ID: 1118648747

View in Genome Browser
Species Human (GRCh38)
Location 14:67867678-67867700
Sequence AAACTGGGGCTCTCATAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118648747 Original CRISPR AAACTGGGGCTCTCATAGCG AGG Intronic
901909915 1:12448374-12448396 AAACAGGAGCTCTCATGGGGTGG + Intronic
1064686564 10:17867786-17867808 AAACTTGGGCTCTAAGAGCATGG - Intronic
1064856802 10:19777667-19777689 AAACTGGGGCTCACCAAGAGGGG + Intronic
1070664419 10:78333172-78333194 AAACTGGGGCTGCCATGACGGGG + Intergenic
1075580352 10:123613013-123613035 AAACTTGGGCTTTCAAAGCTTGG + Intergenic
1076541041 10:131214998-131215020 AAACAGGGGCACTCAGAGCTAGG + Intronic
1077416889 11:2428165-2428187 AAACAGGGACTCTAATAGCCTGG + Intergenic
1081546589 11:44076126-44076148 AAACTAGTGCTCTCTTAGCATGG + Intronic
1083667512 11:64284055-64284077 AAACTGGGGCTCTGAGAGTTTGG + Intronic
1084520889 11:69662107-69662129 AGACTTGGGCTCTCAAAGCCTGG + Intronic
1085295423 11:75428967-75428989 AAACTGAGGCTCACATACCATGG + Intronic
1093090364 12:14913449-14913471 ACACTGGGGCTTTCACAGTGTGG + Intergenic
1102227631 12:111240248-111240270 AAACTGGGCCTCCCAGAGGGTGG + Intronic
1102767515 12:115446430-115446452 CAACTGGGGCTCAAATAGCTCGG + Intergenic
1109734496 13:66464455-66464477 ACACTGGTTCTCTCATAGCAGGG - Intronic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1113958530 13:114112600-114112622 AACCCGGGGCTCTCCTAGCGGGG - Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1127282833 15:57506356-57506378 AGACTGTGGCTCTCATGGTGAGG + Intronic
1129233218 15:74208334-74208356 AACGTGGGGCTCTTATAGCTGGG - Intronic
1129326239 15:74801643-74801665 AGACTGGGGCTCCCATAGCAGGG - Intronic
1130336438 15:82960855-82960877 AATCTGGGGTCCTCATAGTGAGG + Intronic
1131798105 15:96041284-96041306 ACACTGGGCCTCTCAGAGAGTGG + Intergenic
1136756560 16:32689509-32689531 AAAGTGGGACTCTAATAGAGAGG - Intergenic
1136811550 16:33180864-33180886 AAAGTGGGACTCTAATAGAGAGG + Intergenic
1136818026 16:33290944-33290966 AAAGTGGGACTCTAATAGAGAGG + Intronic
1136824590 16:33347473-33347495 AAAGTGGGACTCTAATAGAGAGG + Intergenic
1136829656 16:33446244-33446266 AAAGTGGGACTCTAATAGAGAGG + Intergenic
1141169049 16:81679833-81679855 AAACTGGGGCTCCCAGAACCAGG - Intronic
1141249239 16:82339722-82339744 AAACTGGGGCTTTCAGAGGAAGG + Intergenic
1142114691 16:88350493-88350515 AAACTGAGGCTCTGAGAGGGAGG - Intergenic
1202990128 16_KI270728v1_random:3833-3855 AAAGTGGGACTCTAATAGAGAGG + Intergenic
1151560678 17:74867987-74868009 AAGCTGGAGGTGTCATAGCGGGG - Intronic
1151907201 17:77056363-77056385 AAAATGATGTTCTCATAGCGAGG - Intergenic
1155035119 18:22019587-22019609 ATACTTGGCCTCTCATAGCGTGG - Intergenic
1155976541 18:32138004-32138026 AAACTGGGTCTCTCATATACTGG + Intronic
1156845977 18:41665608-41665630 AATCTGGGTCTCTCAGAGCCAGG - Intergenic
1163385102 19:16995100-16995122 AAGCTGGGGCCCTCAAAGCCAGG + Intronic
1164562571 19:29302851-29302873 ACACAGGGGCTCTCAGCGCGTGG + Intergenic
1165384144 19:35500633-35500655 AAACTGGGGCTCTGAAAGCCCGG - Intronic
1167133685 19:47604004-47604026 AAACTGAGGCTCGCAAACCGAGG + Intergenic
925974987 2:9136131-9136153 AAACTTGAGGTCTCATAGCCAGG - Intergenic
926219964 2:10928919-10928941 AAAATGGGTCCTTCATAGCGAGG - Intergenic
927699260 2:25257667-25257689 AATCTGGGGTTCTCCTGGCGAGG - Intronic
929314666 2:40463019-40463041 AAAATGGGGCTTTCATCGTGGGG + Intronic
941638264 2:167959968-167959990 AAATTGAGGCTCACAAAGCGTGG - Intronic
942761149 2:179399766-179399788 AAACTGGGAATCTCATAGGAAGG - Intergenic
948817255 2:240518425-240518447 AAATTGGGGGTTTCATAGCAGGG - Intronic
1173699743 20:45058374-45058396 AAATTGGGGATTTCTTAGCGTGG - Intronic
1174043563 20:47717196-47717218 AACCAGTGGCTCTCAAAGCGTGG - Intronic
1174173994 20:48633668-48633690 AAGCAGGGGTTCTCAGAGCGTGG - Intronic
1179933238 21:44585957-44585979 ACACTGGGGCTCTCAGGGTGGGG + Intronic
1181915443 22:26276054-26276076 AAACTGGGGCTCTGAGAGAGAGG - Intronic
1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG + Intronic
953925952 3:46982463-46982485 CAACTGGGGGCCTCATAGTGAGG + Intronic
954914457 3:54136898-54136920 AAACAGTGTCTCTCAAAGCGTGG - Intronic
956770969 3:72525707-72525729 AAACTGAGGCTCTCATAGCTTGG - Intergenic
956901963 3:73726225-73726247 AAACTGGGGCTCTGTGAGGGAGG + Intergenic
961093572 3:124136403-124136425 GATCAGGGGCTCTCATAGCAAGG - Intronic
967648890 3:191961441-191961463 AAAATGGGGCTCACTCAGCGAGG - Intergenic
968621157 4:1604055-1604077 ACACTGGGGCCATCATCGCGGGG + Intergenic
973554900 4:52073058-52073080 GAATGGGGGCTCTCATAGCCTGG - Intronic
979191177 4:117860481-117860503 AAACTGGGTCTCTCATATCAGGG + Intergenic
980959017 4:139455940-139455962 AAACTGGGTCTCACATCCCGGGG + Intronic
983534873 4:168846746-168846768 AAGCTGAGGCTCTCAAAGTGTGG + Intronic
992006266 5:72480914-72480936 ATACAGGGGCTCTTAAAGCGTGG - Intronic
998447392 5:142208946-142208968 AAACTGGAGCTCTCACACCGTGG - Intergenic
1006318435 6:33304686-33304708 AAACTGAGGGTCTCTTAGGGAGG - Intronic
1007276759 6:40679772-40679794 AAACTGGGGCTCTCTGAGGATGG - Intergenic
1009059947 6:58386998-58387020 AGACTGTGGCTCTCACAGAGAGG + Intergenic
1018331887 6:162738085-162738107 AAGCTGTGGCTCTCTTAGTGAGG - Intronic
1028845308 7:95473419-95473441 AACCTGTGGCTCTCACAGCCAGG - Intergenic
1030339930 7:108366014-108366036 AGACTGGGGCCCTCATAGAAGGG + Intronic
1032428181 7:131838490-131838512 AATCTGGGGCTTCCATAGCTGGG + Intergenic
1038552519 8:28482277-28482299 AAATAGTGCCTCTCATAGCGGGG + Intronic
1046388568 8:113537248-113537270 ACACTGGGGCTATCAGAGAGTGG - Intergenic
1048977077 8:139679107-139679129 AAACTGGGGTTCTCTTAGTGAGG - Intronic
1058719093 9:107747416-107747438 AAACTGGGCATCTCAGAGCACGG - Intergenic
1188280319 X:28260128-28260150 AATCTGGGGCTCTGACAGCTTGG + Intergenic
1188593754 X:31871464-31871486 AAACTGAGGCTCACAGAGAGAGG + Intronic
1190907279 X:54739391-54739413 ACACTGGGGCTCACAAAGAGTGG - Intergenic