ID: 1118642303

View in Genome Browser
Species Human (GRCh38)
Location 14:67804094-67804116
Sequence AACTCACCAGGCTCTTGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118642296_1118642303 -6 Left 1118642296 14:67804077-67804099 CCAGGTCATTCCATCCCAACTCA 0: 1
1: 0
2: 2
3: 16
4: 186
Right 1118642303 14:67804094-67804116 AACTCACCAGGCTCTTGCTGGGG 0: 1
1: 0
2: 2
3: 12
4: 157
1118642293_1118642303 12 Left 1118642293 14:67804059-67804081 CCTAAGAGGAAATCCTGGCCAGG 0: 1
1: 0
2: 2
3: 17
4: 210
Right 1118642303 14:67804094-67804116 AACTCACCAGGCTCTTGCTGGGG 0: 1
1: 0
2: 2
3: 12
4: 157
1118642295_1118642303 -1 Left 1118642295 14:67804072-67804094 CCTGGCCAGGTCATTCCATCCCA 0: 1
1: 0
2: 2
3: 44
4: 480
Right 1118642303 14:67804094-67804116 AACTCACCAGGCTCTTGCTGGGG 0: 1
1: 0
2: 2
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118642303 Original CRISPR AACTCACCAGGCTCTTGCTG GGG Exonic
905694290 1:39963371-39963393 GACCCACCAGGCTCCAGCTGTGG + Intronic
908937063 1:69388859-69388881 AAATCACCAGGCTCTTTCACTGG + Intergenic
909100106 1:71339762-71339784 AACTGAGCAGTCTCTTGATGGGG - Intergenic
915319010 1:155045977-155045999 CACTCACCAGCTTCTTCCTGCGG - Exonic
915854873 1:159372536-159372558 AACTCTCCAGCCTTCTGCTGAGG - Intergenic
916016193 1:160751655-160751677 GACTCACAATGCTCATGCTGTGG + Intronic
916758658 1:167797249-167797271 GACACACCAGGCTCTTGGAGAGG + Intergenic
917148136 1:171914651-171914673 AACTCACCAGTAATTTGCTGGGG - Intronic
917638327 1:176958424-176958446 GAATCACAAAGCTCTTGCTGAGG + Exonic
918072372 1:181142333-181142355 AACTCACGGGGCCCTTGTTGCGG - Intergenic
919983616 1:202657935-202657957 AAGTCACCAGCCCCTTCCTGGGG + Intronic
920066597 1:203273783-203273805 ATCTCACCAGGCTTTTGGTTTGG - Intergenic
922662242 1:227440165-227440187 AAATAACCAGGCTCTTGAGGTGG - Intergenic
923505601 1:234603197-234603219 AACAAACCAGACTCTTGATGTGG - Intergenic
1064928654 10:20598771-20598793 ATCCCACCAGGCTCTTGCACCGG + Intergenic
1067950727 10:50735670-50735692 AATTCACCAGGCTATGGTTGTGG - Intergenic
1068764153 10:60744728-60744750 AACTCATCATGCTCTTGCAAAGG - Intergenic
1069858127 10:71452957-71452979 CACCCACCAAGCACTTGCTGAGG - Intronic
1070886075 10:79900879-79900901 AATTCACCAGGCTATGGTTGTGG - Intergenic
1072269892 10:93766135-93766157 ACCTTACCAGGCTCTCCCTGTGG + Intronic
1076003148 10:126928249-126928271 ATCTCCCTGGGCTCTTGCTGTGG + Intronic
1078154620 11:8788593-8788615 CACACACCAGGCTCTCCCTGAGG + Intronic
1078932174 11:15921109-15921131 CACTAATCAGGCTATTGCTGTGG - Intergenic
1083045290 11:59729066-59729088 CACAGACCAGGCACTTGCTGTGG - Intronic
1083163620 11:60870489-60870511 AAGGGACCAGGATCTTGCTGGGG - Intronic
1084241882 11:67826885-67826907 GCCTCTCCATGCTCTTGCTGTGG - Intergenic
1084913665 11:72411608-72411630 AACTCCCCAGGCTCTGTTTGTGG + Intronic
1089918345 11:122181865-122181887 AACTCAAATGACTCTTGCTGTGG - Intergenic
1089989676 11:122847561-122847583 ATCTCACTAGGCTCCTGTTGAGG - Intronic
1091276720 11:134357760-134357782 AATTCACCAGCCTCTCTCTGAGG + Intronic
1093266988 12:17015636-17015658 CACTCTCCAGGCTGGTGCTGGGG + Intergenic
1094273894 12:28646500-28646522 AACTGACTAGGCTGTTGGTGGGG - Intergenic
1100444759 12:94650346-94650368 CGCTCACCCGGCTCTTGCAGCGG + Exonic
1102813401 12:115843215-115843237 GACTCACCAGGTGCATGCTGAGG - Intergenic
1103459978 12:121096053-121096075 GACTCCCCAGGCTCTTGCGTGGG - Intergenic
1103891489 12:124242344-124242366 GACTCACCAGGTCCTGGCTGGGG - Intronic
1108360554 13:49664854-49664876 AACACACAAGGCACATGCTGAGG + Intronic
1113711444 13:112467734-112467756 TACGCACCAGGCACTTCCTGCGG - Intergenic
1114652156 14:24292083-24292105 CACTCACCAGGTGCTTACTGTGG - Intronic
1114925980 14:27399550-27399572 AACTCACCATGCTTTTCTTGTGG + Intergenic
1118609290 14:67527682-67527704 ACTTCACCAGGGTCATGCTGGGG - Intronic
1118642303 14:67804094-67804116 AACTCACCAGGCTCTTGCTGGGG + Exonic
1119513401 14:75229315-75229337 AACTCAGCAGGGTATGGCTGTGG + Intergenic
1120481798 14:85058648-85058670 AACTTACCAGGAGATTGCTGAGG + Intergenic
1121009028 14:90509148-90509170 ACTGCACCAGGGTCTTGCTGAGG - Intergenic
1123124824 14:105938559-105938581 GACTCACCAGGCTGTTTCTGAGG - Intergenic
1126700933 15:51367087-51367109 ACCTGTCCAGGATCTTGCTGTGG + Intronic
1130014058 15:80173912-80173934 ATCTCACCACGCATTTGCTGGGG + Intronic
1130912619 15:88281507-88281529 AACACACCAGTCACTAGCTGGGG + Intergenic
1131374123 15:91909602-91909624 AACTGAGCAGGCTCTTCCTGGGG - Intronic
1137585724 16:49663319-49663341 AACTCACCAGCCTCTTCCTGAGG + Intronic
1138073848 16:54021100-54021122 AACTCACCAAGCTCCTGCACAGG - Intronic
1138621926 16:58218373-58218395 AATTCTCCAGTCTCCTGCTGAGG - Intergenic
1141895538 16:86956568-86956590 TCCCCACAAGGCTCTTGCTGAGG - Intergenic
1142678536 17:1531244-1531266 GACTCCCCTGTCTCTTGCTGTGG - Intronic
1144439759 17:15271153-15271175 GTCTGACCATGCTCTTGCTGTGG - Intergenic
1146668298 17:34719619-34719641 AACTCACCAGGCTCATGCCGGGG - Intergenic
1149601786 17:57898191-57898213 GACTCACCTGCCTCCTGCTGGGG + Intronic
1149850297 17:60030022-60030044 ACCTCAGCAGGCTCTTGTTTCGG - Intergenic
1149859869 17:60116502-60116524 ACCTCAGCAGGCTCTTGTTTCGG + Intergenic
1150567222 17:66352292-66352314 AACTCATCAGTGTCTTCCTGAGG + Intronic
1151751283 17:76039689-76039711 AGCTAACCAGGCTCTTCCTCGGG - Exonic
1151768578 17:76145135-76145157 AAGTCTCCAGCATCTTGCTGAGG + Exonic
1151942888 17:77303861-77303883 ACCTCGCCAGGCCCTTGCTGTGG - Intronic
1153787242 18:8545864-8545886 CTCTCACCAGGCACTTCCTGTGG - Intergenic
1154297405 18:13162749-13162771 CCCTCACCAGGCTGCTGCTGTGG - Intergenic
1155797200 18:30054841-30054863 GTCTTCCCAGGCTCTTGCTGTGG - Intergenic
1156213966 18:34977488-34977510 GACCCTCCAGGCTCTAGCTGGGG + Intronic
1163004383 19:14388531-14388553 CCCTCCCCAGGCTCTGGCTGTGG - Intronic
1163063080 19:14774203-14774225 CCCTCCCCAGGCTCTGGCTGTGG + Intronic
1163156715 19:15443652-15443674 AAATCACCTGGCTCTTTCTTGGG + Intronic
1163796425 19:19340858-19340880 AACTTACCATCCCCTTGCTGAGG - Exonic
1164864064 19:31589351-31589373 ATCTCACCTGGCTTTTGCCGAGG + Intergenic
1165139299 19:33689376-33689398 GACTCACCTGGCACCTGCTGGGG - Exonic
1165250673 19:34531397-34531419 AACTCACCAGCCTCTTGCCAGGG - Intergenic
1165454683 19:35903762-35903784 CACTCTCCAGGCTCTTGTTCCGG + Exonic
1166062462 19:40335092-40335114 CACTTACCAAGCACTTGCTGTGG - Intronic
1167952446 19:53038072-53038094 AACTCAGCAGGATCTCCCTGGGG + Intergenic
1168439167 19:56348639-56348661 AGCTCTCCATGCTCATGCTGGGG + Intronic
927415741 2:22878762-22878784 ACATAACCATGCTCTTGCTGTGG - Intergenic
927430977 2:23025916-23025938 AAGTCCCCAGGCTCTGGCTGGGG + Intergenic
930173954 2:48282063-48282085 AACCCACCATGTTCTTGATGGGG + Intergenic
932124681 2:69133054-69133076 AACTCACCAGGCCCATGAAGTGG - Intronic
933776071 2:85772046-85772068 ACGGCACCAGGCACTTGCTGGGG - Intronic
936152048 2:110027394-110027416 TGCCCACCAGGCTCTTTCTGTGG - Intergenic
936192630 2:110344019-110344041 TGCCCACCAGGCTCTTTCTGTGG + Intergenic
941373582 2:164699398-164699420 AACTCACCATTCTCTTGGTTTGG + Exonic
946040442 2:216778645-216778667 ATCTCCCCAGGCTCTTGCAGGGG - Intergenic
948137893 2:235650564-235650586 AACTCTGCAGTCTCATGCTGTGG + Intronic
1168868735 20:1110766-1110788 ATCTCTCCAGCCTCTAGCTGAGG - Intergenic
1170511191 20:17078535-17078557 AACTCATCAGGGTCTTAGTGAGG - Intergenic
1171189934 20:23151544-23151566 AACTTACCCGCCCCTTGCTGGGG + Intergenic
1172330240 20:34070787-34070809 GCCTCACCAGGCACTCGCTGTGG - Intronic
1172336610 20:34122139-34122161 AAGTCAACTGGCTATTGCTGAGG - Intergenic
1172389877 20:34559248-34559270 GACTCACCGGGATTTTGCTGGGG - Exonic
1173039767 20:39451295-39451317 AACACATCATGCTTTTGCTGGGG + Intergenic
1178018123 21:28375854-28375876 AACACTCCAGGCTGGTGCTGGGG + Intergenic
1178405114 21:32317193-32317215 CACTCACCAGGCTCCTGACGTGG - Intronic
1179087807 21:38235655-38235677 TACTCACTGAGCTCTTGCTGTGG - Intronic
1180148725 21:45936658-45936680 AAGCCACCAGGCTTTTCCTGTGG + Intronic
1181025148 22:20123587-20123609 CCCTCACCAGGATCTTCCTGGGG + Intronic
1182569914 22:31229288-31229310 AAATTACCAGGCTCTATCTGAGG - Intronic
1182666748 22:31965677-31965699 AACTCACCTGGCTGTTGCGTGGG + Intergenic
1184234121 22:43174029-43174051 ACCTCTCCAGGTTTTTGCTGGGG - Intronic
1184632482 22:45794061-45794083 AAGTCATCAGGTTGTTGCTGTGG + Intronic
1184681568 22:46074959-46074981 AAAGCACCACGCTGTTGCTGCGG - Intronic
1185125718 22:49009635-49009657 AATTCACCAGTCCCTTGCCGGGG - Intergenic
950092421 3:10305218-10305240 AACCCAACAGGCTCTGCCTGGGG + Intronic
952002139 3:28798251-28798273 AACTCACTAGGCTTCTGCTCAGG - Intergenic
954403508 3:50332043-50332065 AACTCACCAAGCTCATGAAGAGG + Exonic
957163613 3:76642005-76642027 AACTAACCAGGCTAGTGCAGTGG - Intronic
957893353 3:86388039-86388061 AACTCACCACGTTCTTTTTGTGG - Intergenic
960016840 3:112900543-112900565 AACTCACCAGTCTCTTGCCTTGG - Intergenic
962019981 3:131489642-131489664 AAATAGCCAGGCTCTTGCTTAGG - Intronic
962262934 3:133926570-133926592 CACTCACCACGCTCTGCCTGAGG + Intergenic
962995203 3:140620513-140620535 AACTCACCAAGTTTTTGATGTGG - Intergenic
963101444 3:141609909-141609931 TAATCATCAGGCTCTTTCTGTGG - Exonic
967301346 3:188017203-188017225 AAGACAGCAGGCTTTTGCTGAGG + Intergenic
967767564 3:193297741-193297763 GGCTCAACAGGCTATTGCTGTGG + Intronic
969155403 4:5205556-5205578 GTCTCCCCAGGCTCTGGCTGTGG + Intronic
969840450 4:9877855-9877877 ATCTCACCAGGCTCCTGTTGGGG + Intronic
970015344 4:11506520-11506542 AAATCACCAGCCTCTTGCCATGG + Intergenic
970040155 4:11787216-11787238 ACCTCACCAGGCACCTGCAGAGG - Intergenic
972962177 4:44466945-44466967 AACTCTCCAGGATATTGGTGTGG + Intergenic
978902246 4:113965913-113965935 AACACACCAGGTTCTTGCACAGG - Intronic
979078732 4:116307436-116307458 ATCTCACCAGGTTCTCCCTGTGG + Intergenic
981814146 4:148809340-148809362 GACACACCAGGCTATTGATGGGG + Intergenic
983100611 4:163621850-163621872 GACTCACCAGGATATTTCTGGGG + Intronic
985147268 4:186906136-186906158 CACTGACGAGGCTCATGCTGGGG - Intergenic
986539509 5:8828953-8828975 AACACTCCAGGCTGGTGCTGGGG - Intergenic
991299956 5:65120557-65120579 TACTCCCCTGGCTCCTGCTGGGG - Intergenic
991398969 5:66234246-66234268 AACTCTCCAGCCTGGTGCTGTGG + Intergenic
994245619 5:97472067-97472089 AACTCCTCAGGGTCTTTCTGGGG + Intergenic
994311274 5:98274170-98274192 AACTCTCCAGGATATTGGTGCGG + Intergenic
997870412 5:137501024-137501046 AACTCAACAGGTTAGTGCTGGGG - Intronic
998770936 5:145544545-145544567 ATCTCACCAGGATCTAGCTTAGG + Intronic
1004293136 6:14386490-14386512 AACTCACCAGGATGGTGGTGGGG + Intergenic
1006937368 6:37727891-37727913 ACCTCGCCAGCCTCCTGCTGTGG + Intergenic
1012191728 6:96287896-96287918 CACACTCCAGGCTGTTGCTGGGG - Intergenic
1014962978 6:127710440-127710462 GACTCAACAGGCTTTGGCTGTGG + Intronic
1015831117 6:137370012-137370034 AGCTCACCAGTTTCTTGCTTCGG - Intergenic
1017811457 6:157986679-157986701 ATCTTACCAGGCTCTTGTTTTGG + Intronic
1018783415 6:167089823-167089845 ATCACACCAGCCTCTTGGTGTGG + Intergenic
1020505573 7:8983019-8983041 AACTAAGAAGGCTTTTGCTGAGG + Intergenic
1022289260 7:28985502-28985524 AAATCACCAAGCTCTCCCTGGGG + Intergenic
1022702600 7:32775782-32775804 AAATCACCAGGCTCTTCCTAAGG + Intergenic
1022906828 7:34865909-34865931 AAATCACCAGGCTCTTCCTAAGG + Intronic
1023173150 7:37409510-37409532 AACTCAACTGGGGCTTGCTGGGG + Intronic
1029106230 7:98178817-98178839 AACTCACAAGGCTGTTGCAAGGG - Intronic
1030648118 7:112087076-112087098 AGCTCACCAGGCTAGGGCTGTGG + Intronic
1032266650 7:130374382-130374404 CCCTTACCAGGCTCTTGCTCTGG + Intergenic
1032422688 7:131795471-131795493 AAATCACCAGGCCCTTCCTCGGG - Intergenic
1036752647 8:11453038-11453060 AAGTCCCCAGGCTCAGGCTGAGG - Intronic
1037951719 8:23022998-23023020 AACTCACCTGGCTGTCTCTGTGG - Intronic
1041787032 8:61646812-61646834 AACTCATCATCCTCTTGTTGTGG + Exonic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1046728647 8:117701272-117701294 AACTGTCCAGGCACTTGCTGTGG - Intergenic
1048091360 8:131243942-131243964 ATCCCACCAAGCTCCTGCTGTGG - Intergenic
1048493299 8:134914208-134914230 ACCACTCCAGTCTCTTGCTGTGG + Intergenic
1053535208 9:38918870-38918892 AATTCAGCAGGCACATGCTGTGG + Intergenic
1054207430 9:62143274-62143296 AATTCAGCAGGCACATGCTGTGG + Intergenic
1054630923 9:67445080-67445102 AATTCAGCAGGCACATGCTGTGG - Intergenic
1056319990 9:85426911-85426933 GACCCCTCAGGCTCTTGCTGTGG + Intergenic
1061359833 9:130134031-130134053 AACTCAACAGGCTCTTTCCAAGG - Intronic
1062171769 9:135138677-135138699 AAGTCACCATGGTGTTGCTGTGG - Intergenic
1203782890 EBV:110714-110736 AATCCACCAGGATGTTGCTGGGG + Intergenic
1187274771 X:17807610-17807632 AGGTCACCAGGCTCTTGTTTCGG + Intronic
1188342340 X:29019499-29019521 AACTCCCAAGGTTCTTGCTTTGG + Intronic
1190589120 X:51979697-51979719 AAATCACCAAGTACTTGCTGTGG - Intergenic
1192860042 X:75058009-75058031 AAATCTCCAGACTCTTGCTAAGG + Intronic
1194431905 X:93818592-93818614 AACTCTCCAGGATATTGGTGTGG + Intergenic
1199768404 X:150957578-150957600 AACACACCAGGCACTTGCAGAGG - Intergenic