ID: 1118649957

View in Genome Browser
Species Human (GRCh38)
Location 14:67880759-67880781
Sequence TTTACGTTGTTGGTGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118649953_1118649957 25 Left 1118649953 14:67880711-67880733 CCTTTACTTGTCTGGTAATTTTT 0: 1
1: 0
2: 5
3: 38
4: 501
Right 1118649957 14:67880759-67880781 TTTACGTTGTTGGTGGGTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118649957 Original CRISPR TTTACGTTGTTGGTGGGTGC TGG Intronic
906732941 1:48098826-48098848 TTTATGATGTTGCTGGGTGGTGG + Intergenic
915821727 1:159031179-159031201 TCAGCGTTGTTGGTGGGTGATGG - Intronic
916437647 1:164791818-164791840 TTTACCTTTTTGGGGGGTGGGGG + Intronic
916921070 1:169467596-169467618 TTCACATTGTTGTTGGGTGTTGG + Intronic
920537337 1:206746869-206746891 TTTTAGTTTTTGGTGGTTGCTGG + Intergenic
920633506 1:207676552-207676574 TTTACGTGAATGGAGGGTGCAGG - Intronic
921794435 1:219326285-219326307 TTTTTGTTTTTGGTGGGTGGGGG + Intergenic
923151874 1:231241013-231241035 TTTACGACTTTGGTGAGTGCGGG - Exonic
1064225334 10:13478781-13478803 TTTATGTTGTTGGTGGCTTATGG + Intronic
1068182883 10:53545380-53545402 TTGACATTCCTGGTGGGTGCCGG + Intergenic
1069240322 10:66130159-66130181 TGTATGTTTGTGGTGGGTGCAGG - Intronic
1069901538 10:71709224-71709246 ATCACTGTGTTGGTGGGTGCGGG - Intronic
1071800242 10:89051803-89051825 TTCATGTTGATGCTGGGTGCAGG + Intergenic
1072454024 10:95560988-95561010 TTTCCTTTTTTGGTGGGTGTGGG - Intronic
1074872773 10:117590082-117590104 TCTAAGTTGTGGGTGGGTGGTGG + Intergenic
1075708207 10:124515554-124515576 TTTACCTTCTTTTTGGGTGCTGG + Intronic
1077377503 11:2211951-2211973 TTTTCGTGGTTGGTGCATGCCGG - Intergenic
1085264947 11:75231760-75231782 TCTACATTCTAGGTGGGTGCTGG + Intergenic
1087868855 11:103266545-103266567 TTTGCGATGGTGGTGGGTGGTGG + Intronic
1089603319 11:119627922-119627944 TTTCTGTTGTTTGTGGGTCCTGG + Intronic
1091837236 12:3594517-3594539 TTTGCGTGGTTGGGGAGTGCTGG + Intergenic
1096622495 12:52873226-52873248 TTTTCCTTGGTGGTGGGGGCAGG + Intergenic
1098930823 12:76410833-76410855 TTCACGATGTTGGTGGGTTCAGG - Intronic
1099191774 12:79568643-79568665 TTTACTGTTTTGGTGGGTGGAGG - Intergenic
1101829396 12:108245603-108245625 TCTGTGTTGTTGCTGGGTGCTGG + Intronic
1102631406 12:114283951-114283973 TTCACTTTGTAGATGGGTGCTGG - Intergenic
1105513033 13:21066941-21066963 TTTTCGTTTTTGTTGGGTGGGGG + Intergenic
1107480331 13:40780870-40780892 TTTTTGTTGTTGGGGGGTGGGGG - Intergenic
1110598102 13:77341050-77341072 TGTAGGTTGGTGGTGGGGGCAGG + Intergenic
1110914543 13:81005374-81005396 TTTACTTTGTTTGTGATTGCGGG + Intergenic
1113188895 13:107721300-107721322 TATTCCTTGTTGCTGGGTGCTGG - Intronic
1113458551 13:110465886-110465908 TATATGTTGCTGGTGGGGGCAGG - Intronic
1113772685 13:112920688-112920710 GTTGGGTTGTGGGTGGGTGCTGG + Intronic
1117154980 14:52929807-52929829 TGTTTGTTGTTGGTGGGTGGGGG + Intronic
1117696578 14:58370621-58370643 TTTTTGTTGTTGGGGGGTACAGG + Intronic
1118649957 14:67880759-67880781 TTTACGTTGTTGGTGGGTGCTGG + Intronic
1124959473 15:34383691-34383713 CTTAAGTTGTTGGTGGGGGGGGG + Intronic
1124976099 15:34529912-34529934 CTTAAGTTGTTGGTGGGGGGGGG + Intronic
1125208814 15:37186967-37186989 TTTACACTGTTGGTGGGAGTGGG + Intergenic
1129694330 15:77731994-77732016 TTGCCGTGGTTGGTGGCTGCTGG - Intronic
1135101454 16:19609875-19609897 TTCACATTGTTGGTGGTTGGAGG + Intronic
1139848476 16:69936567-69936589 TTTGCCTTGATGGTGGCTGCTGG + Intronic
1140050010 16:71472226-71472248 TTTAAGCTGCTGGTGGCTGCCGG - Intronic
1144251207 17:13418576-13418598 TTTTTTTTTTTGGTGGGTGCTGG + Intergenic
1147355159 17:39889838-39889860 TTTTTGTTGTTGTTGGGTGGGGG + Intergenic
1147642174 17:42009806-42009828 TTTAAATTTTTGATGGGTGCTGG - Intronic
1148727919 17:49809097-49809119 TTGACGTTGTTGATGGTTGCAGG + Exonic
1154029194 18:10736417-10736439 ATTACGGTGTTGCTGGGAGCAGG + Intronic
1158887768 18:61845063-61845085 TTTATTTTGTTGGTGGGTGGTGG + Intronic
1159410156 18:68062739-68062761 TTTACATTGTTTGTATGTGCTGG + Intergenic
1160706662 19:533023-533045 TTTTTGTTGTTGTTGGGAGCGGG + Intronic
930194068 2:48491283-48491305 TACAGGTTGTTGGTGGGTGTTGG + Intronic
936273947 2:111075734-111075756 TATAAGTTGTTGTGGGGTGCAGG - Intronic
937207079 2:120243629-120243651 TTGATGCTGTTGGTGGGTGTGGG + Intronic
938877805 2:135552189-135552211 TTTTCTTTTTTGGGGGGTGCGGG + Intronic
947996874 2:234535200-234535222 TTTAGGCTGTAGGTTGGTGCTGG - Intergenic
949006565 2:241652729-241652751 ATTGGGTTGTTGGTGGGTGACGG + Intronic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172688441 20:36774323-36774345 TTTACTTGCTTGGTGGGTGGGGG + Intergenic
1172704580 20:36873390-36873412 CTTATGTTGTTTGTGGGTGCTGG - Intergenic
1173946591 20:46956136-46956158 TTTAGGTTTTTTGTGGGAGCAGG + Intronic
1179959944 21:44762552-44762574 GTTACGTGGCTGGTGGGGGCAGG + Intergenic
1183353056 22:37344245-37344267 ATTGCGTTGTAGGTGGGTGTGGG - Intergenic
949489054 3:4569950-4569972 TTTAAATTGTTGGTTGGTGGAGG + Intronic
951182467 3:19674572-19674594 TTTATGTTAATTGTGGGTGCTGG + Intergenic
951778176 3:26333645-26333667 TCTAAGTTGTTGGTGGCTTCCGG + Intergenic
956856147 3:73276732-73276754 TTTATGTTGTTGTTGGGAGCTGG - Intergenic
958701119 3:97591555-97591577 TTTGTTTTGTTGGTGGGTGGGGG + Intronic
963242141 3:143017061-143017083 TTTTCGTTTTTGGTGGGGGCAGG + Intronic
966684486 3:182679230-182679252 TTTACTTGGTGGGTGGGTGGGGG + Intergenic
967466111 3:189807892-189807914 TTGAGGTTGTTGGTGGGGGTTGG - Intronic
974418164 4:61637759-61637781 TTGACGTTTTTGGGGGGTGGGGG - Intronic
975606609 4:76161430-76161452 ATTTTGTTGTTGTTGGGTGCTGG - Exonic
976124190 4:81816096-81816118 TTTACCTTTTTGGTGGGGGAGGG - Intronic
982763750 4:159319419-159319441 TTTCCACTCTTGGTGGGTGCGGG - Intronic
983248677 4:165319830-165319852 TTTTGGTTTTTGGTGGGTGCAGG + Intronic
983563600 4:169126457-169126479 TTACTGTTGTTGGTGGGTTCAGG - Intronic
989552446 5:42751673-42751695 ATAACATTGTTGGTGGGGGCAGG - Intergenic
990013170 5:51024950-51024972 TTTATGTTGTTGGTGGAATCTGG + Intergenic
991226999 5:64285228-64285250 TATACTTTGTTTGGGGGTGCTGG + Intronic
992104488 5:73438165-73438187 TTTAGGGAGTTGGTGGGCGCGGG - Intergenic
998430130 5:142063495-142063517 TTTACATTTTTGGGGGGTGCAGG - Intergenic
1002938987 6:1699482-1699504 CTTACGTTCTTGGTGTGGGCAGG + Intronic
1017384626 6:153869154-153869176 TTTAAGTTCTTTGTGGGTTCTGG - Intergenic
1021189028 7:17599157-17599179 TTTACTTTGTTGATGGCTGTTGG - Intergenic
1022959877 7:35416240-35416262 TTTACGTTTTAAGTGGGAGCTGG - Intergenic
1023164854 7:37333451-37333473 TTTGCTCTGTAGGTGGGTGCTGG - Intronic
1035109202 7:156466376-156466398 TTTAAGTGGCTGGTGGGTGAGGG - Intergenic
1036287050 8:7452150-7452172 TGTATGTTGTTAGTGGATGCAGG - Intronic
1036334431 8:7859372-7859394 TGTATGTTGTTAGTGGATGCAGG + Intronic
1038000624 8:23388268-23388290 TTTAAGTTGTTGCAAGGTGCGGG - Intronic
1038311157 8:26447397-26447419 TTTACGTTTTTAGTGGAGGCGGG + Intronic
1041164752 8:55080265-55080287 TTTTCGTTTTTGGGGGGTGCGGG + Intergenic
1045123196 8:99061075-99061097 TTGAAGTTGATGGTGGTTGCAGG + Intronic
1050881641 9:10707358-10707380 ATTAAGTTGTTGGTGGGAGTGGG + Intergenic
1052728911 9:32262521-32262543 TTCAAGCTGTTGGTTGGTGCTGG - Intergenic
1058195629 9:101971422-101971444 TTTAAGTTTTTGGGGGTTGCAGG - Intergenic
1060511734 9:124239688-124239710 TTTACCTTGTTGGTAATTGCAGG - Intergenic
1061943914 9:133897925-133897947 TTTCTGAAGTTGGTGGGTGCTGG - Intronic
1061973824 9:134058450-134058472 TTTACTTTGTTTCTGGGAGCTGG - Intronic
1195333783 X:103830188-103830210 TTGATGTTGTCGGTGGGTGCTGG + Intronic
1198669479 X:139063812-139063834 ATTACCTTATTGTTGGGTGCAGG + Intronic
1199460795 X:148082714-148082736 TTTGTGTTATTGGTAGGTGCAGG + Intergenic
1201898921 Y:19026104-19026126 TTTAAGTTGTTGGTAGCTTCTGG + Intergenic