ID: 1118644207

View in Genome Browser
Species Human (GRCh38)
Location 14:67821096-67821118
Sequence GACACTGATCTGACTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118644207 Original CRISPR GACACTGATCTGACTTTTGC AGG Intronic
900704456 1:4071493-4071515 GACATTAATTTGACTTTTTCTGG + Intergenic
901909815 1:12447302-12447324 GATACTTAGCAGACTTTTGCTGG + Intronic
903741515 1:25561152-25561174 GATAGTGATCTGACTTGGGCTGG + Intronic
905776499 1:40671024-40671046 GAAACTAATGAGACTTTTGCAGG + Intergenic
910591999 1:88935774-88935796 AACACTCATCTGACTTTAGCCGG - Intronic
913704704 1:121407836-121407858 GACACTTTTCTCACTTTTACAGG - Intergenic
914819958 1:151093891-151093913 GAAAGTGATCTGACTTATGATGG - Intronic
915547984 1:156613585-156613607 GACACTCATCTGACTCTCCCAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
924475574 1:244379605-244379627 GACAATGATTTGACATTTGGAGG + Intronic
1062944831 10:1452285-1452307 GACACAGAGCTGATTTTTGTGGG - Intronic
1063961289 10:11307378-11307400 GCCACTGATCTGGCTTCTGCTGG - Intronic
1064842284 10:19607136-19607158 GACACTGATCTGACTTCAATAGG - Intronic
1067223549 10:44361084-44361106 GACACTTCTTTGACTTCTGCTGG - Intergenic
1069678296 10:70265406-70265428 GGCACTGTTCTGACATCTGCAGG + Intronic
1072449254 10:95526365-95526387 GATCCTGATCTAACTTTTGAGGG + Intronic
1073538779 10:104301157-104301179 GAGATTGATCAGCCTTTTGCCGG + Intronic
1075318971 10:121474460-121474482 GACACTTAACTGACGCTTGCTGG - Intergenic
1079402875 11:20119880-20119902 GACAATGATCTGTCTGGTGCAGG + Intronic
1086159231 11:83702689-83702711 GACACTGATCTGTCTCTTCCTGG + Intronic
1091665218 12:2413985-2414007 GGCACTGATTTGAGTTTTGGGGG - Intronic
1092143412 12:6199441-6199463 AGCACTGATCTGACTTCTCCCGG - Intergenic
1095284855 12:40397898-40397920 GATACTGACCTGATTTTTGTCGG - Exonic
1100908058 12:99324199-99324221 GACATTTATCTAAATTTTGCTGG + Intronic
1106837152 13:33646768-33646790 TTCACTGATTTGAATTTTGCAGG - Intergenic
1107835000 13:44405886-44405908 GGCACTGCTCTGACCTTTGAGGG + Intergenic
1108500847 13:51068572-51068594 GACCCTGATCTGGTTTTTGGTGG + Intergenic
1113906785 13:113822995-113823017 GTCACAGATCCGACTTTTCCAGG + Intronic
1115317700 14:32042972-32042994 GAAACTGCTCTGAGTTTTGAAGG + Intergenic
1115348452 14:32367218-32367240 GACACTGATCTATGTTTTGGAGG - Intronic
1116809316 14:49524117-49524139 GACACTAATCTCACTTATGAGGG - Intergenic
1118496420 14:66312142-66312164 GCCACTGATTTGTCATTTGCGGG - Intergenic
1118644207 14:67821096-67821118 GACACTGATCTGACTTTTGCAGG + Intronic
1118746775 14:68779850-68779872 GACACTGAGCTGGCCTTTGGAGG - Intergenic
1119122463 14:72091902-72091924 GTCAATGATCTGACTTATTCTGG - Intronic
1125130169 15:36275321-36275343 GACACTGATCTTTCTTTGGCTGG + Intergenic
1127834688 15:62781306-62781328 GACACAGATCTGGGATTTGCAGG - Intronic
1129424244 15:75453014-75453036 GACGCTGATCTTACTTTGGGGGG + Intronic
1129760624 15:78127364-78127386 GACCCAGACCTGACCTTTGCCGG - Intronic
1133907958 16:10038941-10038963 GACACTGCCCTGATTTTTGAAGG - Intronic
1134254788 16:12602014-12602036 GAGACTCATCTCACTTTTGACGG + Intergenic
1136089577 16:27908852-27908874 GATACTGAGCTGAATCTTGCAGG - Intronic
1137898101 16:52236043-52236065 AACACTGATATGACTTTTAATGG - Intergenic
1138143904 16:54591847-54591869 GACACTGGCCTGACTTTTGAGGG + Intergenic
1140220749 16:73042175-73042197 GGCACTTATATGACTTTTTCAGG + Intronic
1140736997 16:77907312-77907334 GGCACAGAGCTCACTTTTGCTGG + Intronic
1141326435 16:83064003-83064025 TACACTCATCTGACTTTTTCTGG - Intronic
1141788681 16:86218326-86218348 GACATGGATGTGTCTTTTGCAGG - Intergenic
1142733216 17:1877235-1877257 GGTACGGATCTGACTTTTGTTGG - Exonic
1145106594 17:20122965-20122987 GACACTGCTTTGACTTTTTGAGG + Intronic
1150461674 17:65358922-65358944 AACACTGATCTGGATGTTGCAGG - Intergenic
1151062984 17:71118149-71118171 GACACTGAAATGACGTTTCCAGG + Intergenic
1153195783 18:2594599-2594621 GAAAATGAACTGACTTGTGCAGG - Intronic
1157253780 18:46119713-46119735 GACGCTCATCTGAGTTTTGAAGG + Intronic
1157739761 18:50082033-50082055 GGCACTGAACTGACTTTTATGGG - Intronic
1158058825 18:53313792-53313814 GACTCTGTTCTGTCTCTTGCTGG - Intronic
1164767460 19:30782589-30782611 GACACTGGCCTGCCTTTTCCTGG + Intergenic
1167137148 19:47623637-47623659 GACACTGATCTGGCTTTGCAGGG - Intronic
925343084 2:3150142-3150164 GACACTGATCTGATTTTGTGAGG - Intergenic
927856851 2:26533084-26533106 GTCACTGATCTGACATTAGATGG - Intronic
927977185 2:27347808-27347830 GACACTGATCTGACTGGTCAGGG - Intronic
930315523 2:49792609-49792631 GGCACTTATCTTACGTTTGCTGG + Intergenic
934152397 2:89159906-89159928 GAGACTGATCTGGTTTCTGCTGG + Intergenic
934214850 2:90022008-90022030 GAGACTGATCTGGTTTCTGCTGG - Intergenic
935384083 2:102483136-102483158 GACACTGCTGTGACCTCTGCTGG + Intronic
936819207 2:116498342-116498364 GTCAGTGATCTGACTCTTACAGG + Intergenic
937535073 2:122876287-122876309 GACACTGGGATGCCTTTTGCTGG - Intergenic
946132132 2:217614815-217614837 TACACTGTTGTAACTTTTGCAGG - Intronic
946167168 2:217871373-217871395 GACCCTGAACTGATTTTTGTTGG - Intronic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
1173404610 20:42753716-42753738 GACACTGATTTGTCCTCTGCTGG - Intronic
1174897238 20:54462656-54462678 GACACTGATCTGATCTGTGAAGG + Intergenic
1181432328 22:22888932-22888954 GACGCTGCTCTGTCTTTTGGGGG - Intronic
1182972643 22:34592237-34592259 GCCACTGAGCTGTCATTTGCTGG - Intergenic
1183294614 22:37022240-37022262 CAGACTAATCTGACTTTTCCAGG - Intronic
950108510 3:10403660-10403682 GGAACTGCTCTGAGTTTTGCAGG - Intronic
955241654 3:57183290-57183312 GGCACTGATCTGATTTATGAGGG + Intergenic
960913718 3:122676233-122676255 GGCACTAATCTGACTTATGAGGG + Intergenic
965342535 3:167507842-167507864 GACAGACATCTGACATTTGCAGG + Intronic
967317482 3:188162995-188163017 GGCACTCATCCCACTTTTGCGGG - Intronic
968044550 3:195616759-195616781 CACACAAATCTCACTTTTGCAGG - Intergenic
968060338 3:195722810-195722832 CACACAAATCTCACTTTTGCAGG - Intronic
970963019 4:21895657-21895679 GATACTTACCTTACTTTTGCAGG - Intronic
975264329 4:72343772-72343794 AACACTGCTCTACCTTTTGCAGG - Intronic
976364569 4:84218695-84218717 GACACTGTTTTGGCATTTGCAGG + Intergenic
978588101 4:110294367-110294389 AAAACTGATCTCTCTTTTGCAGG - Intergenic
979891551 4:126102658-126102680 GACACTGAACTGAGTTTTGGAGG - Intergenic
987803220 5:22725614-22725636 GACACTAATCTCACTTTTGAGGG + Intronic
988113038 5:26847942-26847964 GACACGGTTTTGATTTTTGCTGG + Intergenic
988344114 5:30014531-30014553 GAGTCTGATCAGACTTTTGTTGG - Intergenic
989974032 5:50560821-50560843 GACACTTTTCTCACTTTTACAGG + Intergenic
992043161 5:72857438-72857460 GACACTGATTTTACATTTGATGG + Intronic
992710712 5:79452175-79452197 GACACTGGTTTGAATTATGCAGG - Intronic
997118464 5:131150605-131150627 AACACTGATCAGTCATTTGCAGG + Intergenic
997308571 5:132859812-132859834 AACACTCATCTGACTTTTGGGGG - Intergenic
1000031560 5:157406387-157406409 GACAGAGATTTGAATTTTGCTGG + Intronic
1000071883 5:157748063-157748085 GACACTGATGTGCCTTTGCCGGG + Intronic
1000389404 5:160707369-160707391 GACAGTGATCTGGCTTTTTAAGG + Intronic
1001896243 5:175383970-175383992 GACACTGCTCTGGCTCTGGCAGG - Intergenic
1002336013 5:178478768-178478790 GACACTGATGGGCCTTTTGAGGG + Intronic
1003038008 6:2661938-2661960 GATACTCATCTGAATTTGGCTGG - Intergenic
1005995208 6:30926647-30926669 GACAGTGCCCTGGCTTTTGCAGG + Intergenic
1017306547 6:152924724-152924746 ATCACTGATTTCACTTTTGCAGG - Intergenic
1017445422 6:154503140-154503162 CACACTTAACTGACTTTTGGTGG - Intronic
1017832221 6:158140792-158140814 GACACTGAGCTGATGTTTGATGG + Intronic
1018104013 6:160466120-160466142 GCCACTGATCTGACAGTTGGTGG + Intergenic
1018300471 6:162397049-162397071 GTCACTCCTATGACTTTTGCTGG + Intronic
1019305265 7:331363-331385 CACAATGATTTTACTTTTGCAGG - Intergenic
1021475140 7:21052330-21052352 GATACTGATCTGTTTTTTGCAGG - Intergenic
1021533967 7:21681560-21681582 TACACTGATTACACTTTTGCTGG + Exonic
1022620872 7:31983540-31983562 GATTCTCATTTGACTTTTGCAGG - Intronic
1027265167 7:76490895-76490917 GATACTGACCTGTCTTTTACTGG + Intronic
1027316538 7:76988998-76989020 GATACTGACCTGTCTTTTACTGG + Intergenic
1028209541 7:88056500-88056522 GACACTGTTTTTCCTTTTGCTGG + Intronic
1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG + Intronic
1039224802 8:35376892-35376914 GAAAAAGATATGACTTTTGCTGG - Intronic
1042789768 8:72591298-72591320 GACACTGATCTGCTTCTTTCAGG + Intronic
1043399730 8:79872083-79872105 TAAACAGATCTGACTTTTTCTGG - Intergenic
1050093045 9:2034788-2034810 GACTCTTATCTGAATTTTGGTGG + Intronic
1050186457 9:2980173-2980195 GACACTCATCTGTCATTTGACGG + Intergenic
1050541664 9:6675575-6675597 GACACAGATCTGAGTGATGCTGG + Intergenic
1051105784 9:13578489-13578511 AACCCTGATCTGACACTTGCAGG + Intergenic
1051597047 9:18834663-18834685 AACACTGATCTGATTTATGTCGG + Intronic
1056315936 9:85389835-85389857 AACACTCATGTGATTTTTGCAGG + Intergenic
1058607269 9:106736268-106736290 TAAACTGACCAGACTTTTGCTGG + Intergenic
1185852523 X:3502355-3502377 GACGCTGAGCTGAGTTTTTCAGG - Intergenic
1187212203 X:17242835-17242857 GACAATGATCTGACTGAGGCTGG - Intergenic
1190081342 X:47359032-47359054 GACACTGAACTGGTGTTTGCTGG - Intergenic
1190369209 X:49725642-49725664 GAGACTGGATTGACTTTTGCGGG + Intergenic
1196222169 X:113124488-113124510 GGCACTGACCTGACTATTGTAGG + Intergenic
1200696946 Y:6369308-6369330 GACAATGAGCTGCCTTGTGCTGG + Intergenic
1200919549 Y:8601142-8601164 GAGACAGATCTGCCTTTTTCTGG - Intergenic
1200921809 Y:8619993-8620015 GAGAATGAGCTGACTTTTGCTGG - Intergenic
1200922902 Y:8628934-8628956 GAGAATGAGCTGACTTGTGCTGG - Intergenic
1200927886 Y:8670931-8670953 GAGAATGACCTGACTTGTGCTGG - Intergenic
1200928973 Y:8679931-8679953 GAGAATGAGCTGCCTTTTGCTGG + Intergenic
1200936890 Y:8746130-8746152 GAGAATGAGTTGACTTTTGCTGG + Intergenic
1201037167 Y:9795391-9795413 GACAATGAGCTGCCTTGTGCTGG - Intergenic
1201385733 Y:13437711-13437733 GACTCTGATCGGGCTTTTGGAGG - Intronic
1202125717 Y:21567294-21567316 GAGAATGAGCTGACTTGTGCTGG - Intergenic
1202153289 Y:21862086-21862108 GAGAATGAGCTGACTTGTGCTGG + Intergenic
1202182086 Y:22148233-22148255 GAGAATGAGCTGACTTTTGCTGG + Intergenic
1202209274 Y:22438169-22438191 GAGAATGAGCTGACTTTTGCTGG - Intergenic