAGAGACAGG - Intronic
1188486043 X:30683554-30683576 ATGAAGGTAAAGACTGAGAAGGG + Intronic
1189510999 X:41661331-41661353 AAGGAGACAGAGACAGAGTAGGG + Intronic
1189867768 X:45349260-45349282 ATGGAAACACAGAATCAAAAAGG - Intergenic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190930972 X:54949567-54949589 ATGGAGAGATAGACTGTGCATGG - Intronic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1192317950 X:70066724-70066746 AGGGAGGCACAGACTAGGAAAGG + Intergenic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1192528488 X:71867742-71867764 AGGGAGACACAGAGAGAGTATGG + Intergenic
1193218303 X:78891576-78891598 ATGGAGACTTAGAATGATAAGGG + Intergenic
1194416691 X:93621177-93621199 ATGGGGATACAGACTCAGATAGG + Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195173869 X:102296199-102296221 GTGGAGACAGAGACAGAGACTGG + Intergenic
1195184996 X:102390894-102390916 GTGGAGACAGAGACAGAGACTGG - Intronic
1196746915 X:119079438-119079460 ATGAAGAGAAAGACAGAGAAAGG + Exonic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198209665 X:134505376-134505398 AGGAAGACCCAGACAGAGAAGGG - Intronic
1199118466 X:144021166-144021188 GTGAAGACAGAGACTGAGATTGG - Intergenic
1199319853 X:146425529-146425551 ATGGAGAAAGAGAGTGAGATAGG + Intergenic
1200375692 X:155777418-155777440 ATTTAGAAACACACTGAGAAAGG - Exonic
1201239511 Y:11945163-11945185 ATGGAGACAGAGGCAGAGACTGG + Intergenic
1201906707 Y:19092907-19092929 ATGGAGACAAAGACAGAGACTGG - Intergenic