ID: 1118654682

View in Genome Browser
Species Human (GRCh38)
Location 14:67933874-67933896
Sequence CTGACTCAGCAGGAGCATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118654682 Original CRISPR CTGACTCAGCAGGAGCATAG AGG (reversed) Intronic
900109899 1:1000966-1000988 CGAACTCAGCAGCAGCAAAGTGG + Intergenic
901953570 1:12768670-12768692 CTGGCTCAGCAGGAGCCCTGTGG - Intergenic
902082902 1:13833465-13833487 CTGGCTCAGCAGGTGCAGCGTGG - Intergenic
903623375 1:24714277-24714299 CAGACCCAACAGGAGCAGAGTGG + Intergenic
903857315 1:26344830-26344852 ATGAGGCAGCAGGAGCACAGGGG + Exonic
908826364 1:68136331-68136353 ATGATCCAGCAGGAGCATAAAGG + Intronic
909301038 1:74013715-74013737 TTGACTCACCAGGAGCTGAGAGG - Intergenic
911084491 1:93965114-93965136 CTGATTCACCAGGAGCAAACAGG - Intergenic
911090765 1:94015308-94015330 CTGACTCAGGAGGAGCTTTTTGG + Intronic
914573441 1:148941970-148941992 CTGATTCAGCTGGAGTATGGAGG + Intronic
916231870 1:162548832-162548854 CTGACCCAGCAGGGGCACAAAGG - Intergenic
918005737 1:180540608-180540630 CTGACTCACCTGGAGCTCAGAGG + Intergenic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
1063238456 10:4143613-4143635 CTGCCTCAGCAGGAGATTACAGG + Intergenic
1063951416 10:11226653-11226675 CTGCCACAGCAGGGGCATCGGGG + Intronic
1065825456 10:29566718-29566740 CTGAGTCAGAAGAAGCAGAGAGG - Intronic
1065951909 10:30659866-30659888 CTGAGTCAGAAGAAGCAGAGAGG + Intergenic
1066321742 10:34309515-34309537 CTTGCTCAGCAGGAGTACAGTGG - Intronic
1066690753 10:38025494-38025516 CTCACTCACCATGTGCATAGAGG + Intronic
1067058199 10:43064546-43064568 CTGACCCAGCAGGAGCTCAGGGG + Intergenic
1067819963 10:49519888-49519910 CTGAGGCAGCAGGTGCAGAGTGG - Intronic
1068632116 10:59308833-59308855 CTGACTCAGCACGAGCTTTAGGG - Intronic
1069351052 10:67527950-67527972 CAGAATGAGCAGGAGCATTGTGG - Intronic
1069990167 10:72310332-72310354 CTGAATCAGCGGGAGCCTTGCGG + Intergenic
1070621192 10:78012668-78012690 CTGACCCAGCAATAGCACAGTGG - Intronic
1070787815 10:79172222-79172244 CTGACCAAGCAGGAACATGGCGG + Intronic
1071306869 10:84307215-84307237 CTGACTCAGCAGGATCTTGCTGG + Intergenic
1072056905 10:91767208-91767230 AAAACTCTGCAGGAGCATAGAGG - Intergenic
1075794133 10:125106868-125106890 CAGACTCACCAGGAGAATGGAGG + Intronic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1081866176 11:46361865-46361887 CTGGCTCAGCAGGAGCTCGGGGG - Intronic
1082184777 11:49165523-49165545 CTGACTCAGGAGGAGTTTTGGGG + Intronic
1083733736 11:64667901-64667923 CTGGCCCAGCAGGAGCATGGTGG + Intronic
1085338732 11:75717725-75717747 CTGCCTCAGCAGGGGCAAGGAGG + Intergenic
1085612552 11:77965173-77965195 CTGACTCAGCCTGAGAATACAGG + Intronic
1085879524 11:80449382-80449404 CTGTTTCTGCAGCAGCATAGTGG - Intergenic
1086681563 11:89679836-89679858 CTGACTCAGGAGGAGTTTTGGGG - Intergenic
1089354306 11:117839912-117839934 CTGACTCTGGGGGAGCAAAGAGG + Intronic
1089765032 11:120757054-120757076 CTGACACAGCAGCAGCATCGTGG + Intronic
1089912580 11:122116938-122116960 CTTACTTAGCAGCAGCAGAGAGG + Intergenic
1090000241 11:122949947-122949969 CTGCCTCAGCAGGAGTATCTGGG + Intronic
1090072465 11:123555771-123555793 CTTACTCAGCTGGAGCACAATGG + Intronic
1090329630 11:125920844-125920866 TTGGCACAGCAGGAGCAGAGAGG + Intronic
1091024806 11:132132608-132132630 AGGACTCCGCAGGAGCATGGAGG - Intronic
1091366028 11:135021473-135021495 CTGATTCAGCAGGCACAGAGTGG - Intergenic
1091854010 12:3724313-3724335 CTGGCTCAGCAGGAGCCTAGAGG - Intronic
1092272140 12:7031588-7031610 CTGAGCCTGAAGGAGCATAGTGG + Intronic
1092283601 12:7115632-7115654 CTGACTCAGGAAGAGCACAGTGG + Intergenic
1093229646 12:16528033-16528055 CAGACTCAGTAGCAGAATAGAGG - Intronic
1095461445 12:42448720-42448742 CCTACTCAGCAGCAGGATAGAGG + Intronic
1096317557 12:50581724-50581746 CTGAGTCAGCAGGAGTTGAGTGG - Intronic
1098974772 12:76890988-76891010 GTGATTCTGCAGGAGCAAAGGGG - Intergenic
1100501980 12:95183166-95183188 CTTTATCAGCAGAAGCATAGTGG - Intronic
1102205000 12:111084192-111084214 CTGAATCAGCAGGAGTGGAGTGG + Intronic
1105254762 13:18736521-18736543 CTGAATCAGGAGGAGAAAAGAGG + Intergenic
1106953768 13:34913121-34913143 CTGACACCACAGGAGCACAGAGG + Intergenic
1110127410 13:71963668-71963690 CTCACCCAGCAGGAGCAGACAGG - Intergenic
1112259555 13:97865444-97865466 CTGACACAGGCTGAGCATAGTGG - Intergenic
1112749849 13:102571164-102571186 CTGCTTCAGCTGGAGCACAGAGG + Intergenic
1115312307 14:31991769-31991791 CTGACTAGGCAGGAGCAGGGAGG + Intergenic
1116639199 14:47439536-47439558 CTGAATCACCACAAGCATAGAGG - Intronic
1118654682 14:67933874-67933896 CTGACTCAGCAGGAGCATAGAGG - Intronic
1120107973 14:80517905-80517927 CTGGATCAGGAGGAGCACAGTGG + Intronic
1120808251 14:88775831-88775853 CTGACCCAGCACCATCATAGTGG + Intronic
1122015851 14:98796085-98796107 GTGACCCGGCAGGAGCATGGAGG - Intergenic
1122642525 14:103168529-103168551 CTGCCTCAGTTGGAGCACAGAGG - Intergenic
1122660209 14:103290146-103290168 TTGACTCACCAGGAGCAGGGTGG + Intergenic
1126424103 15:48507126-48507148 CTGGGTCAGCAGGAGCCTAGAGG + Intronic
1126664060 15:51059879-51059901 CTGACCCAGAAGGAGCAGAGAGG - Intronic
1128414263 15:67429750-67429772 CTGACGCAGGAGGGGCAAAGGGG + Intronic
1129079814 15:73029247-73029269 CTGACTCGGCAGGACCTTAGAGG - Intergenic
1129829734 15:78660945-78660967 CTGACTCAGCAGGACAAGGGTGG + Intronic
1132736339 16:1387928-1387950 CTGACCCACCAGTAGCCTAGAGG + Intronic
1135879650 16:26241394-26241416 CTGACTCAGCACAGTCATAGTGG + Intergenic
1138433751 16:56985750-56985772 CTCACTAAGCAGGAGCATCATGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142006490 16:87691766-87691788 TGGTCCCAGCAGGAGCATAGGGG - Intronic
1142178927 16:88657820-88657842 CTGCCTCAGGAGGGGCACAGAGG + Intronic
1142592241 17:1011389-1011411 CTGAACCAGCAGGAGCAGGGAGG + Intronic
1142772084 17:2105580-2105602 CAGACTCAGCAGTAGCCTAAAGG + Intronic
1144282171 17:13737034-13737056 GTGAATCAGCAGAAGCCTAGGGG + Intergenic
1144487958 17:15683346-15683368 CTGACTCTGCAGGGCCCTAGTGG - Intronic
1145276963 17:21437317-21437339 CTGGCTCAGCAGGACCCCAGGGG + Intergenic
1145713235 17:26995147-26995169 CTGGCTCAGCAGGACCCCAGGGG + Intergenic
1149145964 17:53492719-53492741 GTGACTCAGCAGGATCTTGGAGG - Intergenic
1150203478 17:63380908-63380930 CTTACTTAGTAGGAGCAGAGTGG + Intronic
1152234067 17:79129487-79129509 CTGGCTCAGCAGGAGCCTGGGGG - Intronic
1152373899 17:79908002-79908024 CTTACTCAGCAGGAGGCTGGAGG - Intergenic
1152495593 17:80669120-80669142 CTGGCTCAGCAGGAGCAGCCAGG + Intronic
1152914442 17:83026151-83026173 CTGGCTGAGCAGGAGCAAAGGGG - Intronic
1153942791 18:9991867-9991889 CAGACTCAGCAGGTCCACAGTGG + Intergenic
1154436265 18:14344082-14344104 CTGAATCAGGAGGAGAAAAGAGG - Intergenic
1156592662 18:38509227-38509249 CTGACCAAGCAGGAGGATGGGGG + Intergenic
1157692886 18:49698258-49698280 CTGACTGAGCAGAAGCTTCGGGG - Intergenic
1157871292 18:51232311-51232333 CAGACCCAGCAGGACCCTAGAGG - Intergenic
1160510027 18:79448247-79448269 CTGCCTCTGCAGGAGGAGAGGGG + Intronic
1162413666 19:10521061-10521083 AAGACACAGCAGGAACATAGAGG - Intergenic
1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG + Intergenic
1164466787 19:28493923-28493945 CTCAGTCAGCAGGAACACAGAGG - Intergenic
1164723338 19:30448207-30448229 CTGACTAAGTAGGAGAATTGAGG + Intronic
1164920593 19:32085822-32085844 CTGACTTAGCAGGACTATGGTGG - Intergenic
1167015741 19:46839820-46839842 CTGACTCTCCAGGATCAGAGGGG - Intronic
1167572927 19:50301233-50301255 CTGACTCAGCAATACCAAAGTGG - Intronic
1168605396 19:57755376-57755398 CTGATTTTGAAGGAGCATAGAGG - Exonic
925222911 2:2156842-2156864 CTGAGACAGCAGGATCATCGGGG + Intronic
926172889 2:10564385-10564407 CTGACTCTGCAAGAGCCAAGAGG + Intergenic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927827189 2:26317050-26317072 CTGATTCTACAGGAGCAGAGGGG + Exonic
930020703 2:47000491-47000513 CTGACGCAGCAGGAGCTCGGAGG + Intronic
930134559 2:47887976-47887998 CTCACCCAGCAGGAACACAGTGG - Intronic
930196663 2:48517409-48517431 TTGACTGAGCAGGAGGATTGAGG + Intergenic
932451665 2:71814439-71814461 CTGACAGAGGAGGAGCAAAGGGG + Intergenic
933162955 2:79045734-79045756 CTGACCCAGCACAATCATAGTGG + Intergenic
933980888 2:87549846-87549868 CAGCCTCAGCAGGAGAATGGGGG + Intergenic
936312942 2:111400939-111400961 CAGCCTCAGCAGGAGAATGGGGG - Intergenic
936971675 2:118182562-118182584 CTGACTCCTCATGAGCATGGTGG - Intergenic
938022973 2:127921266-127921288 CTGCCTCAGCAGGAGATTACAGG + Intergenic
938659514 2:133471269-133471291 CTCACTTAGCAGGAGTAAAGTGG - Intronic
939479924 2:142734981-142735003 CTGACTCACCAGAAGTACAGAGG + Intergenic
941145685 2:161841363-161841385 CTGTGTCAGCAGGGGCATGGTGG - Intronic
947729655 2:232420882-232420904 CTGCCTGAGCAGGAGCGAAGCGG + Intergenic
1168863402 20:1062829-1062851 CTGAGACAGAAAGAGCATAGGGG - Intergenic
1171879591 20:30608507-30608529 CTGAATCAGCAGGAGAAAAGAGG + Intergenic
1173506605 20:43591902-43591924 GGGACTCAGCAGGAGCTTACAGG + Intronic
1174087771 20:48021185-48021207 CTCTCTCAGCTGGAGCACAGGGG + Intergenic
1174859283 20:54075243-54075265 CTGTCTCAGCTGGAGCAGGGTGG - Intergenic
1174983107 20:55419734-55419756 CTGATTCAGCAGGTGCATGGTGG - Intergenic
1175715950 20:61253920-61253942 CTGAAGGAGCAGGAGCACAGCGG - Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176840775 21:13841557-13841579 CTGAATCAGGAGGAGAAAAGAGG + Intergenic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1180642912 22:17313812-17313834 CTCACTCAGCTGGCGCACAGGGG - Intergenic
1181405154 22:22679174-22679196 CTGAATCAGCAGCAACATTGGGG + Intergenic
1181408310 22:22700818-22700840 CTGAATCAGCAGCAACATTGAGG + Intergenic
1181577425 22:23803770-23803792 CTCACACAGCAGAAGCAGAGTGG - Intronic
1183067302 22:35371964-35371986 ATTACTCAGCAGGGGCAGAGCGG - Intergenic
1183599618 22:38832364-38832386 CTGCCCCAGCAGGAGCTGAGTGG - Intronic
1184782915 22:46658086-46658108 CTGACTCAGAAACAGCAGAGGGG - Intronic
951659077 3:25042093-25042115 ATCAGTCAGCAGGAGCACAGTGG - Intergenic
954678918 3:52330995-52331017 CTGGCTCTGCTGGAGCAGAGGGG + Intronic
956017726 3:64901706-64901728 CTGAATCAGCAGGAGCAACCAGG - Intergenic
959841745 3:110984278-110984300 CTGACCCAGCAGAGGCCTAGTGG + Intergenic
959932484 3:111999303-111999325 CTGGCCCAGCAGCAGCAAAGAGG - Exonic
960041205 3:113151591-113151613 CTGGCTCAGCAGGGGCCCAGTGG - Intergenic
960246284 3:115403941-115403963 CAGAGTCAGCAGGAGCTTAAGGG + Intergenic
961173453 3:124815495-124815517 CTGACTCAGCAGGAGGCAAGCGG + Intronic
962128685 3:132649576-132649598 CTGTCTCAGCAAGAGCAATGTGG - Intronic
963321505 3:143814179-143814201 CTGACTCAGCAGGAGTAAGAGGG + Intronic
964904381 3:161701142-161701164 CTGACTCAGCACAGTCATAGTGG + Intergenic
965782033 3:172296304-172296326 CTGATGCAGCAGGAAAATAGGGG - Intronic
967249853 3:187526268-187526290 CTGCCCAAGCAGGAGCACAGTGG + Intergenic
968274577 3:197430190-197430212 CTGACTCAGCAGGACCTCTGCGG + Intergenic
973182467 4:47286508-47286530 CTGGCGTAGCAGGAGCACAGGGG - Intronic
975095221 4:70449873-70449895 CTGACCCAGCATGGTCATAGTGG - Intronic
975832795 4:78387593-78387615 CTGAACCATCATGAGCATAGTGG - Exonic
976662388 4:87553217-87553239 CTAATTCAGCAGGAGCACACTGG - Intergenic
978261831 4:106768873-106768895 CTGACGCAGCAGAGTCATAGTGG + Intergenic
981308702 4:143273979-143274001 CTGATTCAGCAAAACCATAGTGG + Intergenic
981870963 4:149486131-149486153 CTGACTCAGCACAGTCATAGTGG - Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
986899260 5:12412337-12412359 CTGACTTAGCAGAGTCATAGTGG - Intergenic
987413122 5:17634333-17634355 ATGGCTCAGCAGAAACATAGCGG + Intergenic
988424701 5:31050019-31050041 CTCACTAAGCAGAAGCATTGAGG + Intergenic
995417872 5:111930165-111930187 CTGATTTAGCAAGAGCAGAGGGG + Intronic
998716508 5:144890144-144890166 CTGACTCAGCACAATCATAGTGG + Intergenic
999269493 5:150288605-150288627 CTGAGGCAGCAGGAGCACGGGGG - Intronic
1007294956 6:40814585-40814607 GTGACCCAGCAGGGGCATGGTGG + Intergenic
1011430130 6:87276778-87276800 CTGACTCAGCAAGAACACACTGG - Intergenic
1011856025 6:91692645-91692667 CCGACTCAGCAGGACCATGATGG + Intergenic
1013745360 6:113339263-113339285 TTGGCTCAGCAGGAATATAGAGG + Intergenic
1014479958 6:121923787-121923809 CTGACTTATCAAGAGCAAAGTGG + Intergenic
1017391086 6:153940263-153940285 TTGACTCACCAGGAGCCCAGAGG + Intergenic
1019404032 7:873515-873537 CTGCCTCTGCAGGTGCAGAGGGG + Exonic
1027648341 7:80833346-80833368 CTGCCTCTGCAGGAGAATTGAGG - Intronic
1027771364 7:82410632-82410654 CTGACTGAGCAGGCGCGTAAGGG + Intronic
1029331379 7:99858928-99858950 CTGACACAGGAGGATCATTGAGG - Intronic
1034422395 7:150996489-150996511 CTGACTCAGCAGCTGCTCAGGGG - Exonic
1035216624 7:157372431-157372453 CTGAGTGAGGAGGAGCACAGCGG + Intronic
1035337280 7:158138032-158138054 CTGACTCAGCCTCAGCATGGAGG + Intronic
1037372094 8:18191024-18191046 GTCACTCAGCAGAAGCACAGTGG - Intronic
1038945589 8:32356057-32356079 ATGACTCACCAGGAGGACAGAGG + Intronic
1041934081 8:63317650-63317672 ATGAATCTGCAGGAGCAAAGAGG - Intergenic
1042425454 8:68643006-68643028 CTGGCACAGCAGGAGGTTAGCGG - Intronic
1046716006 8:117568144-117568166 CTGACCCTGGAGTAGCATAGAGG + Intergenic
1047004005 8:120600919-120600941 TTGACTCAGCCTGAGCACAGGGG + Intronic
1047517403 8:125567147-125567169 CTAACTGAGGAGGAGCATGGTGG - Intergenic
1048281555 8:133109276-133109298 CTGACTCAGCAGGTCCAGAGTGG - Intronic
1048284930 8:133134244-133134266 CTGAGTGAGCAGGAGCCCAGAGG + Intronic
1053344952 9:37371402-37371424 CAAACACAGCAGGAGCACAGGGG + Intergenic
1056340601 9:85627657-85627679 CTGTCTCAGCAGGGGCAAAGGGG - Intronic
1056570942 9:87814302-87814324 ACGACTCAGCAGGAGCCTGGAGG - Intergenic
1057307831 9:93922326-93922348 CTTGCTCATCAGGAGCAGAGGGG - Intergenic
1058021896 9:100098775-100098797 CTCACTCACCAGGAGCAGAAGGG + Exonic
1058767903 9:108199421-108199443 CTGACCCAGCACAATCATAGTGG + Intergenic
1059504758 9:114788349-114788371 CAGACTCAGTGGGAGCACAGAGG - Exonic
1060527721 9:124329866-124329888 GTGACTCAGGAGGGGCACAGGGG + Intronic
1061981900 9:134110157-134110179 GTGACTCAGCAGCAGAATGGAGG + Intergenic
1062026829 9:134344414-134344436 CTGACTCAGCAGCTGCAGGGTGG + Intronic
1062097640 9:134711173-134711195 CTGACTCTGCAGGCCCACAGGGG - Intronic
1062131841 9:134899982-134900004 CTGACACTGCAGGAGTAGAGGGG - Intergenic
1062294847 9:135818962-135818984 CAGACTGAGCAGGAGCCTGGTGG - Intronic
1062333738 9:136055934-136055956 TGGAGTCAGCAGGAGCACAGGGG + Intronic
1187985832 X:24809700-24809722 CTGGCTCAGAATCAGCATAGAGG + Intronic
1188815217 X:34705057-34705079 CTGACCCAGCACAATCATAGTGG - Intergenic
1193192750 X:78592211-78592233 CTGACTCAGCATATTCATAGTGG - Intergenic
1194285585 X:92007031-92007053 GTGACCCAGCAGGGTCATAGTGG - Intronic
1194574670 X:95596978-95597000 CTGACTTAGCATAATCATAGTGG + Intergenic
1194990814 X:100544527-100544549 CTGACCCAGCATAATCATAGTGG + Intergenic
1197146840 X:123181418-123181440 CTGAGCCAGCAGGGGCACAGTGG - Intergenic
1197458434 X:126707368-126707390 CTGACTCAGCACAGTCATAGTGG + Intergenic
1197602521 X:128547503-128547525 CTGACTCAGCACCGTCATAGTGG - Intergenic
1200603153 Y:5231569-5231591 GTGACCCAGCAGGGTCATAGTGG - Intronic