ID: 1118654459

View in Genome Browser
Species Human (GRCh38)
Location 14:67932419-67932441
Sequence CACTTTTTGGGCCCTATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118654459 Original CRISPR CACTTTTTGGGCCCTATTGG TGG Intronic
903585079 1:24408556-24408578 CAGTTTTTAGGCCATATTGTAGG - Intronic
905982478 1:42241890-42241912 CAGTTCTTGGGCCCTGGTGGTGG - Intronic
909178031 1:72384510-72384532 CACTTACTGGGGCCTATCGGGGG - Intergenic
913352048 1:117872668-117872690 CACTTACTGGGGCCTGTTGGGGG + Intronic
917242519 1:172964160-172964182 CACATATTGGGGCCTGTTGGAGG + Intergenic
917361282 1:174178813-174178835 CACATACTGGGGCCTATTGGGGG + Intronic
917390295 1:174529508-174529530 CAGTATTTGGGGCCTAGTGGTGG + Intronic
922682174 1:227609493-227609515 CACACATTGGGGCCTATTGGAGG - Intronic
923102226 1:230825944-230825966 CAGTTTTAGGGCCCCATGGGAGG - Intergenic
924862887 1:247944468-247944490 CACTTACTGGGGCCTGTTGGGGG - Intronic
1065445699 10:25796023-25796045 CACATACTGGGGCCTATTGGGGG + Intergenic
1067138551 10:43633949-43633971 CACACATTGGGGCCTATTGGAGG - Intergenic
1068196667 10:53726607-53726629 CTCTTTTGGGGCCCTACTGCTGG + Intergenic
1068253054 10:54469568-54469590 CAGTCTTTGGCCCCCATTGGCGG + Intronic
1068409507 10:56636580-56636602 CACTTACTGGGGCCTGTTGGTGG - Intergenic
1069300870 10:66905351-66905373 CACACTCTGGGGCCTATTGGGGG + Intronic
1071063263 10:81599514-81599536 CACTCACTGGGGCCTATTGGAGG + Intergenic
1071119583 10:82261917-82261939 CAGTTTTGGGGCCAGATTGGGGG + Intronic
1075385940 10:122055539-122055561 CACATACTGGGGCCTATTGGAGG + Intronic
1085418698 11:76337259-76337281 CCCATTTTGGGTCCTTTTGGAGG - Intergenic
1086123428 11:83325873-83325895 CAGTCTTTGGGCCCCAGTGGTGG + Intergenic
1087378638 11:97376632-97376654 CACATACTGGGGCCTATTGGAGG - Intergenic
1087757703 11:102072991-102073013 CAGTTTTTGGGCCCCAGTAGTGG + Intronic
1089003974 11:115075320-115075342 CACTTTGTGGGCCCTGTTACTGG - Intergenic
1091911927 12:4239945-4239967 CAATCTTTGGGCCCCAGTGGTGG + Intergenic
1094286271 12:28797756-28797778 TATATTTTGGGTCCTATTGGTGG + Intergenic
1094773174 12:33689975-33689997 CACATGCTGGGGCCTATTGGAGG + Intergenic
1095565664 12:43621043-43621065 CAGTCTTTGGGCCCTAGTGGTGG + Intergenic
1095686273 12:45038596-45038618 CACTTTTAGGGCCCTAGGGTTGG - Intronic
1095686285 12:45038678-45038700 CACTTTTAGGGCCCTAGGGTTGG - Intronic
1096381979 12:51166534-51166556 CACTTTTTGGGCACTCATGCAGG - Intronic
1098302742 12:69070635-69070657 AACTTTTAGGGGCATATTGGTGG - Intergenic
1099917592 12:88915006-88915028 CAGTCTTTGGGCCCTAGTGGTGG + Intergenic
1105333663 13:19442603-19442625 CAAATTTTTGGCCTTATTGGTGG - Intronic
1105922308 13:24975167-24975189 CAAATTTTTGGCCTTATTGGTGG - Intergenic
1106611643 13:31288524-31288546 CAGTCTTTGGGCCCCAGTGGTGG - Intronic
1107262713 13:38514374-38514396 CACTCACTGGGGCCTATTGGAGG - Intergenic
1107587025 13:41861557-41861579 CACTTTTAGGAGCCTTTTGGTGG - Intronic
1108468615 13:50744900-50744922 CACTTTTTGGTCTCTATTTATGG - Intronic
1109155599 13:58905950-58905972 CAGTTCTTGGGCCCCAGTGGTGG + Intergenic
1110258795 13:73461686-73461708 CACATACTGGGGCCTATTGGAGG + Intergenic
1110909573 13:80939754-80939776 CAGTCTTTGGGCCCCAGTGGTGG + Intergenic
1112061150 13:95741430-95741452 CAGTTCTTGGGCCCTAGTGGGGG + Intronic
1114546942 14:23509957-23509979 CACTTTCTGGGTCCTATTGTTGG - Intergenic
1118654459 14:67932419-67932441 CACTTTTTGGGCCCTATTGGTGG + Intronic
1121373356 14:93381522-93381544 CGCTTCTTGAGCACTATTGGTGG - Intronic
1124366342 15:29074022-29074044 AACTTTTTGGGCACTCTTGGTGG + Intronic
1127047486 15:55042867-55042889 CAGTTCTTGGGCCCTACTGATGG + Intergenic
1127793819 15:62421654-62421676 CACACTCTGGGGCCTATTGGAGG + Intronic
1132334414 15:101036975-101036997 CAGTCTTTGGGCCCCAGTGGTGG + Intronic
1134652212 16:15918670-15918692 CACATATTGGGGCCTGTTGGGGG + Intergenic
1135180089 16:20265298-20265320 CACACATTGGGGCCTATTGGAGG - Intergenic
1136224355 16:28848629-28848651 CACTTTTTGGGGTTTAGTGGTGG - Intronic
1140326025 16:74004812-74004834 CAGTTTTCAGGCCCCATTGGTGG + Intergenic
1141912243 16:87067962-87067984 CACTTTTTGGGATTTATTTGAGG - Intergenic
1146421748 17:32693282-32693304 CATTTTCTGGCCCCTATAGGTGG - Intronic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1148082136 17:44972886-44972908 CACTTTGGGAGGCCTATTGGGGG - Intergenic
1153272916 18:3341077-3341099 CACACACTGGGCCCTATTGGAGG + Intergenic
1158307718 18:56125044-56125066 CACTTACTGGGGCCTATTGGGGG - Intergenic
1158575606 18:58635039-58635061 CACATATTGGGACCTGTTGGGGG - Intergenic
1159172150 18:64784867-64784889 CACATATTGGGACCTGTTGGGGG + Intergenic
1164243768 19:23413136-23413158 CACATACTGGGGCCTATTGGAGG - Intergenic
1167390652 19:49192657-49192679 CACACATTGGGGCCTATTGGAGG + Intronic
925377404 2:3397904-3397926 CACTTTTTGGACCACATTGCAGG - Intronic
925643199 2:6006930-6006952 CACACATTGGGCCCTGTTGGAGG - Intergenic
928622374 2:33104011-33104033 AACTTTTTGTGGCCTATTGGGGG + Intronic
928751213 2:34472477-34472499 CACATGTTGGGGCCTGTTGGGGG + Intergenic
935521644 2:104113483-104113505 CACTCTCTGGGGCCTGTTGGAGG + Intergenic
937679849 2:124632534-124632556 CACTTATTGGGGCCTGTTAGGGG + Intronic
941268930 2:163400962-163400984 CACTTTTTGTGCCCTCCTGGTGG + Intergenic
944260099 2:197667801-197667823 CAGTCTTTGGGCCCCAGTGGTGG + Intronic
944989746 2:205221933-205221955 CACACTCTGGGGCCTATTGGAGG + Intronic
946188001 2:217992103-217992125 CACCTTTTGGGCCCCACTGCGGG + Intronic
947939408 2:234036145-234036167 CAGTCTTTGGGCCCCACTGGTGG - Intergenic
1170064656 20:12298655-12298677 CAGTTCTTGGGCCCCAGTGGTGG + Intergenic
1170240768 20:14164313-14164335 CAGTTTTGGGGCCCCAGTGGTGG + Intronic
1176116711 20:63434854-63434876 CACTTTTTGGTTCCTATGAGTGG + Intronic
1177376265 21:20274230-20274252 CACACATTGGGGCCTATTGGAGG - Intergenic
1177690896 21:24506029-24506051 CACATATTGGGGCCTATTGGAGG - Intergenic
1178142724 21:29702124-29702146 CACACATTGGGGCCTATTGGAGG + Intronic
1185023634 22:48395168-48395190 CACTTTTTGCTCCCTATGTGGGG - Intergenic
949395215 3:3607493-3607515 GACTTTTTGGGCACTGTTGCAGG - Intergenic
951202658 3:19892108-19892130 AACTTTATGGGCCCTACTGTTGG - Intronic
951258583 3:20480598-20480620 CACTTTTTGGGCCCTTTATCTGG + Intergenic
955000328 3:54921558-54921580 CACTTTTTGTGGTCTATTTGAGG + Intronic
958930146 3:100199074-100199096 CAGTTTTTGGGCCCCAGTGATGG - Intergenic
961723483 3:128910850-128910872 CACTTCTAGGCCCCTATTGATGG + Intronic
962955744 3:140265160-140265182 CACTGTTTGGGCCCAATTCCTGG - Intronic
963615941 3:147538264-147538286 CAATATTTGTGCACTATTGGTGG + Intergenic
964746944 3:160021271-160021293 CACTTTCTGGGCACTAGTGCTGG - Intronic
965033566 3:163405370-163405392 CACATACTGGGGCCTATTGGAGG - Intergenic
966499680 3:180625843-180625865 CTGTCTTTGGGCCCCATTGGTGG + Intronic
966854554 3:184185310-184185332 CACTTTTAGAGACCAATTGGAGG + Intronic
967823559 3:193860637-193860659 GAATTTTAGGGCCCTACTGGTGG + Intergenic
969169622 4:5349258-5349280 CAGTCTTTGGGCCACATTGGTGG - Intronic
970884846 4:20976394-20976416 CACTTATTGGCTCCTATTTGTGG + Intronic
972841503 4:42935335-42935357 CACATTTTGAGAACTATTGGGGG + Intronic
974911988 4:68133390-68133412 CAGTCTTTGGGCCCCAGTGGTGG - Intergenic
976168806 4:82282906-82282928 CACTTTTTTGGTCCTCTTGGAGG - Intergenic
976460199 4:85302369-85302391 CACAGTTTGGGCCCTGGTGGGGG + Intergenic
976653281 4:87459264-87459286 CACATTCTGGGGTCTATTGGAGG + Intronic
976795715 4:88930551-88930573 CAGTATTTGGGCCCTGGTGGTGG + Intronic
976983267 4:91259601-91259623 CACATATTGGGGCCTGTTGGAGG - Intronic
979033796 4:115685732-115685754 CACATGTTGGGGCCTTTTGGAGG - Intergenic
980755510 4:137154300-137154322 CACACGTTGGGGCCTATTGGAGG - Intergenic
986418943 5:7557536-7557558 CACACTCTGGGGCCTATTGGAGG - Intronic
986908671 5:12526525-12526547 CACTTTTTGGATTCTATTTGCGG - Intergenic
986908766 5:12527723-12527745 CAGATTTTGGGGCCTATTTGAGG - Intergenic
987738371 5:21873795-21873817 CACTCATTGGGGCCTGTTGGGGG - Intronic
988656844 5:33221129-33221151 CACTTAGTGGGGCCTGTTGGGGG + Intergenic
989231102 5:39086890-39086912 CAGTCTTTGGGCCCCAGTGGTGG - Intergenic
993219710 5:85076424-85076446 CACACTCTGGGGCCTATTGGAGG - Intergenic
993921089 5:93803534-93803556 CACATACTGGGGCCTATTGGAGG + Intronic
994061937 5:95487477-95487499 CAGTCTTTGGGTCCTAGTGGTGG - Intronic
994712632 5:103283906-103283928 CCAGTTTTGGGCCCTATTTGGGG + Intergenic
996928566 5:128858619-128858641 CACACACTGGGCCCTATTGGAGG - Intronic
997049220 5:130358894-130358916 CACACATTGGGGCCTATTGGAGG + Intergenic
998752772 5:145340879-145340901 CAGTCTTTGGGCCCTAGTGGTGG - Intergenic
1000238531 5:159387076-159387098 CAGTCTTTGGGCCCCAGTGGTGG + Intergenic
1006261212 6:32872943-32872965 CACATACTGGGGCCTATTGGAGG - Intergenic
1008083953 6:47224150-47224172 CACACATTGGGGCCTATTGGAGG + Intergenic
1010619488 6:78056476-78056498 CACATACTGGGGCCTATTGGAGG - Intergenic
1012952032 6:105528570-105528592 CACATGCTGGGGCCTATTGGAGG + Intergenic
1016248249 6:142013835-142013857 CACTTTCTGGGAATTATTGGTGG - Intergenic
1017974081 6:159338738-159338760 CAATCTTTAGGCCCTAGTGGTGG - Intergenic
1018636570 6:165865071-165865093 CAATTTTTGGGCACAAATGGTGG - Intronic
1020750358 7:12133178-12133200 CACTCACTGGGGCCTATTGGAGG + Intergenic
1022497301 7:30861151-30861173 CTCTATTTGGGCCCTCTGGGAGG - Intronic
1022747989 7:33192105-33192127 CACTGGTTGGGCCCTTTAGGTGG - Intronic
1023270539 7:38456870-38456892 CAGTCTTTGGGCCCCAGTGGAGG - Intronic
1023424108 7:40016161-40016183 CAGTTTTTGGTACCTCTTGGAGG + Intronic
1025018625 7:55463639-55463661 CAGTCTTTGGGCCCCAGTGGTGG + Intronic
1026357421 7:69571005-69571027 CACTTTTCGGGTCCTTTTGAAGG - Intergenic
1029561222 7:101303839-101303861 CAGTATTTGGGCCCCAGTGGTGG - Intergenic
1035714855 8:1746210-1746232 CACTTTTTAGGGCTTATTGTTGG - Intergenic
1037970843 8:23170822-23170844 CTCTTTTTGGGCTTTTTTGGGGG - Intergenic
1040028125 8:42800405-42800427 CAGTTTTTGGGCCTTTCTGGGGG + Intergenic
1042129963 8:65578826-65578848 CAGTCTTTGGGCTCTAGTGGTGG + Intergenic
1042649384 8:71023473-71023495 CAATCCTTGGGCCCTAGTGGTGG + Intergenic
1043198299 8:77329695-77329717 CAGTTTTTAGGCCCCGTTGGTGG + Intergenic
1043751581 8:83943183-83943205 CAGTCTTTGGGCCCCAGTGGTGG + Intergenic
1043992013 8:86766671-86766693 CACATTCTGGGGCCTATCGGAGG + Intergenic
1044154286 8:88823896-88823918 CACTCTTTGGGCCCTATGCAGGG - Intergenic
1044200787 8:89432885-89432907 CACTTTTTGGATCTTTTTGGGGG + Intergenic
1048123188 8:131604728-131604750 CACACAATGGGCCCTATTGGTGG - Intergenic
1049708939 8:144055095-144055117 CCCTCTTTGGGCCCGATGGGGGG - Exonic
1050608746 9:7329161-7329183 CATTTTTTGGTCCCTAGTGAAGG + Intergenic
1050872521 9:10591662-10591684 CATATTTGGGGCCTTATTGGAGG - Intronic
1051115705 9:13691990-13692012 CACATACTGGGGCCTATTGGAGG - Intergenic
1053030866 9:34777080-34777102 CAGTCTTTGGGCCCCATTGGTGG + Intergenic
1055208773 9:73763978-73764000 CACATCCTGGGACCTATTGGAGG + Intergenic
1056385940 9:86097613-86097635 CAGTTGATGGGCACTATTGGTGG - Intronic
1186952655 X:14644236-14644258 CACTATTTGGGCACTATTATGGG - Intronic
1187779993 X:22809949-22809971 CCCTTTTTGTGCGCTATAGGTGG + Intergenic
1187794356 X:22985941-22985963 CACTCCCTGGGGCCTATTGGAGG - Intergenic
1188224738 X:27583465-27583487 CTCTTTTTGGGCCCTCTCAGTGG + Intergenic
1188371974 X:29379797-29379819 AACATTTTGGTCCCTCTTGGCGG + Intronic
1193056280 X:77154699-77154721 CACATATTGGGGCCTTTTGGGGG + Intergenic
1193484444 X:82069401-82069423 CACACATTGGGGCCTATTGGAGG - Intergenic
1193493961 X:82187678-82187700 CAGTCTTTGGGCCCTCTTAGTGG + Intergenic
1194878753 X:99223180-99223202 CACACATTGGGGCCTATTGGCGG - Intergenic
1195566449 X:106344949-106344971 CATGTTTTGAGCCCTCTTGGAGG - Intergenic
1199066493 X:143425089-143425111 CACACGTTGGGGCCTATTGGAGG - Intergenic
1200358701 X:155578803-155578825 CAGTTTTGGGGCCCCAGTGGTGG - Intronic
1200870847 Y:8096607-8096629 CACATTTTGGGTCCTGTTGTGGG - Intergenic