ID: 1118647839

View in Genome Browser
Species Human (GRCh38)
Location 14:67857404-67857426
Sequence GTACATAAAAATAATGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 1, 2: 6, 3: 64, 4: 525}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118647838_1118647839 -4 Left 1118647838 14:67857385-67857407 CCAAGACTATACTGAATCAGTAC 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1118647839 14:67857404-67857426 GTACATAAAAATAATGAAGTAGG 0: 1
1: 1
2: 6
3: 64
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118647839 Original CRISPR GTACATAAAAATAATGAAGT AGG Intronic
900233121 1:1572446-1572468 ATACATAAATAAAATAAAGTTGG - Intronic
901093554 1:6660104-6660126 GTACATAAAGCGAAGGAAGTGGG - Intronic
901951152 1:12747852-12747874 TTGCATAAAAATAGTGGAGTTGG + Intronic
902535223 1:17115864-17115886 ATACATAGAAAGAAGGAAGTAGG - Intronic
903435817 1:23348368-23348390 CTATATAAAAATCATGGAGTTGG + Intergenic
903678109 1:25078725-25078747 GTCCATAAAAATTCTAAAGTAGG + Intergenic
905619011 1:39424925-39424947 GGACATAAAAAGACTGAAGAGGG - Intronic
907593925 1:55702520-55702542 TTACATAATAATGATGATGTAGG + Intergenic
908287882 1:62628494-62628516 CCACATAAAAAGAATGAAATTGG + Intronic
909040130 1:70639528-70639550 GTACATAAAAAAAAAAGAGTTGG + Intergenic
909201621 1:72696382-72696404 GTAAAGAAGAATAAAGAAGTTGG + Intergenic
909503165 1:76357999-76358021 GTTAATAAAAATAATGAAAAAGG - Intronic
910186986 1:84554299-84554321 CCTCATAAAAATAATGTAGTTGG + Exonic
910556416 1:88539341-88539363 GTACAGATTAATAATGATGTTGG + Intergenic
911053203 1:93689578-93689600 GCCCATAAAAATAAAGAAGAGGG + Intronic
911132524 1:94404143-94404165 GGACAAAAAAATTATGGAGTAGG - Intergenic
911331412 1:96529680-96529702 GTACATAAAATTCAAGAATTGGG + Intergenic
911776229 1:101816337-101816359 GTTTATAAAAATAATCTAGTAGG + Intronic
911924187 1:103806846-103806868 ATATATAAAAATAACCAAGTGGG + Intergenic
914264670 1:146028111-146028133 CAACAAAAAAATAATGAAGGGGG - Intergenic
915451170 1:156006369-156006391 ATAAATAAAAATAATAAAATAGG + Intronic
917043672 1:170833595-170833617 GTACATAGAAATCAAGAACTGGG + Intergenic
917587577 1:176443469-176443491 TTACAGAAAAATATTGAAGAAGG + Intergenic
917918163 1:179725469-179725491 ATACATAAAAAATATTAAGTTGG - Intergenic
918951039 1:191138190-191138212 GTACATAGAAAAATGGAAGTGGG - Intergenic
918970536 1:191410637-191410659 GAACAGAAAAATAATGAGGAAGG + Intergenic
919447942 1:197733013-197733035 GTCTATAGAAATAAAGAAGTAGG - Intronic
919461927 1:197887439-197887461 ATATATAGAAATAATAAAGTTGG + Intergenic
919583754 1:199409838-199409860 GTGCATAATAATAATAATGTAGG - Intergenic
921078460 1:211719490-211719512 GCACATAAAAAATATGAAATAGG - Intergenic
921204758 1:212839006-212839028 GCTCATAAAAATAAAGCAGTGGG - Intronic
922068209 1:222165063-222165085 GTACTTTAAAATAATGAAAAGGG + Intergenic
922369867 1:224898701-224898723 CTAGATAAAAATAATGACGGTGG + Intronic
922640618 1:227227152-227227174 GTAATTAATATTAATGAAGTAGG + Intronic
922921640 1:229310221-229310243 ATAAATAAAAATAATTAACTGGG - Intergenic
924336264 1:242989437-242989459 CTACATAAAAATAATAAAGTGGG - Intergenic
924352771 1:243134440-243134462 GTACATATAAATAATGTTGAAGG - Intronic
924525852 1:244847462-244847484 GAACAAAAAAATTATGAAGATGG + Intronic
924540612 1:244977532-244977554 ATAAATAATAATAAAGAAGTCGG + Intronic
924785630 1:247195764-247195786 CTACATGAAAAAAATTAAGTTGG + Intergenic
1062870375 10:897321-897343 CAACATGAAAATAATGAAGCTGG + Intronic
1063233500 10:4088862-4088884 GTTCAGAAAAATGATGATGTCGG - Intergenic
1064293400 10:14055651-14055673 TTACATAAAAGAAATAAAGTTGG - Intronic
1064428098 10:15247771-15247793 GTAAATAAAAATGATATAGTAGG - Intronic
1064490666 10:15852464-15852486 TAAAACAAAAATAATGAAGTTGG + Intronic
1065165588 10:22973706-22973728 GAAAATAAAAATAATATAGTGGG - Intronic
1065339423 10:24690068-24690090 GTCTTTAAAAATAATGATGTAGG - Intronic
1066070505 10:31804467-31804489 GAAAATAAAAATAGTCAAGTGGG - Intergenic
1066547204 10:36512809-36512831 GTACATAAAAACCATTAACTAGG - Intergenic
1067714498 10:48679049-48679071 ATACATTGTAATAATGAAGTAGG + Intergenic
1068135526 10:52948743-52948765 GTAAATAAAAAGAATAAATTTGG + Intergenic
1069059907 10:63884716-63884738 GAACCTAAAAATCATGCAGTGGG - Intergenic
1069125793 10:64631111-64631133 TTACTTATAAATAATGAAATTGG - Intergenic
1069290736 10:66776562-66776584 GTACATAAGAGTAAAAAAGTAGG - Intronic
1069472211 10:68703420-68703442 ACACATAAAAATAATAAAGTCGG + Intergenic
1070381910 10:75888677-75888699 GTAATTAAGAATAATCAAGTGGG - Intronic
1071139815 10:82495415-82495437 GGACAAAAAAAAAATCAAGTAGG - Intronic
1071181792 10:82994443-82994465 GTACGTAAAGTTAATAAAGTGGG - Intergenic
1072227284 10:93382449-93382471 GTAAATAAAAATAAGGAAACTGG + Intronic
1073093815 10:100968099-100968121 GTACAAATAAAAAATGAAGCAGG + Intergenic
1073515992 10:104076163-104076185 GTCCATAAAAGAAATGAAGGAGG + Intronic
1073699795 10:105913743-105913765 ATACATAAAAATAAACAAATGGG + Intergenic
1074794154 10:116924355-116924377 GTACATAAAGACGATGAAGCAGG + Intronic
1078294089 11:10048062-10048084 ACACATAAAGATAATGATGTCGG - Intronic
1079086492 11:17449306-17449328 AGCCATAAAAATGATGAAGTGGG + Intronic
1079410922 11:20186715-20186737 ATAAATAAAAATAATAAATTTGG + Intergenic
1079669801 11:23154358-23154380 ATACCTTAAAATAATTAAGTTGG - Intergenic
1079808693 11:24967650-24967672 GCACATTAAAAAAATGAAGATGG - Intronic
1080296227 11:30731823-30731845 GGACATACATATGATGAAGTTGG + Intergenic
1080808650 11:35680499-35680521 GCAAATAAAAAGAATGAGGTAGG - Intronic
1081097771 11:38961097-38961119 GGACATAAAGTTAATGAAGTAGG + Intergenic
1081142463 11:39518780-39518802 GTAGAAAAAAATGATTAAGTGGG + Intergenic
1081288249 11:41299411-41299433 GAAATTAAAAATAATAAAGTGGG - Intronic
1082654269 11:55834109-55834131 GTACCCAAAAATACTGAACTTGG + Intergenic
1082754436 11:57059898-57059920 GTATATAAAAAAAATAAAGTGGG - Intergenic
1082777996 11:57262765-57262787 GTAAATAACAAGGATGAAGTAGG - Intergenic
1085331429 11:75655200-75655222 TTCCATAATAATAATGCAGTGGG - Intronic
1086031279 11:82359446-82359468 GTACATCAGAATATTGAAGATGG - Intergenic
1086591392 11:88519054-88519076 ATACATTAGAATTATGAAGTTGG + Intronic
1086775671 11:90829920-90829942 TAAAATAAAAACAATGAAGTAGG - Intergenic
1087226689 11:95608602-95608624 TTACAGAAATATAAAGAAGTTGG + Intergenic
1087413632 11:97824566-97824588 CTACATACAAAAGATGAAGTTGG - Intergenic
1087679642 11:101205033-101205055 GTACAAAAAAATAATTAGCTGGG - Intergenic
1088054998 11:105564132-105564154 CTACATGAAAAGAATAAAGTTGG + Intergenic
1088570416 11:111218522-111218544 TTACAGAAAAATTATGAAGATGG - Intergenic
1089839433 11:121402025-121402047 GAAAAAAAAAAGAATGAAGTTGG - Intergenic
1090862038 11:130662563-130662585 GGAAATAAAAATCATTAAGTTGG + Intergenic
1091093739 11:132797301-132797323 GCACATGCAAATAATGAAGTTGG - Intronic
1091479002 12:807384-807406 GTACATAAAAACAAAGAGTTAGG - Intronic
1092389330 12:8061807-8061829 GTACTTAAAAATGGTGAAGATGG - Intronic
1092744302 12:11659276-11659298 GTACATACAAAGAATGACTTAGG - Intronic
1092814630 12:12302074-12302096 GGACAGGAAAATAAAGAAGTTGG + Intergenic
1093517176 12:20002200-20002222 GTACTTAAAAATGATTAAGATGG + Intergenic
1093741627 12:22695009-22695031 ATACATAAAAATAATTATGTAGG - Intergenic
1093873153 12:24316642-24316664 GTACATAGGAATAATGAAATAGG + Intergenic
1094349302 12:29505951-29505973 GAACATTAAGATAATAAAGTAGG + Intronic
1094659977 12:32460004-32460026 CTAAATAATAATAATCAAGTAGG - Intronic
1095117752 12:38376071-38376093 TTAAAAAAAAATAAAGAAGTTGG + Intergenic
1095725855 12:45452389-45452411 CTACAAGAAAAGAATGAAGTTGG + Intergenic
1095766070 12:45897226-45897248 GTACATCAAAACAATGAAGTTGG + Intronic
1096306649 12:50483767-50483789 CTACATAAAAATAAAAAAATAGG - Intergenic
1097208284 12:57343074-57343096 GTAGATTAAAATAAAGAAATTGG + Intronic
1097366166 12:58715806-58715828 CAACATAAAAATAATAAAGCTGG - Intronic
1097532538 12:60822718-60822740 GTACATAAGGTTAATGCAGTTGG + Intergenic
1097673505 12:62570351-62570373 GTACACAAAAATATTAGAGTAGG + Intronic
1098069811 12:66660997-66661019 ACACATATAAATATTGAAGTTGG + Intronic
1098597259 12:72288839-72288861 CTACATAAAAATTATTAAGCAGG - Intronic
1098832971 12:75385975-75385997 GTTCATAAATAGAATGAAGAAGG + Intronic
1099361213 12:81704177-81704199 GTACACTTAAATAGTGAAGTAGG + Intronic
1099663068 12:85591230-85591252 TTATATAAAACTAGTGAAGTTGG + Intergenic
1100171025 12:91975359-91975381 TTACATAATAATAATAAAGTAGG + Intergenic
1100245824 12:92755941-92755963 GTACAAAAAAAAAATCAATTAGG + Intronic
1101238021 12:102809713-102809735 ATAGAAAAAAATCATGAAGTTGG + Intergenic
1101262633 12:103048220-103048242 GTTCATTAGAATAATAAAGTAGG + Intergenic
1102947060 12:116999237-116999259 GTGCATTAAAATGAGGAAGTGGG + Intronic
1103356138 12:120322044-120322066 ATACATAAAAATAAAAGAGTAGG + Intergenic
1103878330 12:124146665-124146687 TAAAATAAAAATAATGAAATAGG - Intronic
1104280397 12:127371527-127371549 GCACTTAAAAATAATTAAGATGG + Intergenic
1105289669 13:19044130-19044152 GTGCAGAAAAATTATGAAGATGG + Intergenic
1105667111 13:22572421-22572443 ATCCTTAAAAATAATGAAATGGG + Intergenic
1106968539 13:35105205-35105227 GGACAGAAAGAAAATGAAGTTGG - Intronic
1107630750 13:42340604-42340626 GAACATATAAATAAACAAGTGGG - Intergenic
1107677577 13:42812805-42812827 GAACATAAACAAAATCAAGTGGG - Intergenic
1108018031 13:46096475-46096497 GTACAAGTAAAAAATGAAGTGGG + Intronic
1108314972 13:49227947-49227969 GAACACAAAGAGAATGAAGTAGG + Intergenic
1108906314 13:55478641-55478663 GTACCTGAATATAATGAAATGGG + Intergenic
1109618466 13:64868998-64869020 GTACATAACAACATTGAAATGGG + Intergenic
1109658706 13:65429747-65429769 GAAAACAAAAATAATGAATTAGG - Intergenic
1109755307 13:66750939-66750961 GTACAGCACATTAATGAAGTTGG + Intronic
1109822233 13:67672087-67672109 TTATAAAAAGATAATGAAGTTGG - Intergenic
1110236646 13:73223794-73223816 GTAGATAAAAATGATGAAATCGG - Intergenic
1110594982 13:77310235-77310257 GTGCATAAAAATGAGGAGGTAGG - Intronic
1110599287 13:77353466-77353488 GTAAATAAAAAGCATTAAGTTGG + Intergenic
1110904808 13:80873479-80873501 ACACACAAAAATAATGAATTTGG + Intergenic
1110995807 13:82107930-82107952 ATACACAACAATATTGAAGTTGG - Intergenic
1111166802 13:84468444-84468466 CCACATTAAAATAAAGAAGTTGG + Intergenic
1111338623 13:86854762-86854784 TTGAATAAAAATAACGAAGTGGG + Intergenic
1111399447 13:87713717-87713739 GTACAAATAAAAAATGAAGTTGG + Intergenic
1111843678 13:93481631-93481653 GTACAAAAAAAAAATGAAGCTGG - Intronic
1112301581 13:98235601-98235623 GTACTTAAAAATGATTAAGATGG - Intronic
1112330022 13:98470034-98470056 GCACATTAACTTAATGAAGTAGG + Intronic
1112667920 13:101598099-101598121 GTACATAAAGATAATGAAGTTGG - Intronic
1112724298 13:102284522-102284544 TTATTTAAAAATAATGAAATTGG + Intronic
1112757973 13:102660935-102660957 ATATAGAAAAAGAATGAAGTTGG + Intronic
1113084725 13:106556467-106556489 GTACAGAAAAATATCCAAGTGGG - Intronic
1113967622 13:114163333-114163355 ATAAATAAAAATAAAGAAGGCGG + Intergenic
1114305752 14:21421352-21421374 GCAGTTAAAAACAATGAAGTAGG - Intronic
1114888443 14:26885538-26885560 GTATTAAAAAAAAATGAAGTTGG - Intergenic
1115120995 14:29937789-29937811 GTACATAGAAAAAATAAAGGAGG - Intronic
1115538834 14:34399898-34399920 GTACAAAAAAAAAATTAGGTGGG + Intronic
1115862481 14:37703114-37703136 ATACATAAACATAATCTAGTAGG + Intronic
1116280103 14:42895797-42895819 CTAAATAAAAAGAATGAAGCTGG - Intergenic
1116461827 14:45185799-45185821 TTACAGAAAAATAAAAAAGTTGG + Intronic
1116836940 14:49777941-49777963 GTATATAAAAACAAGTAAGTTGG + Exonic
1117124342 14:52604999-52605021 CTAAGTAAAAAGAATGAAGTTGG - Intronic
1117363718 14:55003865-55003887 GTACATAAAAAATATACAGTTGG - Intronic
1117906822 14:60598042-60598064 TTAGAAAAAAATAATAAAGTTGG + Intergenic
1118469303 14:66060174-66060196 TTAAATAAAAATAGTGAGGTGGG + Intergenic
1118557902 14:67046584-67046606 GTACATAAAGATGATAAAATAGG - Intronic
1118638111 14:67766699-67766721 TTTCAAAAAAATAAAGAAGTGGG - Intronic
1118647839 14:67857404-67857426 GTACATAAAAATAATGAAGTAGG + Intronic
1118652268 14:67909619-67909641 GTCACTAAAAATAATGATGTGGG + Intronic
1118712681 14:68535412-68535434 GAAACTAAAAATAATGAAGAAGG - Intronic
1119358102 14:74024039-74024061 GGTCATAAAAATAATTAAATAGG - Intronic
1119608478 14:76041717-76041739 GTACATACACGTATTGAAGTGGG - Intronic
1119680871 14:76591440-76591462 GGACATAAACATAATGGAGCTGG - Intergenic
1120189416 14:81426915-81426937 GCACATAAAAATAAAGCGGTAGG - Intronic
1120221801 14:81742739-81742761 CTACATAAAAACCATGCAGTGGG + Intergenic
1120359214 14:83475720-83475742 GAACGTAAAAATGATGAAGGTGG - Intergenic
1120502934 14:85319561-85319583 GAACATAAAAATAAGGTATTTGG + Intergenic
1120574626 14:86167236-86167258 GTACATAAGAATTATGACTTTGG + Intergenic
1120600583 14:86500844-86500866 GTAAATAAAAATAAAGATGATGG + Intergenic
1120792100 14:88593669-88593691 CCACATGAAAAGAATGAAGTTGG + Intronic
1120860631 14:89252352-89252374 GTACTTAAAAATCAGGAAATTGG + Intronic
1121043557 14:90771164-90771186 GCACTTAAAAATAATGAAGATGG + Intronic
1122358973 14:101146354-101146376 ACACACAAAAATAATGAAATTGG - Intergenic
1122583845 14:102790213-102790235 GAACATACAAAGAATGAATTGGG - Intronic
1123484445 15:20675313-20675335 GGACAGAAAGAAAATGAAGTTGG + Intergenic
1123537170 15:21244280-21244302 GGACAGAAAGAAAATGAAGTTGG + Intergenic
1124919425 15:34011465-34011487 GTACATAATAATAAATAATTGGG + Intronic
1125247895 15:37662517-37662539 CTACACAAAAAGAATGAAGCTGG - Intergenic
1126632306 15:50749587-50749609 AAACATAAAAATAGTGAAGAAGG - Intronic
1126746942 15:51835764-51835786 CTACATAAGAATAATGAGGTTGG - Intronic
1128275521 15:66350303-66350325 GTACAAAAACTTAATAAAGTTGG + Intronic
1128439660 15:67693602-67693624 GTACATAAAGATAAAGATGTTGG - Intronic
1131084569 15:89565525-89565547 TTGCATAAAAATAATGAACTTGG - Intergenic
1131769746 15:95724185-95724207 GTAATTAAAAATTATAAAGTGGG - Intergenic
1132069904 15:98767144-98767166 GTAACTAAAAATAATGATCTAGG - Intronic
1132127889 15:99245685-99245707 ATACATGAAAAGAATAAAGTTGG + Intronic
1132935281 16:2477014-2477036 GTACATAAGGACAATGAAGCAGG + Intronic
1134809267 16:17153430-17153452 GTCTCTAAAAATAATAAAGTTGG - Intronic
1135243962 16:20838292-20838314 GTACATAAAAACAGTTAAGATGG - Intronic
1139142371 16:64282218-64282240 GTGCAGAAAAATAAAGAAATTGG + Intergenic
1140075598 16:71695869-71695891 CTATATAAAAATAATCAAGTTGG + Intronic
1140426042 16:74862307-74862329 GCACATATAAATAAGGAAGATGG - Intergenic
1140590711 16:76348965-76348987 GAATATAAAAATAATGAAGCAGG + Intronic
1141051096 16:80764708-80764730 GAAAATAATAATAATTAAGTGGG + Intronic
1147029907 17:37624899-37624921 TTAGATAAAAATAATTAAATGGG - Intronic
1147274420 17:39303246-39303268 GTAAAAAAAAAAAATGAACTAGG + Intronic
1148802764 17:50242561-50242583 ATACTTAAAAATAGTGAAGATGG - Intergenic
1149315512 17:55434779-55434801 GGACTTAAAAATACTCAAGTAGG - Intergenic
1149975149 17:61258010-61258032 GTGCACAAAAATAATAAGGTGGG - Intronic
1150324644 17:64246964-64246986 ATACAGAAAAATAAAGAAGGCGG + Intronic
1150687062 17:67329437-67329459 GTACTTAAGAATCTTGAAGTTGG - Intergenic
1150711792 17:67536875-67536897 TTACACACAAATCATGAAGTGGG - Intronic
1151841652 17:76622661-76622683 CTACATAAAATTAATAAAATGGG - Intergenic
1153173851 18:2347985-2348007 GTAAATAATAATAATAAACTGGG + Intergenic
1153422303 18:4920538-4920560 TCACATGAAAAAAATGAAGTTGG + Intergenic
1153423494 18:4935943-4935965 GTAAACAAAAATAATGAAGCTGG - Intergenic
1153523631 18:5975342-5975364 GGAAATAAAAAAAATGCAGTCGG + Intronic
1153684633 18:7533486-7533508 ACACGTTAAAATAATGAAGTAGG + Intergenic
1153837271 18:8975190-8975212 AAACATAAAAAGAATGAAGAAGG + Intergenic
1154013494 18:10595681-10595703 TTAAGTAAAAATAATGAAGTAGG - Intergenic
1154095567 18:11411859-11411881 GTACATAAAAGTAAAGAGGTTGG - Intergenic
1154152718 18:11919276-11919298 TTAAGTAAAAATAATGAAGTAGG - Intergenic
1154357335 18:13632058-13632080 CTACATTAACAGAATGAAGTTGG + Intronic
1154393747 18:13968132-13968154 GCACATGCAAAAAATGAAGTTGG + Intergenic
1155467171 18:26149728-26149750 TCACATAAAAAGAATGAAGTAGG + Intronic
1155574351 18:27228470-27228492 CTACAAAAAAATATTGGAGTCGG - Intergenic
1155728040 18:29114513-29114535 ATACATAAAAATAAGCAAGATGG + Intergenic
1157070608 18:44403709-44403731 GGGCTTTAAAATAATGAAGTGGG + Intergenic
1157781501 18:50443967-50443989 CTTGATAAAAATAATGAATTTGG - Intergenic
1158062860 18:53367194-53367216 CAAAATAAAAATAATTAAGTGGG - Intronic
1158616058 18:58988087-58988109 TTACTTAAAAATATGGAAGTAGG + Intergenic
1158922277 18:62206450-62206472 GTACATCACAATAATCAAGATGG - Intronic
1159254006 18:65921886-65921908 GTAAATAAAAATAAAAATGTAGG - Intergenic
1161960140 19:7518761-7518783 AAAAATAAAAATAAAGAAGTGGG + Intronic
1164185453 19:22863724-22863746 GTAAATAAAAATAATGTGGTAGG - Intergenic
1164970684 19:32529777-32529799 GTACATAAAAAAAAAGACCTCGG + Intergenic
1167131545 19:47589483-47589505 GGAAATAAAAATAATAAAGTGGG + Intergenic
1167950630 19:53024408-53024430 TTACCTAAAAATAGTGAACTAGG - Intergenic
1168074735 19:53974003-53974025 ATACTTAAAAATGATGAAGATGG - Intronic
925663640 2:6229807-6229829 CCACATACAAAGAATGAAGTTGG + Intergenic
925695619 2:6574962-6574984 TGACATAAAAATAATTAATTGGG - Intergenic
926558625 2:14390362-14390384 GAACAAAAAAAAAATGAATTTGG + Intergenic
926812922 2:16772455-16772477 GTAAAAAAAAAAAATGAAATGGG + Intergenic
927004151 2:18830304-18830326 GTAGATAAAAATGATGACTTTGG + Intergenic
927590229 2:24349574-24349596 TTAAAAAAAGATAATGAAGTGGG + Intronic
928846849 2:35684700-35684722 GTACATAAAAATAACCAGTTAGG + Intergenic
929340763 2:40814247-40814269 TCACATCAAAATAATGTAGTAGG - Intergenic
929630612 2:43457785-43457807 GTGAATAAAAAGAATGAAATTGG - Intronic
930764129 2:55067107-55067129 TTACAAAAATATAATGAAATTGG + Intronic
931080319 2:58761912-58761934 GTAGAAAAAAATAATGATGGGGG + Intergenic
931412493 2:62046288-62046310 GTACAGAAAAGTAAAGAATTTGG + Intronic
931552141 2:63458435-63458457 GTATACAACAATAATGAACTAGG + Intronic
931800417 2:65752714-65752736 ATGCATAAAAATGATGAAATAGG - Intergenic
932044523 2:68334586-68334608 CCAAATAACAATAATGAAGTTGG - Intergenic
932267485 2:70380866-70380888 GTACTGAAAAATAACAAAGTAGG - Intergenic
933035142 2:77386937-77386959 GAACTTAAAAAAAATAAAGTTGG + Intronic
933055493 2:77658031-77658053 GAAAATAAAAATAATTTAGTAGG - Intergenic
933059470 2:77719015-77719037 GTAGATAAAACTAATAACGTTGG - Intergenic
933173123 2:79145917-79145939 GCACATTAAAATGATCAAGTGGG - Intergenic
933360546 2:81277267-81277289 GTACTTAAAAATAAATAAGGAGG - Intergenic
934562844 2:95322062-95322084 GGCCATAAGAATAATGAGGTTGG + Intronic
934583952 2:95472504-95472526 GTAGATAAAATCAATGAAGTAGG + Intergenic
934595500 2:95604210-95604232 GTAGATAAAATCAATGAAGTAGG - Intergenic
935485848 2:103652596-103652618 ATACTTAAAAATATAGAAGTAGG - Intergenic
936105199 2:109617092-109617114 TTACATAAGAATCATTAAGTTGG - Exonic
936342324 2:111644855-111644877 GTACAAAACAATAATGATGATGG + Intergenic
936512882 2:113162553-113162575 GTACTTAAAAACGATGAAGGCGG - Intronic
936599573 2:113882531-113882553 AGACATAAAAATACTGATGTCGG - Intergenic
937123369 2:119456375-119456397 GTCCAGCAAAATAATGAATTAGG + Intronic
938170082 2:129068354-129068376 TGAAATAAAAATAAAGAAGTTGG - Intergenic
938229270 2:129644237-129644259 GTACATAAAAATATTTTAGTTGG - Intergenic
938682902 2:133710495-133710517 TGACATAAAAATAATGAATTTGG - Intergenic
939012796 2:136866166-136866188 GTAAATAAGAAGAATGAAATAGG - Intronic
939064856 2:137470888-137470910 GTAAAGAAAAATAAAGAAATAGG - Intronic
939321391 2:140627715-140627737 GTATATATAAATAATTAAATTGG - Intronic
939498711 2:142953466-142953488 GGAAATAAATATAATGAAGATGG + Intronic
939849384 2:147286154-147286176 CTACATAAAGTTAATCAAGTTGG + Intergenic
939950046 2:148459539-148459561 TTACAGAAAAACTATGAAGTAGG - Intronic
941120203 2:161521073-161521095 TTACAAAAAAATACAGAAGTCGG - Intronic
941632480 2:167899933-167899955 GTGGTTAAAGATAATGAAGTAGG + Intergenic
942174287 2:173316604-173316626 GTACAAAAAAATAAAGAGTTTGG - Intergenic
942177888 2:173352521-173352543 GGATATAAAAATAATGAAAAAGG + Intergenic
942627708 2:177920714-177920736 ATACTTAAAAATAGTGAAGATGG + Intronic
943472708 2:188314650-188314672 GTACATAAAGAAAGTGTAGTGGG - Intronic
943573400 2:189601657-189601679 GTACAAAGAAATAATATAGTAGG + Intergenic
943848381 2:192681764-192681786 ATACATAAAAATTAGTAAGTTGG - Intergenic
944402097 2:199339425-199339447 GAACATTAAATTAATAAAGTAGG - Intronic
944446242 2:199793239-199793261 GATCAGAAAAATAATAAAGTAGG + Intronic
944518562 2:200539356-200539378 ATACATAAAATTAATCAACTGGG - Intronic
945041191 2:205745118-205745140 GTACATAAAACTGATGATGCGGG - Intronic
945344074 2:208692114-208692136 GTACATAAAGAAAAAGAAGAAGG - Intronic
945410651 2:209502575-209502597 ATACACAAAGAAAATGAAGTCGG - Intronic
945608282 2:211964485-211964507 GTTAATAAAAATAATGACATAGG + Intronic
946210177 2:218141362-218141384 ATCTTTAAAAATAATGAAGTAGG + Intergenic
947069689 2:226274478-226274500 GTAGCTAAAAATGATGAACTGGG + Intergenic
947145283 2:227058784-227058806 GTACTTAAAAATAACCAAGTGGG - Intronic
948328577 2:237147021-237147043 GTACATAGAAATTATAGAGTTGG + Intergenic
948904422 2:240971618-240971640 GTAGGTAAAAATAATGAAAGGGG - Intronic
1169031644 20:2413694-2413716 GGAAATAAAAAGAATGAAGTTGG + Intronic
1169412001 20:5379336-5379358 GTTCATAAAAATAATGACTATGG - Intergenic
1170914295 20:20607340-20607362 GAACATAAAAATGTTAAAGTAGG + Intronic
1172638666 20:36427469-36427491 GTCCATCAAAAGAAAGAAGTGGG + Intronic
1173138287 20:40459486-40459508 TTCCATAAAACTAATGATGTGGG + Intergenic
1174930950 20:54814159-54814181 GGACATTAAAAAAATCAAGTTGG + Intergenic
1175672057 20:60911981-60912003 GCATTTAAAAATAATGAAGATGG + Intergenic
1176007155 20:62871933-62871955 ATACATAAAAATAAATAAGGTGG - Intergenic
1176884505 21:14238613-14238635 GTACATAAAAATAGTTAAGAAGG - Intergenic
1181293242 22:21814457-21814479 GTACTTAAAAATGATTAAGATGG + Intronic
1181523541 22:23464159-23464181 TTCCATAAAATTAATGAAGGGGG + Intergenic
1184599901 22:45537288-45537310 GTGGTTAAAAATAATGCAGTGGG - Intronic
949589843 3:5482761-5482783 GAACATAAACATATTGAAGGGGG - Intergenic
949774345 3:7614809-7614831 TGACATAAAAATAAGGAAGGGGG - Intronic
953189815 3:40674669-40674691 GTAAATAAAAAGAATAAAGCTGG + Intergenic
953370244 3:42381412-42381434 TCACTTAAAAATAATGAAGAAGG + Intergenic
954901456 3:54023612-54023634 GTACTTAAAAATAATCCAGGAGG - Intergenic
956451128 3:69375765-69375787 GTACATAAAATCAATAAAATGGG + Intronic
956481929 3:69681672-69681694 GTTCTTACAAAAAATGAAGTTGG + Intergenic
956505861 3:69938886-69938908 GTAGAGAAAAATAAAGCAGTTGG - Intronic
956729729 3:72185585-72185607 TTATGTAAAAAAAATGAAGTAGG + Intergenic
957121071 3:76093600-76093622 GTTCTTAAAAAGAATGAGGTTGG - Intronic
957137123 3:76303363-76303385 ATATATAAAAATAATGAACTAGG + Intronic
957299537 3:78373638-78373660 GTGCTTAAAAATATTGAAGGTGG - Intergenic
957384497 3:79478493-79478515 CGACATATAAATAATGGAGTGGG - Intronic
957647287 3:82947566-82947588 TTATATAAAAAAAATTAAGTCGG - Intergenic
958431137 3:94043138-94043160 GGCCAAAAAAATAATGAATTTGG + Exonic
958513063 3:95073899-95073921 CGAGAAAAAAATAATGAAGTTGG + Intergenic
958707109 3:97669667-97669689 GTGTATAAAAATCATGGAGTGGG - Intronic
958715747 3:97778140-97778162 TAAAATCAAAATAATGAAGTTGG + Intronic
959016653 3:101142369-101142391 GCAGATAAAGATAAGGAAGTGGG + Intergenic
959134712 3:102403047-102403069 GTAAATAATAATAATAAAGTAGG - Intronic
959839236 3:110955002-110955024 GTACACAAAAATAATACAATTGG + Intergenic
960346902 3:116544442-116544464 AGCCATAAAAATAATGAGGTCGG + Intronic
961247435 3:125467408-125467430 AAACATAAAAATAAAGGAGTGGG + Intronic
961256818 3:125561672-125561694 TAACATAAAAATAATGCAGAAGG - Intronic
961835034 3:129650811-129650833 CTACTTAAAAATACTGTAGTAGG + Exonic
964614835 3:158651899-158651921 GTAGATAAATATACTGAAATAGG - Intronic
964700702 3:159562777-159562799 GGAGATAAAATTAATGAACTGGG + Intronic
964755474 3:160087719-160087741 ATAAATAAATAAAATGAAGTGGG - Intergenic
964782234 3:160352888-160352910 GTACAAGAAAATGATGACGTTGG - Intronic
964957062 3:162373618-162373640 ATACAGAAAAATAATAAAGATGG + Intergenic
965148317 3:164936065-164936087 GTGCATAATAAGAATGAAGAAGG - Intergenic
965690727 3:171354133-171354155 TTACATATATATAATGAATTTGG - Intronic
965788468 3:172361834-172361856 CTACAAAAAAATAATTTAGTGGG - Intronic
966316135 3:178647644-178647666 GTACTTAATAATAGTTAAGTAGG + Intronic
966383995 3:179375471-179375493 GCACTTAAAAATATAGAAGTAGG - Intronic
966387165 3:179411320-179411342 TTATAAAAATATAATGAAGTTGG + Intronic
966583653 3:181597349-181597371 GAAAATAAAAAGATTGAAGTTGG - Intergenic
967529697 3:190534265-190534287 TTAAAAAAAAAAAATGAAGTGGG - Intronic
968037936 3:195564019-195564041 ATACATCAAAATAATTAAGTGGG + Intergenic
968420805 4:483078-483100 GAAAATGAAAATAATAAAGTGGG + Intronic
968740372 4:2326566-2326588 TTCCATAAAAAAAATGATGTTGG + Intronic
970072767 4:12180282-12180304 GAACCTCAAAATAATGAGGTTGG - Intergenic
970548299 4:17152874-17152896 CTAAATAAAAAAAATAAAGTTGG + Intergenic
970739586 4:19219487-19219509 CTACATAAAAATAATGCAGCTGG - Intergenic
971023154 4:22559001-22559023 CTACATATAAAGAATAAAGTTGG - Intergenic
971031560 4:22642826-22642848 GAACATAAAAATTACTAAGTAGG - Intergenic
971777399 4:30984479-30984501 ACACATAAACATAAGGAAGTTGG + Intronic
972037381 4:34543272-34543294 GAACATAAAAATAATCACCTGGG - Intergenic
972117414 4:35654416-35654438 GTACAACAAATTAATGAAATAGG + Intergenic
972837326 4:42888842-42888864 GGATATAATAATAATAAAGTTGG - Intergenic
972882469 4:43442820-43442842 ATAGATAAAAACACTGAAGTAGG - Intergenic
972949227 4:44298412-44298434 ATACAGAAAAATAAAGAGGTGGG - Intronic
973128086 4:46613723-46613745 GTTCAGAAAAAAAATGAAATAGG + Intergenic
974146643 4:57956110-57956132 GTTCATATAAATAAAGAAATTGG + Intergenic
974468982 4:62294748-62294770 ATACATAAAAATAGTGAAAAGGG - Intergenic
974555109 4:63436207-63436229 AAAAAGAAAAATAATGAAGTTGG + Intergenic
974615923 4:64282478-64282500 GTTCATAAAAATAAATATGTAGG + Intronic
974709300 4:65568817-65568839 GCCCTTAAAAATAATAAAGTTGG - Intronic
974717599 4:65690017-65690039 GCCTATAAAAATAATGAATTTGG + Intergenic
974821237 4:67068830-67068852 GTACTTAAAATTAATTAAGAGGG + Intergenic
974918656 4:68208805-68208827 GTAGTTAAAAATAATGCAGTAGG + Intergenic
975022780 4:69510560-69510582 GTATATAGAAATAAACAAGTAGG - Intronic
975799631 4:78046616-78046638 GCACAGAAAAATCATGATGTTGG + Intergenic
976489915 4:85658249-85658271 TTACAGAGAAAAAATGAAGTGGG - Intronic
976916848 4:90386624-90386646 GCAAATAAAAATAAATAAGTAGG + Intronic
977194849 4:94045862-94045884 GAAGATAAAATTAATGAAATAGG + Intergenic
977792491 4:101124317-101124339 GTACATAGAAATAACTATGTTGG + Intronic
978008179 4:103645033-103645055 GTACATAAAGATAAATAAATTGG + Intronic
978221279 4:106277954-106277976 ATACATCAAAATAATAAAGATGG + Intronic
979040113 4:115779959-115779981 ATACATAATTATAATTAAGTAGG - Intergenic
979240861 4:118445873-118445895 CTACATAAAAATAATAAAGTGGG + Intergenic
979249180 4:118546079-118546101 GTACATATAAATAATGTTGAAGG + Intergenic
979321451 4:119329841-119329863 GTAGATAACAATGATGAAGTAGG - Intergenic
979882256 4:125975734-125975756 CTACATAAAAGTATTGAATTAGG + Intergenic
980424554 4:132609346-132609368 TTACATAAAATAAAAGAAGTAGG - Intergenic
981140947 4:141268550-141268572 TTATTTTAAAATAATGAAGTTGG - Intergenic
981308471 4:143271107-143271129 TTACCTAAAAATAAGTAAGTAGG - Intergenic
981331962 4:143520751-143520773 TTTCATAAAAATAATGAAATTGG - Intronic
981352386 4:143746991-143747013 TTAAATATAAATGATGAAGTTGG - Intergenic
981469757 4:145118380-145118402 GTACATAAATATTAAGATGTGGG + Intronic
981498823 4:145424043-145424065 TTTTATAAAAATAAAGAAGTAGG - Intergenic
982471615 4:155798286-155798308 GTTCATTAAAATAATGATATAGG + Intronic
982696075 4:158602558-158602580 ATACAAAAAAAAAAAGAAGTTGG + Intronic
982931919 4:161419378-161419400 GGACATTAAAAAAATGTAGTGGG + Intronic
983120058 4:163872742-163872764 GATAATAAAAATGATGAAGTCGG + Intronic
984107646 4:175569666-175569688 GTACAAACAAACAATGAATTAGG + Intergenic
984636352 4:182114402-182114424 ATACATAAATAAAATGAAGAAGG - Intergenic
984740085 4:183152898-183152920 ATAAATAAAAATAATAGAGTTGG + Intronic
984891459 4:184497880-184497902 GTAAATACACAAAATGAAGTAGG + Intergenic
985151662 4:186953616-186953638 GTTCATATAAATAATGAAGTTGG + Intergenic
985209244 4:187573976-187573998 GAACATAAAAAGAATAAAATCGG - Intergenic
985565750 5:615599-615621 GTGAATAAAAATAATGAACCAGG - Intronic
986738631 5:10686048-10686070 AGACATAATAATAATGAAGATGG - Intronic
986904835 5:12484232-12484254 GGTATTAAAAATAATGAAGTAGG + Intergenic
987023015 5:13894546-13894568 GGAGATATAAATAATGAAATGGG - Intronic
987079588 5:14414654-14414676 GGACATAAAAATGGTGAAGACGG - Intronic
987662227 5:20891777-20891799 GTCCGTATAAATAATGAAGCAGG + Intergenic
987939133 5:24509623-24509645 GTTCATGAAGATATTGAAGTGGG - Exonic
988460050 5:31427024-31427046 GAAGATAAAAATAAGGAAGGAGG + Intronic
988761355 5:34313537-34313559 GTCCGTATAAATAATGAAGCAGG - Intergenic
989127339 5:38069170-38069192 GTACATAAAATTAATAACTTTGG + Intergenic
989371618 5:40716599-40716621 GTACATTAAGATAATGCATTAGG - Intronic
990828959 5:59934899-59934921 GTACAAAAAAATATTGAAGTTGG + Intronic
990859113 5:60305955-60305977 GTAAATTCAATTAATGAAGTTGG + Intronic
990914248 5:60886014-60886036 GGAAATATAAATAATGTAGTTGG - Intronic
991037986 5:62146998-62147020 GTACCTAAAAGTAATCAAGCAGG + Intergenic
991408624 5:66325489-66325511 GGAAATAAAATTAATGAAATCGG + Intergenic
991438503 5:66621130-66621152 ATACTTAAGAAAAATGAAGTCGG + Intronic
991518894 5:67472290-67472312 GTACTATTAAATAATGAAGTAGG - Intergenic
991678763 5:69116962-69116984 GTCTATAAAAATAATAAACTAGG - Intronic
991779734 5:70121036-70121058 GTACATAAAAATTAAGCAGATGG + Intergenic
991811678 5:70480814-70480836 GTACATAAAAATTAAGCAGATGG - Intergenic
991859021 5:70996480-70996502 GTACATAAAAATTAAGCAGATGG + Intronic
991872181 5:71121364-71121386 GTACATAAAAATTAAGCAGATGG + Intergenic
992035171 5:72766592-72766614 GTACATAAAAAAAATTAGTTGGG - Intergenic
992935020 5:81693967-81693989 GTGCATATACAGAATGAAGTAGG + Intronic
993250932 5:85521070-85521092 ATACATAAAAATTATGAAAAGGG - Intergenic
993599303 5:89901036-89901058 GTTCATTAAAATAATTATGTAGG - Intergenic
994245764 5:97473735-97473757 TTACACAAAAATAATAAACTTGG - Intergenic
994448664 5:99911100-99911122 GTATTTAAAAATAATGAAAGAGG - Intergenic
994475711 5:100266332-100266354 TTACATAAAAATGAAAAAGTTGG + Intergenic
994501536 5:100584870-100584892 TTACAAAAAAAAAAAGAAGTTGG - Intronic
994567067 5:101462848-101462870 ATACATAAAAATAATTCAGTTGG - Intergenic
995918388 5:117279135-117279157 GTTCATAAAAATAAATAAGATGG - Intergenic
995968989 5:117944072-117944094 GTGCATTAAAATTATAAAGTAGG - Intergenic
996221659 5:120940194-120940216 GAATATAGAAATAATTAAGTGGG + Intergenic
997850698 5:137330145-137330167 GAACATAAATATTATGAATTGGG - Intronic
998306223 5:141079591-141079613 GTAAATAAAAATTCAGAAGTAGG + Intergenic
999469840 5:151844168-151844190 TTAAAAAAAAAAAATGAAGTTGG + Intronic
999767423 5:154752110-154752132 CTACATTAAAATAATGAAACTGG - Intronic
1000040751 5:157483412-157483434 GCACTTAAAAAGAATGAAGTAGG + Intronic
1001050622 5:168411225-168411247 GTACAGAAAGATCATGAACTTGG - Intronic
1002791001 6:437416-437438 GTACATAAAAAAATTGATGTTGG - Intergenic
1003228412 6:4227171-4227193 ATAAATAAAAATAATAAAATGGG + Intergenic
1004154066 6:13151628-13151650 GTACTCAAAAAGAATGAGGTGGG + Intronic
1005139835 6:22616770-22616792 GTAATACAAAATAATGAAGTAGG + Intergenic
1005618511 6:27598433-27598455 TTAAATAAAAATAATCAAGTAGG + Intergenic
1005707766 6:28472480-28472502 ATAAATAAAAATAATGAAATTGG + Intergenic
1005798625 6:29394851-29394873 GTTAAAAAAAATAATGAACTAGG - Intronic
1005800343 6:29415594-29415616 GTAAAAAAAAATAATGAACAAGG - Intronic
1007035390 6:38668254-38668276 ATAAATAAAAATAAAGAAGAGGG + Intergenic
1007065467 6:38986511-38986533 ATTCATAAAAATAATAAACTCGG + Intronic
1008839569 6:55885330-55885352 GTATATAAAAGTTATGAATTGGG - Intergenic
1009493459 6:64321547-64321569 AAACAGAAAAATAAAGAAGTAGG + Intronic
1009506710 6:64492223-64492245 GTTCATAAATATAATTAAATAGG + Intronic
1010126965 6:72443703-72443725 GTAGAAGAAAATAATGAAGAAGG + Intergenic
1010551333 6:77226192-77226214 GTACAACAAAAAAATGAGGTAGG - Intergenic
1010908453 6:81522535-81522557 ATACTTAAAAATAAATAAGTTGG - Intronic
1011500044 6:87978300-87978322 GTTCAGAAATATAAAGAAGTGGG + Intergenic
1011850387 6:91620480-91620502 GTACATAAAAATAATGGCTGAGG + Intergenic
1012781939 6:103571610-103571632 GTACAAAAAAATAATAAAATAGG - Intergenic
1013759697 6:113502861-113502883 GTACATAATACAAATGAAGAAGG + Intergenic
1014536697 6:122622296-122622318 TTACAAAAAAAAAATGAAGAAGG - Intronic
1015036545 6:128662458-128662480 TTAAATTAAAATATTGAAGTGGG + Intergenic
1015085094 6:129281005-129281027 ATGCATAAAATTAATGAAGCAGG + Intronic
1015100402 6:129471709-129471731 GTATATAAAAATAATAAAATAGG + Intronic
1015227783 6:130877981-130878003 TTACATAAAAATAATTAAATGGG + Intronic
1015339435 6:132080885-132080907 GTACATAAAATTAATAAAACAGG - Intergenic
1015871589 6:137781244-137781266 GTACCAGAAATTAATGAAGTGGG - Intergenic
1016064518 6:139665933-139665955 ATTTCTAAAAATAATGAAGTTGG - Intergenic
1016091486 6:139984625-139984647 GAACCTACAAGTAATGAAGTGGG - Intergenic
1016163633 6:140911859-140911881 ATACTTAAAAATAATGAGGCAGG + Intergenic
1016308142 6:142704892-142704914 TTACATGAAAAAAATGAGGTTGG + Intergenic
1016556899 6:145348835-145348857 GAACTTAAAAATATTTAAGTTGG - Intergenic
1020331239 7:7019100-7019122 TTACATAACAATAATCAAATCGG + Intergenic
1020917909 7:14220322-14220344 CTACATACAAAGAATGCAGTTGG - Intronic
1021016494 7:15541418-15541440 CCACATAAAAATAATGCATTAGG - Intronic
1021336573 7:19409966-19409988 ATACATAAAAATAACGATGCTGG - Intergenic
1021585820 7:22206827-22206849 GTGTATAAAAATAATTAATTAGG + Intronic
1022991079 7:35707790-35707812 GTACATTAAAATACTGAGTTTGG - Intergenic
1023053800 7:36275759-36275781 GGAAATAAAAATAATAAAGGTGG - Intronic
1024018471 7:45341983-45342005 GTAAATAAGAAGAATAAAGTTGG + Intergenic
1025266591 7:57464774-57464796 CTACATTGAAACAATGAAGTTGG - Intronic
1025738126 7:64172740-64172762 GAAAATACAAATGATGAAGTTGG - Intronic
1025742983 7:64215717-64215739 CTACATTGAAAAAATGAAGTTGG - Intronic
1025819928 7:64953172-64953194 TTATATTAAAATAATGAAGGAGG - Intergenic
1026427050 7:70305452-70305474 GTTCATAAAAATATTGAATTTGG + Intronic
1026458162 7:70590940-70590962 TTAAATAAAAATAATGTAGTGGG - Intronic
1027379286 7:77588686-77588708 GTACTTAACAATAATTAATTAGG + Intronic
1027451001 7:78331374-78331396 GTATAAAAAAATAATGCAGATGG + Intronic
1027770047 7:82394927-82394949 GTATAAAAAAATAATGAAGCTGG - Intronic
1028294576 7:89112560-89112582 TTACATAAAAAGAAGAAAGTTGG - Intronic
1028332001 7:89606096-89606118 GGACATAAAAATTATACAGTAGG - Intergenic
1029861510 7:103577308-103577330 GTAACTTAAAATAATGAAGGGGG - Intronic
1030393260 7:108953368-108953390 ATAGATAGAAATCATGAAGTCGG - Intergenic
1030622651 7:111807770-111807792 ATAAAAAAAAATAATGAAGCTGG - Intronic
1030760768 7:113347562-113347584 GTACACAAAATTACTGAAATGGG + Intergenic
1030957884 7:115877806-115877828 ATGCAGAAAAACAATGAAGTCGG + Intergenic
1031941220 7:127791498-127791520 GTAAATAAAAATGGTGAAGATGG - Intronic
1032010685 7:128345402-128345424 GTACAAAAAAATAAATAAATTGG - Intergenic
1032493410 7:132342252-132342274 CTAGATAAAAAAAATAAAGTTGG + Intronic
1032551827 7:132791392-132791414 GCACATGAAAAAAATGAGGTTGG + Intronic
1032605782 7:133350369-133350391 CTACATACAAAAAATGAAGTTGG - Intronic
1032917408 7:136507996-136508018 ATATTTAAAAATCATGAAGTTGG + Intergenic
1034334877 7:150315159-150315181 ATACATACAAGTGATGAAGTAGG + Intronic
1035550662 8:521929-521951 GTACTTAGAAATAATGAAGGAGG - Intronic
1035687555 8:1536779-1536801 GGAAATAAAAATAAAGAGGTGGG - Intronic
1037215666 8:16448326-16448348 GTACATTTAAGTAATGAAGAGGG - Intronic
1037352050 8:17970723-17970745 TTATATGAAAATAATGAAGTAGG - Intronic
1037474717 8:19245667-19245689 GAACATAAAATAAATGAGGTGGG - Intergenic
1037650962 8:20838205-20838227 GGACATAAAAATTATGAGCTAGG + Intergenic
1038256510 8:25955527-25955549 GCACATAAAAAAAATGAAAACGG + Intronic
1039054610 8:33525601-33525623 GACCATAAAGATAAAGAAGTAGG + Intergenic
1039212607 8:35234905-35234927 ATTCATATAAATAAAGAAGTGGG - Intergenic
1040583898 8:48721744-48721766 GCACATCAAAAGAATGAAATTGG + Intronic
1040839997 8:51775050-51775072 GTACCTAAGTATAATGTAGTGGG + Intronic
1041071810 8:54132564-54132586 TTACATAATAACAATGAAGCCGG - Intergenic
1042124678 8:65526225-65526247 GTACTTAAAAATAGTTAAGATGG - Intergenic
1042522977 8:69733926-69733948 GTAGTTAAATATTATGAAGTTGG - Intronic
1043059353 8:75480514-75480536 ATACAAAAAATTAATAAAGTTGG - Intronic
1043654840 8:82650074-82650096 TTACATAAAAAAAGTGAAATAGG + Intergenic
1044702496 8:94977209-94977231 GTACATAAAAATATTGATATGGG + Intronic
1044850591 8:96423657-96423679 CCACATGTAAATAATGAAGTTGG - Intergenic
1044905203 8:96993389-96993411 GTATACAAAAATAATGATGTGGG + Intronic
1045024604 8:98074705-98074727 TTACAGAAAAATTATGAAGTTGG + Intronic
1045131287 8:99156707-99156729 GTACATAACAATAATGAAGCAGG - Exonic
1045257835 8:100544721-100544743 GTACAAAAATATTGTGAAGTAGG - Intronic
1045746897 8:105432939-105432961 AAACATAAAAATAATTAGGTGGG + Intronic
1046273969 8:111932629-111932651 GTACAATGAAATAATGGAGTTGG - Intergenic
1046280789 8:112027887-112027909 GCACATAAAAATAAAGAAATAGG - Intergenic
1046489015 8:114923040-114923062 GTAGAAAAATATAATGATGTAGG - Intergenic
1046768045 8:118091436-118091458 TTACAAAAAAATAAATAAGTCGG + Intronic
1047067802 8:121305897-121305919 GGACTTAAGAATAATGGAGTGGG + Intergenic
1047662403 8:127051843-127051865 GTACAGGAAAATAATAAAATAGG - Intergenic
1047668621 8:127120233-127120255 GCACATAGAAATAATAAAATGGG + Intergenic
1047909668 8:129514215-129514237 GTACCTACTGATAATGAAGTAGG + Intergenic
1048562667 8:135558733-135558755 CCACATGAAAATAATGAAGCAGG - Intronic
1048685388 8:136899269-136899291 GCACAGACAAAAAATGAAGTTGG + Intergenic
1050019888 9:1271774-1271796 GTCCAGAGAAAGAATGAAGTCGG - Intergenic
1050634830 9:7601022-7601044 GCACTTAAAAATCATTAAGTTGG + Intergenic
1050722365 9:8605187-8605209 AGACCTTAAAATAATGAAGTTGG + Intronic
1050791588 9:9477692-9477714 GTACCTAATAATAATAAAATTGG + Intronic
1050913805 9:11106806-11106828 GGAAATAAAAAAAAGGAAGTTGG + Intergenic
1051267724 9:15324717-15324739 TTACATCCAAAGAATGAAGTTGG + Intergenic
1051317218 9:15852773-15852795 CCATATAAAAAAAATGAAGTTGG - Intronic
1051688307 9:19681701-19681723 ATCCATAAAAATAAAGCAGTGGG + Intronic
1051770810 9:20577271-20577293 GCACAAAAAAATCATGAAGTAGG + Intronic
1051926682 9:22336097-22336119 GTATCTAAAAAAAATGGAGTGGG - Intergenic
1053125693 9:35579128-35579150 GTACAAAAATAGAATGAATTAGG - Intergenic
1053591232 9:39516632-39516654 GTTCATAAAAAGAAGCAAGTAGG - Intergenic
1054575076 9:66848661-66848683 GTTCATAAAAAGAAGCAAGTAGG + Intergenic
1054838189 9:69702650-69702672 CCACATAAATATAATGAAGTGGG - Intergenic
1055191360 9:73528511-73528533 ATAAATAAAAATTATCAAGTTGG + Intergenic
1055278229 9:74643596-74643618 TGCCATAAAAATATTGAAGTAGG + Intronic
1055345451 9:75331838-75331860 GTAAAAAAAAAAAATGATGTTGG + Intergenic
1055806412 9:80099095-80099117 GTCACTAAAAATAATGAAGTAGG - Intergenic
1055963174 9:81840083-81840105 GTACATAATAATAATAATTTTGG + Intergenic
1056779139 9:89536364-89536386 TTACATGAAAATATGGAAGTTGG + Intergenic
1058267490 9:102921570-102921592 GTATTTAAAAATAGTGAAGCTGG + Intergenic
1058362009 9:104158997-104159019 ATACATAAAAATCAAGAATTAGG + Intergenic
1059046632 9:110875817-110875839 CAATATAAAAATACTGAAGTTGG + Intronic
1060001410 9:119962205-119962227 GTATATTAAAATTAAGAAGTTGG - Intergenic
1060697438 9:125721419-125721441 GAAAAAAAAAATAATGAAATTGG + Intergenic
1061676645 9:132220830-132220852 CCACGTAAAAAGAATGAAGTTGG - Intronic
1062709366 9:137965564-137965586 ATAAATAAATAAAATGAAGTAGG - Intronic
1185881216 X:3742933-3742955 GTACATGAAAATAATTAAAATGG - Intergenic
1186310453 X:8312078-8312100 ATAAATAAAAATAAAGAAATCGG + Intergenic
1187227203 X:17384997-17385019 GGAAATAAAAATAATGAGGTAGG + Intronic
1187474007 X:19593646-19593668 TCACCTAACAATAATGAAGTCGG + Intronic
1187630500 X:21164577-21164599 GTAAAGAAAAACAATGAATTGGG + Intergenic
1188073365 X:25745166-25745188 GGACATAAAAATATTGAATGAGG + Intergenic
1188408070 X:29836953-29836975 GTACATAAAAATTATAATGAAGG + Intronic
1189425800 X:40898720-40898742 GTCCATAAAAATCAAGAAATAGG + Intergenic
1190029452 X:46957773-46957795 GCAGTTAAAAACAATGAAGTGGG - Intronic
1190568321 X:51754355-51754377 GTAAACAAAAAAAATCAAGTTGG - Intergenic
1192536354 X:71931558-71931580 GAACATGCAAAGAATGAAGTTGG - Intergenic
1192749952 X:73979101-73979123 GAACATAAAAATAATGAGCCAGG - Intergenic
1193219420 X:78905263-78905285 GCACTACAAAATAATGAAGTAGG - Intergenic
1193503659 X:82311247-82311269 CTACATGCACATAATGAAGTTGG - Intergenic
1193762229 X:85481182-85481204 GGACATAAAAATAATGAAAGGGG - Intergenic
1193889147 X:87021649-87021671 GCAAACAAAAATAGTGAAGTAGG + Intergenic
1193959935 X:87913180-87913202 TAACAAAAAGATAATGAAGTAGG + Intergenic
1194064360 X:89243131-89243153 ATATATAAAAATAATTAAGAGGG - Intergenic
1194583033 X:95699393-95699415 GTAAAAAAAAAATATGAAGTTGG - Intergenic
1194911514 X:99650728-99650750 GTACATATAAAAAAAGAATTGGG - Intergenic
1194950529 X:100120648-100120670 CTACATACAAATGATGAAGGGGG + Intergenic
1195837904 X:109139696-109139718 CAACATAAAAATAATGAATTTGG + Intergenic
1195902016 X:109808842-109808864 GTGCAAAAAAAAAATGAAGTGGG + Intergenic
1196360297 X:114846752-114846774 ATAAATAGAACTAATGAAGTTGG - Intronic
1196558447 X:117119623-117119645 TCACATAAAAATAATGCAGTAGG - Intergenic
1196626274 X:117880023-117880045 TTACATAAAAATAAATAAGCAGG - Intergenic
1196707940 X:118732067-118732089 GTACTTAAAAATGATTAAGATGG - Intronic
1196730853 X:118940183-118940205 ACACATTAAAAGAATGAAGTTGG + Intergenic
1196894756 X:120324270-120324292 GCACATCAAAAGAATGAAGTTGG - Intergenic
1197975917 X:132165776-132165798 GTACATAACCACAATGAATTTGG - Intergenic
1198040748 X:132849350-132849372 ATACAGAAAAAAAATCAAGTGGG + Intronic
1198712060 X:139515215-139515237 ATACTTAAGAAGAATGAAGTTGG - Intergenic
1199058237 X:143323199-143323221 GTAAAAAAAAAAAAAGAAGTAGG + Intergenic
1200718534 Y:6577206-6577228 ATATATAAAAATAATTAAGAGGG - Intergenic
1200928819 Y:8678654-8678676 TTACATAAAAATAAAGAACATGG + Intergenic
1202167048 Y:22000704-22000726 GTAAAAAAAAATAAGGAATTGGG + Intergenic
1202224312 Y:22585669-22585691 GTAAAAAAAAATAAGGAATTGGG - Intergenic
1202318802 Y:23609991-23610013 GTAAAAAAAAATAAGGAATTGGG + Intergenic
1202551966 Y:26060066-26060088 GTAAAAAAAAATAAGGAATTGGG - Intergenic