ID: 1118647035

View in Genome Browser
Species Human (GRCh38)
Location 14:67850641-67850663
Sequence TTCCTATTTTACGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118647028_1118647035 19 Left 1118647028 14:67850599-67850621 CCAGGTGATAGGCTAGACTGTGG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1118647035 14:67850641-67850663 TTCCTATTTTACGGGAGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118647035 Original CRISPR TTCCTATTTTACGGGAGTGC TGG Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
909742376 1:79045833-79045855 TCCTTATGATACGGGAGTGCTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912729553 1:112090139-112090161 GTCCTTTGTTACAGGAGTGCTGG - Intergenic
913343328 1:117782023-117782045 TTTCTATTTTTGGGGAGTGGTGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
922901997 1:229144452-229144474 TTCCTATTTCCCAGGAGTTCAGG - Intergenic
924802242 1:247335858-247335880 TCCTTATTTTACTGGAGTGTTGG - Intergenic
1066629770 10:37447750-37447772 GTCCTATTTTACAGGAGAGGTGG - Intergenic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1073698685 10:105899805-105899827 TTCTTATTTTACGTGTATGCAGG - Intergenic
1075834680 10:125443560-125443582 TTCCTGATGTACTGGAGTGCAGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1078785420 11:14486415-14486437 TTCATATTTTACAGCAGGGCTGG + Exonic
1080295869 11:30726746-30726768 TTCCTATTTTACAGGTGTGTAGG - Intergenic
1080734877 11:35003800-35003822 TTCCTTTTTTAAGGGACTGGGGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082928294 11:58574643-58574665 TTCTTATCCTACGTGAGTGCTGG - Intronic
1082993700 11:59232079-59232101 TTCCTATTCCACTTGAGTGCTGG - Intergenic
1084278577 11:68070604-68070626 TTCCTAGTTCACTGAAGTGCAGG - Intronic
1084504915 11:69559488-69559510 TGCCCATTTTAGGGGAGTGTGGG - Intergenic
1093815685 12:23543375-23543397 TTCCTGTTTTCAGGAAGTGCTGG - Exonic
1094762380 12:33549233-33549255 TTCCTATTTTAGGGACGTGTTGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1095995096 12:48075530-48075552 TTCCTATTTTATTTAAGTGCAGG + Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098333716 12:69380731-69380753 TTCCTATTTTCCCTAAGTGCCGG + Intronic
1100037588 12:90272032-90272054 TTTCTATTGTACTGGAGTGATGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1112192496 13:97191588-97191610 TGCCTATTTGATGGAAGTGCAGG + Intergenic
1112212998 13:97399861-97399883 TTTCTATTTTATGAAAGTGCTGG - Intergenic
1118647035 14:67850641-67850663 TTCCTATTTTACGGGAGTGCTGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122616230 14:103019882-103019904 TTCCTATTTAAAGGGAGCACTGG - Intronic
1124580600 15:30951412-30951434 TTCCTATTTTATGGGAAGGGTGG - Intronic
1128745807 15:70113476-70113498 TTCCTCTTTAACTGGAATGCTGG + Intergenic
1129923590 15:79341675-79341697 TTCCTACTTCACTGGAGTGTGGG + Intronic
1134114715 16:11539294-11539316 TTCCTAGTTTACCGAAGAGCTGG + Intergenic
1137297317 16:47107639-47107661 TTCTTACTTTACGGCAATGCTGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146617721 17:34370139-34370161 TTCCTGCTCTACGGGAGTGGGGG - Intergenic
1152188894 17:78876183-78876205 CTCATATTTTAGGGGAGGGCAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164760293 19:30723355-30723377 GACTTATTTTATGGGAGTGCGGG + Intergenic
1168712234 19:58508241-58508263 TTTCTATTTTCCGTAAGTGCTGG - Intronic
928488855 2:31759975-31759997 TTCCTCTTTTAGGGGAGTGGGGG - Intergenic
930903143 2:56532681-56532703 TTCCTATATTAGGAGAGTCCAGG - Intergenic
930974008 2:57432183-57432205 TTACTATTTTACTGCATTGCAGG - Intergenic
938725325 2:134103688-134103710 TTCCTGTTTTCCTGGAGTACAGG + Intergenic
942528139 2:176878264-176878286 TTCCTATTTTTCTGGAGTTGGGG - Intergenic
943503145 2:188717446-188717468 TACCTATTTTAGGGTAATGCTGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1171253443 20:23668062-23668084 TTCAGGTTTTACGAGAGTGCAGG + Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
955767322 3:62358606-62358628 TTCCTACATCATGGGAGTGCTGG + Intergenic
957410032 3:79828724-79828746 TTCACATTTTTCTGGAGTGCAGG - Intergenic
968681667 4:1925180-1925202 TTTTTATTTTTCGGGAGTGCTGG + Intronic
972156939 4:36175007-36175029 TTCCTATGTTAGGGTAGTGTAGG + Intronic
972671194 4:41214934-41214956 TTCCTATTGCAAGGGAATGCTGG - Intronic
973865613 4:55109886-55109908 TTCCTTTTTGACAGGAGTTCAGG - Intronic
977570404 4:98623071-98623093 TTCCTTTTTTAGGGGAGGGGAGG + Intronic
977956496 4:103033392-103033414 CTCCTATTTAACCGGAGTACTGG + Intronic
981337396 4:143582246-143582268 TTCCTCTCTTACCTGAGTGCTGG - Intronic
983317659 4:166152490-166152512 TTCCTATCTTATTGGAGTGTTGG + Intergenic
984655748 4:182316586-182316608 TTCCTTTTTTGTGGGAGTGGGGG - Intronic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
995471110 5:112503129-112503151 TTTTTATTTCACTGGAGTGCAGG - Intergenic
998975523 5:147642229-147642251 GTCCTATTTTCAGGGACTGCAGG - Intronic
1000424860 5:161078745-161078767 TTCCTATTTTACTGGGTTGTTGG - Intergenic
1002349622 5:178574859-178574881 TTCCTATTGAGCAGGAGTGCTGG - Intronic
1002780992 6:365936-365958 TTTCTTTTTTATTGGAGTGCAGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1008949452 6:57139660-57139682 TTCCTATTTTAAGGTAGAGGAGG + Intronic
1012258990 6:97065837-97065859 TTCCTATTTTCCAGGGTTGCTGG - Intronic
1014499754 6:122171493-122171515 TTCCTACTTTCAGTGAGTGCAGG + Intergenic
1014591503 6:123277429-123277451 TTCCTATTTTAAGGTACTGGAGG - Intronic
1017979183 6:159384150-159384172 TCACTATTTTACAGGAGTACAGG + Intergenic
1022136903 7:27457543-27457565 TTCCTATTTAGAGGGAGTCCTGG - Intergenic
1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG + Exonic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1038849411 8:31260680-31260702 TTCCTGTTTTATGGGTCTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1047942750 8:129841354-129841376 TTCTTCTTTTAGGGGAGAGCCGG - Exonic
1050197297 9:3099760-3099782 TTTCTTTTTTAGGGAAGTGCTGG - Intergenic
1054783833 9:69191331-69191353 TTCCTATTTCTCTGGATTGCAGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186398215 X:9232003-9232025 TTCCTATTTTTCTGGTCTGCAGG - Intergenic
1187412233 X:19061642-19061664 TTCCTATATTTCTGGAGTGGAGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1196407341 X:115378214-115378236 TTCCTATTTTAGGTCAGAGCAGG - Intergenic
1199185742 X:144912852-144912874 TTCCTATTTTAACATAGTGCAGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic