ID: 1118640102

View in Genome Browser
Species Human (GRCh38)
Location 14:67784259-67784281
Sequence ATATAGCCAAGGGCTCAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118640102_1118640112 22 Left 1118640102 14:67784259-67784281 CCGCACTGAGCCCTTGGCTATAT 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1118640112 14:67784304-67784326 ATGGCTGACTTGCATGGAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 156
1118640102_1118640110 19 Left 1118640102 14:67784259-67784281 CCGCACTGAGCCCTTGGCTATAT 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1118640110 14:67784301-67784323 CCCATGGCTGACTTGCATGGAGG 0: 1
1: 0
2: 2
3: 13
4: 113
1118640102_1118640108 16 Left 1118640102 14:67784259-67784281 CCGCACTGAGCCCTTGGCTATAT 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1118640108 14:67784298-67784320 AGGCCCATGGCTGACTTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 150
1118640102_1118640106 3 Left 1118640102 14:67784259-67784281 CCGCACTGAGCCCTTGGCTATAT 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1118640106 14:67784285-67784307 TGAAATCATCCGAAGGCCCATGG 0: 1
1: 0
2: 0
3: 11
4: 82
1118640102_1118640105 -4 Left 1118640102 14:67784259-67784281 CCGCACTGAGCCCTTGGCTATAT 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1118640105 14:67784278-67784300 ATATTGATGAAATCATCCGAAGG 0: 1
1: 0
2: 0
3: 14
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118640102 Original CRISPR ATATAGCCAAGGGCTCAGTG CGG (reversed) Intronic
900188806 1:1344813-1344835 TTAGAGACAAGGGCTCACTGTGG - Intronic
901227315 1:7621242-7621264 AGAGAGCCAAGGGCTCTGGGAGG + Intronic
903562279 1:24236949-24236971 ATCTAGCACAGGGCTCAGAGTGG - Intergenic
903812517 1:26042723-26042745 ACAAAGCCAAGGGCTCACTGAGG + Intronic
906022539 1:42642844-42642866 ACACAGCCAAGTCCTCAGTGAGG - Intronic
908786360 1:67738434-67738456 ATATAGACCAAAGCTCAGTGAGG - Intronic
910856343 1:91699490-91699512 ATATCCCCAAGGGCTCAGACTGG + Intronic
911112051 1:94199501-94199523 AGATAGCCAAGGGCACAGCTAGG + Intronic
912349099 1:108994451-108994473 ATATAGCAAAAGGCTGGGTGTGG + Intronic
913600518 1:120417303-120417325 ATATAGAAAAGAGCTGAGTGTGG - Intergenic
915498868 1:156300720-156300742 AGGTACCAAAGGGCTCAGTGTGG + Intergenic
916167349 1:161975945-161975967 ACGTCGCCAAGGTCTCAGTGAGG - Intergenic
921701562 1:218274338-218274360 ATAGTACAAAGGGCTCAGTGTGG + Intergenic
921987419 1:221327271-221327293 GTGTAACAAAGGGCTCAGTGTGG - Intergenic
1063151412 10:3339897-3339919 CCATAGCCAAGGGCTCTGGGCGG + Intergenic
1063829784 10:9939690-9939712 ATATAGCAAAAGAATCAGTGGGG - Intergenic
1065559469 10:26947644-26947666 ATAGAGCCAAATTCTCAGTGAGG + Intergenic
1066682184 10:37945044-37945066 AGATAGCAAAGGGCTCAGCCTGG + Intergenic
1068838779 10:61587096-61587118 ATATAGCCAAGGGCTCAATCAGG + Intergenic
1070343931 10:75523518-75523540 ATATAGCCAGGAGCTATGTGGGG + Intronic
1071211421 10:83346034-83346056 ATACAGTCAAGGGCTCAGGAGGG - Intergenic
1071293656 10:84204214-84204236 GTAGAGGCAAGGGCTGAGTGTGG + Intronic
1075443464 10:122497598-122497620 ATAAAGCTCAGGGCTCAGGGAGG - Intronic
1075579962 10:123610034-123610056 TTTGAGCCAAGGGCTGAGTGAGG + Intergenic
1076202220 10:128567832-128567854 AATTAGACAAGGGCTAAGTGTGG - Intergenic
1076459926 10:130635196-130635218 ATATAGACAGGTGATCAGTGGGG - Intergenic
1077431014 11:2516005-2516027 ATAGGCCCAGGGGCTCAGTGAGG - Intronic
1079239408 11:18712052-18712074 AGATAGCCTGGTGCTCAGTGGGG - Intronic
1079969265 11:27016892-27016914 AGATAGCAAAGGGCTCAGCCAGG + Intergenic
1086246292 11:84757151-84757173 ATTCATCCAAGGACTCAGTGTGG + Intronic
1088788663 11:113204842-113204864 ATGGAGCCCAGGGCTCAGTGGGG + Intronic
1090450107 11:126798572-126798594 ATTTAGCCTGGAGCTCAGTGGGG + Intronic
1090842162 11:130499710-130499732 AAATTGCCAGAGGCTCAGTGTGG - Intergenic
1092304244 12:7283127-7283149 ATGTAGCCTAGGGTTTAGTGTGG - Intergenic
1096575947 12:52552954-52552976 AGGGAGCAAAGGGCTCAGTGGGG - Exonic
1097174239 12:57133662-57133684 ATATAGCTAAGGGAACAGAGTGG - Intronic
1099792112 12:87349344-87349366 ATACATCCCAGGCCTCAGTGAGG - Intergenic
1100881609 12:99024732-99024754 AGATAGCAAAGGACTCAGTTAGG + Intronic
1101402441 12:104400305-104400327 ATCAAGCCAAGGGCTGAGGGCGG + Intergenic
1101414845 12:104499891-104499913 AGCCAGCCCAGGGCTCAGTGGGG + Intronic
1102168211 12:110822680-110822702 CTATAGCAAGGGGCTCAGGGAGG - Intergenic
1103164723 12:118760717-118760739 ATATTGCCAGAGGCTCAGGGGGG - Intergenic
1104196613 12:126545964-126545986 ATAATGCCAAGTGCTTAGTGAGG + Intergenic
1104662568 12:130621606-130621628 ATATAGCCGTGGGCTCAGAGAGG - Intronic
1104836874 12:131797426-131797448 ACATAGGCAAGGACTCAGGGAGG - Intronic
1108418287 13:50223134-50223156 AAGTAGCCCAGTGCTCAGTGAGG - Intronic
1110814789 13:79849256-79849278 TTATAGCCAATGGCTCATAGAGG + Intergenic
1117028947 14:51650811-51650833 CTTTAGCGAAGGGCTCAGTGAGG + Intronic
1118640102 14:67784259-67784281 ATATAGCCAAGGGCTCAGTGCGG - Intronic
1119756909 14:77125863-77125885 AGATAGCCAAGGGTAGAGTGTGG + Intronic
1120883002 14:89429026-89429048 ATGTCTCCAAGGGCTCAGTGAGG + Intronic
1122645742 14:103192527-103192549 ATAGGGCCAAAGGCTCAGAGAGG + Intergenic
1122806171 14:104259755-104259777 AAATTGCCAGAGGCTCAGTGTGG + Intergenic
1126866907 15:52946725-52946747 ATAAAGCCAAGGCCTAAGTGTGG - Intergenic
1127217020 15:56834045-56834067 ATAAAACCCAAGGCTCAGTGAGG + Intronic
1128644640 15:69367478-69367500 ACATAGCTAAGTGGTCAGTGAGG + Intronic
1128647026 15:69385068-69385090 ATTTAGCCACTGGCTCTGTGGGG + Intronic
1130813387 15:87405605-87405627 AAATAGCAAAGGGCTCAGCCAGG + Intergenic
1133593033 16:7264730-7264752 ATATAGCCAAGAGCTAAGAATGG - Intronic
1135276919 16:21121148-21121170 ATATAGGGAAGGGATCTGTGGGG - Intronic
1137513649 16:49123889-49123911 AAAGAGCCCAGGGCTCACTGAGG + Intergenic
1138404510 16:56778925-56778947 AAAGGGCCAAGGTCTCAGTGAGG + Intronic
1139301242 16:65947154-65947176 ATATAGCCAGGGAGTGAGTGGGG - Intergenic
1141561894 16:84874526-84874548 TTCTAGTCAAGGGCACAGTGTGG - Intronic
1142567077 17:847331-847353 ATTTGGCCCAGGGCTCAGTGGGG - Intronic
1143236966 17:5411057-5411079 GTATAGCTAAGGGCTCAGGACGG - Intronic
1144738418 17:17567751-17567773 CTAGAGCCAAGGTCTCAGTCAGG + Intronic
1144755108 17:17675336-17675358 ATATTGCCTAGAGCTAAGTGGGG + Intergenic
1147761930 17:42803989-42804011 AAATAGCCAAGTGCGAAGTGTGG - Intronic
1148089187 17:45012772-45012794 ATATAACTGAGGGCTCACTGTGG + Intergenic
1148389426 17:47260130-47260152 ATATAGAAAAAAGCTCAGTGTGG + Intronic
1149606233 17:57927082-57927104 ATGTAATTAAGGGCTCAGTGGGG + Intronic
1149611788 17:57962721-57962743 GTAAAGCCCAGGGCTCAGTTCGG + Intergenic
1152997421 18:420817-420839 AGATAGCCAAGGGCCCAGAAAGG + Intronic
1153300982 18:3591834-3591856 ACAAAGGCAAGGGCTCAGAGAGG + Intronic
1155556236 18:27021995-27022017 TTATAAACAAGAGCTCAGTGAGG + Intronic
1156550507 18:38011547-38011569 ATACAGTCAAGGCCCCAGTGGGG - Intergenic
1157202033 18:45667789-45667811 AAGTAGGCAAGTGCTCAGTGTGG - Intronic
1157985676 18:52435352-52435374 AAATAGAGAAGGGCTAAGTGGGG - Intronic
1163166969 19:15505264-15505286 CCACAGCCCAGGGCTCAGTGGGG - Intergenic
1165203343 19:34163223-34163245 ATATGGCCAAAGGCTGGGTGTGG + Intergenic
1166666016 19:44680915-44680937 AAGTAGCCTAGGACTCAGTGAGG - Intronic
1168583407 19:57574106-57574128 AGATAGCAAAGGGCTCAGCAAGG + Intronic
928738654 2:34323377-34323399 TTAAATCCAAAGGCTCAGTGAGG - Intergenic
932083560 2:68737547-68737569 ATATAGCCAAGTGTTCCTTGGGG + Intronic
932773311 2:74513591-74513613 ATCCAACCAAGGCCTCAGTGAGG + Intronic
932788774 2:74633535-74633557 ATATAGCCAAGGAGCCTGTGGGG - Intronic
933117177 2:78489105-78489127 ATATAATCAAGGACTCAGTCAGG - Intergenic
933914781 2:86978680-86978702 ATATAGTAAAGGGCTGGGTGTGG - Intronic
934008213 2:87791220-87791242 ATATAGTAAAGGGCTGGGTGTGG + Intronic
935386940 2:102509683-102509705 ATCTAGAGCAGGGCTCAGTGAGG + Intronic
935771851 2:106432160-106432182 ATATAGTAAAGGGCTGGGTGCGG + Intronic
935908219 2:107863781-107863803 ATATAGTAAAGGGCTGGGTGCGG - Intronic
937952595 2:127400382-127400404 ATATAGCCAGGGGCCAAGAGGGG + Intergenic
938791512 2:134680576-134680598 ATATCCCCAAGGGCTCATTATGG + Intronic
941268057 2:163388624-163388646 ATATAGCCAAGGGGTAAAAGGGG + Intergenic
941382877 2:164817069-164817091 AAATATCCATAGGCTCAGTGGGG + Intronic
946467181 2:219922337-219922359 ATATAGCCAAAGCTTTAGTGTGG + Intergenic
1175726223 20:61320546-61320568 ATATTGCCAAGTGCTCTCTGGGG - Intronic
1175949762 20:62577062-62577084 ATCCAGCCCAGGGCTCACTGAGG - Intergenic
1180744134 22:18075567-18075589 ATTTGGCAGAGGGCTCAGTGTGG - Intergenic
1181569928 22:23763044-23763066 CTGTGGCCCAGGGCTCAGTGGGG + Exonic
1184551059 22:45204336-45204358 GTGTGGCCAAAGGCTCAGTGTGG + Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
949762366 3:7485116-7485138 TTATAGTCAAGGTGTCAGTGAGG - Intronic
950361569 3:12453058-12453080 AGGCAGCCAAGAGCTCAGTGGGG - Intergenic
950460568 3:13119909-13119931 AGATTGCCCAGGGCTGAGTGAGG - Intergenic
953149688 3:40313528-40313550 ATATAGGCAAGGGCTCATTAGGG - Intergenic
953957803 3:47244995-47245017 ATATGGCCCAAGGCTCAGGGTGG + Intronic
957668433 3:83268085-83268107 CTATGGCCAAGGACTCAGTGTGG - Intergenic
959300043 3:104587492-104587514 AAATAGCCGAAGGCTCACTGTGG + Intergenic
963605300 3:147407883-147407905 ATATAGTCAATGGCTCTTTGTGG + Intronic
964063604 3:152555489-152555511 GGATAGACAAGGGCTCAGTCAGG + Intergenic
964170144 3:153760086-153760108 ATACATCCAAGGGCCCAGTGTGG - Intergenic
964637686 3:158875361-158875383 ATATAGAAAAGTGTTCAGTGAGG - Intergenic
967332247 3:188302348-188302370 ATATAGCTAAGGTTTCATTGTGG - Intronic
968978562 4:3834624-3834646 ATAAAGCCACGGGGTCGGTGGGG - Intergenic
978207914 4:106102110-106102132 TTAAAGCCAAAGGCTCAGAGAGG - Intronic
982308127 4:153954964-153954986 ATATAGGGAATAGCTCAGTGGGG + Intergenic
988332627 5:29862181-29862203 AAATTGCCAAAGGCTAAGTGTGG + Intergenic
991404561 5:66289314-66289336 ACATAGCCAATTGCTCTGTGTGG + Intergenic
998463021 5:142323495-142323517 ATATTGCCAAGGCCTCTGTGAGG - Intronic
998623012 5:143815284-143815306 CTATAGTCAAGGTGTCAGTGGGG + Intronic
999120691 5:149207191-149207213 ATGTAGGCATGGGCTCAATGGGG - Intronic
1004498466 6:16186966-16186988 AGATTCCCAAGGGCACAGTGGGG + Intergenic
1004531466 6:16458908-16458930 AACTTGCCCAGGGCTCAGTGAGG - Intronic
1004784747 6:18955154-18955176 ATACAGACAGAGGCTCAGTGTGG - Intergenic
1007292570 6:40798567-40798589 ATGTTGCCAAGGGCAGAGTGAGG + Intergenic
1007679334 6:43623690-43623712 ATATAGGTGAGGGCTGAGTGGGG + Intronic
1018667925 6:166156438-166156460 AGATGGACAAGGGTTCAGTGAGG + Intergenic
1021613636 7:22481046-22481068 ATACATCCAAAGGCTCTGTGAGG + Intronic
1029805183 7:102988586-102988608 ATGTAGCCAAGAACACAGTGGGG + Intronic
1030514683 7:110525029-110525051 ATACAAACAAGAGCTCAGTGGGG - Intergenic
1031064196 7:117086888-117086910 ATAAAGCCAAGGGCTTATTTTGG + Intronic
1032496525 7:132367259-132367281 ATCTAGGCAAGGGATCTGTGTGG - Intronic
1033443308 7:141399190-141399212 ATAAAGGCAAGGTCTGAGTGGGG - Intronic
1037356987 8:18031019-18031041 AGATAGCAAAGGGCTCAGCCAGG - Intergenic
1046840005 8:118845732-118845754 AGAGAGCCCAGGGCTCAGTAAGG - Intergenic
1047093895 8:121602939-121602961 ATATATCCAAGCCCTCAGTGTGG + Intergenic
1049070345 8:140350842-140350864 ATAAAACCCAGGACTCAGTGTGG - Intronic
1049250033 8:141583283-141583305 AGATATTGAAGGGCTCAGTGAGG - Intergenic
1054950674 9:70847778-70847800 ATATAGACAAGGCCTGTGTGGGG - Intronic
1055804595 9:80078087-80078109 ATTTATCCAAGGGCTCAAAGAGG - Intergenic
1056286616 9:85093541-85093563 AGATAGCAAAGGGCTCAGCCTGG - Intergenic
1057310257 9:93938543-93938565 GAATAGCCAAGAGGTCAGTGTGG + Intergenic
1058957595 9:109963593-109963615 ATAAAGCCCAGGGCCCAGTATGG - Intronic
1060038374 9:120278648-120278670 ATATAGTTAAGGGAACAGTGAGG - Intergenic
1061956275 9:133962842-133962864 ATGGAGCCAAGCGCTCAATGTGG - Intronic
1062351187 9:136139714-136139736 ATAGAGGTAAGGGCTGAGTGCGG + Intergenic
1062470224 9:136699846-136699868 ATATAGGTAAGGGCTGGGTGCGG - Intergenic
1189941895 X:46133010-46133032 AAATAGCAAAGAGGTCAGTGTGG + Intergenic
1190081700 X:47361818-47361840 AGCTAGCCAATGGCTCTGTGTGG - Intergenic
1199757773 X:150881232-150881254 ATAGAGCCAAGGCCACAGAGTGG - Intronic
1200097334 X:153670358-153670380 ATGTGGCCAAGAGCTAAGTGGGG - Intronic
1200776297 Y:7173016-7173038 ATTTACCTGAGGGCTCAGTGAGG - Intergenic