ID: 1118641431

View in Genome Browser
Species Human (GRCh38)
Location 14:67796326-67796348
Sequence CGTGCCTCAGGCTCCCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5332
Summary {0: 1, 1: 0, 2: 115, 3: 1500, 4: 3716}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118641427_1118641431 -1 Left 1118641427 14:67796304-67796326 CCTCCCAGGTTCAAGTGATTCTC 0: 20599
1: 62494
2: 120157
3: 154110
4: 162194
Right 1118641431 14:67796326-67796348 CGTGCCTCAGGCTCCCGAGCTGG 0: 1
1: 0
2: 115
3: 1500
4: 3716
1118641429_1118641431 -5 Left 1118641429 14:67796308-67796330 CCAGGTTCAAGTGATTCTCGTGC 0: 1160
1: 40862
2: 89906
3: 105181
4: 120903
Right 1118641431 14:67796326-67796348 CGTGCCTCAGGCTCCCGAGCTGG 0: 1
1: 0
2: 115
3: 1500
4: 3716
1118641426_1118641431 5 Left 1118641426 14:67796298-67796320 CCTCTGCCTCCCAGGTTCAAGTG 0: 8512
1: 31147
2: 73419
3: 112634
4: 127542
Right 1118641431 14:67796326-67796348 CGTGCCTCAGGCTCCCGAGCTGG 0: 1
1: 0
2: 115
3: 1500
4: 3716
1118641423_1118641431 11 Left 1118641423 14:67796292-67796314 CCCCAACCTCTGCCTCCCAGGTT 0: 2275
1: 6787
2: 11518
3: 11759
4: 10271
Right 1118641431 14:67796326-67796348 CGTGCCTCAGGCTCCCGAGCTGG 0: 1
1: 0
2: 115
3: 1500
4: 3716
1118641424_1118641431 10 Left 1118641424 14:67796293-67796315 CCCAACCTCTGCCTCCCAGGTTC 0: 31
1: 102
2: 180
3: 268
4: 740
Right 1118641431 14:67796326-67796348 CGTGCCTCAGGCTCCCGAGCTGG 0: 1
1: 0
2: 115
3: 1500
4: 3716
1118641425_1118641431 9 Left 1118641425 14:67796294-67796316 CCAACCTCTGCCTCCCAGGTTCA 0: 148
1: 431
2: 871
3: 1305
4: 4869
Right 1118641431 14:67796326-67796348 CGTGCCTCAGGCTCCCGAGCTGG 0: 1
1: 0
2: 115
3: 1500
4: 3716
1118641428_1118641431 -4 Left 1118641428 14:67796307-67796329 CCCAGGTTCAAGTGATTCTCGTG 0: 794
1: 25697
2: 93743
3: 151682
4: 166175
Right 1118641431 14:67796326-67796348 CGTGCCTCAGGCTCCCGAGCTGG 0: 1
1: 0
2: 115
3: 1500
4: 3716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118641431 Original CRISPR CGTGCCTCAGGCTCCCGAGC TGG Intronic