ID: 1118657728

View in Genome Browser
Species Human (GRCh38)
Location 14:67970227-67970249
Sequence AATTAATGGTAGCAGTAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118657724_1118657728 14 Left 1118657724 14:67970190-67970212 CCAGTTATTTTTTGCTGCTCAGT 0: 1
1: 0
2: 1
3: 28
4: 268
Right 1118657728 14:67970227-67970249 AATTAATGGTAGCAGTAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 140
1118657723_1118657728 20 Left 1118657723 14:67970184-67970206 CCACTGCCAGTTATTTTTTGCTG 0: 1
1: 0
2: 2
3: 28
4: 343
Right 1118657728 14:67970227-67970249 AATTAATGGTAGCAGTAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118657728 Original CRISPR AATTAATGGTAGCAGTAGGG TGG Intronic
907664996 1:56426906-56426928 AATAAATGGCAGCTGTAGGTGGG + Intergenic
909202316 1:72706094-72706116 AAATAAGGGTAGCAGGTGGGCGG + Intergenic
913113734 1:115678424-115678446 AATGACTGATAGCAGTAGTGAGG + Intronic
918959977 1:191262062-191262084 AACTATTGGTAGCTGTTGGGTGG - Intergenic
919377539 1:196813677-196813699 AATTAATGATAACAGTTGAGAGG + Intergenic
920376159 1:205509303-205509325 ATTTAATGGTGGGGGTAGGGAGG - Intronic
921062245 1:211595406-211595428 AATTGAAGGAGGCAGTAGGGTGG + Intergenic
922114765 1:222602171-222602193 AATCAATACTAGCAATAGGGAGG - Intergenic
924848456 1:247797973-247797995 AATTAATGGCTGCAGTAATGAGG - Intergenic
924927733 1:248699529-248699551 AATTAATGGTAGGAGGAGTGGGG + Intergenic
1063881960 10:10540712-10540734 AATTATTGGTAGAAGTAGATGGG - Intergenic
1065298097 10:24295755-24295777 AAGGATTGGTAGCAATAGGGAGG - Intronic
1071308641 10:84322981-84323003 AGTTAATGGTAGCCGTAGCCAGG - Intergenic
1073009613 10:100349064-100349086 ACTTCATGGCATCAGTAGGGGGG - Intronic
1074353916 10:112764558-112764580 TATTAATGGTGTCAGTATGGTGG - Intronic
1075541663 10:123318841-123318863 AAGTAATGGTGGCAGCAGTGAGG + Intergenic
1075923502 10:126232816-126232838 AAATAGTGGTAGGACTAGGGAGG + Intronic
1081133293 11:39406829-39406851 AATTTATGGTAGGGGTATGGTGG + Intergenic
1083020291 11:59499951-59499973 GATTAAAAGTAGCAGAAGGGTGG + Intergenic
1085555164 11:77412717-77412739 AATAAATGGTAGCAGTGGCTAGG - Intronic
1086302274 11:85439818-85439840 AATAAATGTTTGCAGTAAGGAGG + Intronic
1093395165 12:18672027-18672049 AAGTAATGGTATTAGTAGGTGGG - Intergenic
1096770562 12:53933636-53933658 AATGAAAGGTAAGAGTAGGGAGG + Intergenic
1097758078 12:63428466-63428488 AGTAAATAGTACCAGTAGGGTGG - Intergenic
1098929374 12:76393203-76393225 AGTTAATGGTAGCATTATGCAGG - Intronic
1099991813 12:89730475-89730497 AATTAATGGTAGCAGGGGGCAGG + Intergenic
1107185251 13:37510400-37510422 CATTCATTGTAACAGTAGGGTGG - Intergenic
1107351309 13:39517822-39517844 AATTAATAGTAACAGCAGGCTGG - Intronic
1109207748 13:59500720-59500742 AATTAATGGAAGCAGTAAAAGGG + Intergenic
1109621151 13:64907198-64907220 ACTTTATGGTAGCAGAAGGGTGG + Intergenic
1109704121 13:66066850-66066872 ATGTAATGGTAGCAATAAGGTGG + Intergenic
1110882114 13:80584818-80584840 AATTAAAGTAAGCATTAGGGTGG - Intergenic
1111845693 13:93506164-93506186 CATTAATGATAGAAGTGGGGTGG - Intronic
1113866587 13:113530181-113530203 AATTACTGGTTGCCGGAGGGTGG + Intronic
1115528924 14:34308107-34308129 AATAAATAGTAGTAGTAGGCTGG - Intronic
1116046917 14:39754739-39754761 AAATAATGGTAGCAGTAGGATGG + Intergenic
1116709444 14:48347667-48347689 AAATAATGCTATCTGTAGGGGGG - Intergenic
1117615512 14:57530049-57530071 AATTGGTGGTAGGAGAAGGGTGG + Intergenic
1117910035 14:60628040-60628062 AATAAATAGTAGCAGTTGGCTGG - Intergenic
1117947567 14:61045287-61045309 AAATAATGGTTTCAGTAGAGTGG + Intronic
1118657728 14:67970227-67970249 AATTAATGGTAGCAGTAGGGTGG + Intronic
1125295781 15:38201786-38201808 AATTAATGCTAGCTGTCGGCTGG + Intergenic
1126536247 15:49768815-49768837 AATTAATGGCAGAGGCAGGGAGG - Intergenic
1126913935 15:53444325-53444347 AATTAATGGTTGGAGTGGAGAGG - Intergenic
1129593508 15:76939318-76939340 AATAAATGGTAGCAGTTGGAGGG + Intronic
1132435486 15:101798040-101798062 AATAAATGGTAGCCGAAAGGAGG - Intergenic
1135125219 16:19803998-19804020 AATGAATGGTGTCAGTATGGAGG + Intronic
1143457531 17:7077703-7077725 GATTGATGGTAACGGTAGGGGGG - Intronic
1143641803 17:8203115-8203137 AAATTATGGTGGCAGTGGGGTGG - Intergenic
1143726416 17:8849906-8849928 AATTAGTGGAAGCAGTGGGAAGG + Intronic
1144089082 17:11837511-11837533 CCTGAGTGGTAGCAGTAGGGAGG - Intronic
1144238002 17:13281283-13281305 AATAGTTGGTTGCAGTAGGGTGG - Intergenic
1145189002 17:20822192-20822214 AATTAATGGAAGCATTATGAAGG + Intergenic
1153115887 18:1655625-1655647 AATTAATAGTAGCAGTCATGGGG + Intergenic
1156552867 18:38036661-38036683 AGTTAATTTTAGCAGCAGGGAGG - Intergenic
1158896152 18:61915365-61915387 AATTAAGGGAGGCAGTGGGGAGG - Intergenic
1159111063 18:64057089-64057111 ATTTAATTGTTGGAGTAGGGTGG + Intergenic
1162214144 19:9118610-9118632 AATGCATGGGAGCAGTAGTGTGG - Intergenic
1163093200 19:15035741-15035763 AATAAATGTTAGCAGGAAGGAGG + Intergenic
1164069380 19:21752426-21752448 CTTTAATGGTAACAGTAGGGAGG - Intronic
1165502734 19:36203017-36203039 AAAGAATGAAAGCAGTAGGGAGG - Intronic
925001571 2:407023-407045 CATGAATGGTTGCAGCAGGGAGG - Intergenic
925080582 2:1060915-1060937 AAAAAATGGTAACATTAGGGTGG + Intronic
928204148 2:29272086-29272108 AATGAATGTTAGCAGTGAGGAGG - Intronic
929824010 2:45295971-45295993 AATTAATAGTAACAGTAGGCTGG - Intergenic
930280762 2:49367157-49367179 AATTGATGGTGGCAATTGGGAGG - Intergenic
930942020 2:57025071-57025093 AATTAATGATAGGATTTGGGTGG + Intergenic
931371270 2:61665353-61665375 AATTAATAGAAGCAGGACGGTGG + Intergenic
932086333 2:68765800-68765822 GAATAATGCTAGCAGTGGGGTGG - Intronic
933022346 2:77209491-77209513 AATTCTTGGTTGCAGTAGTGGGG + Intronic
937850405 2:126627277-126627299 AATTACTGGTAGCTAGAGGGGGG - Intergenic
939380752 2:141432917-141432939 ACTTAAAGTTAGCAGTAGGAAGG - Intronic
945249703 2:207754209-207754231 CTTCAATGGTAACAGTAGGGAGG - Exonic
945973192 2:216250562-216250584 CAATAATAGTAGCAGTAAGGTGG + Intergenic
947499647 2:230662579-230662601 AAATAATGGTGGCAGAAAGGAGG + Intergenic
948027350 2:234788934-234788956 AATGAATGGTGGGGGTAGGGTGG - Intergenic
949080278 2:242091255-242091277 TATTAATGGAAACAGTAGGCAGG + Intergenic
1170357140 20:15505413-15505435 AATTGATGGTAGGAGGAGAGGGG - Intronic
1170922109 20:20688951-20688973 AATTAATACTAGCTGCAGGGTGG - Intronic
1172267447 20:33628767-33628789 AATTATTGGTAGCATTAAGTAGG - Intronic
1173013043 20:39199938-39199960 AATTAATCTGAGCAGTAAGGAGG + Intergenic
1175263772 20:57690540-57690562 AATTAACTGTAGCAGGAGGCGGG + Intronic
1178132635 21:29590721-29590743 AACTACTAGTAGCAGTTGGGAGG + Intronic
1178448667 21:32670761-32670783 AATTGCTGGTAACAGTTGGGAGG + Intronic
1178760907 21:35401828-35401850 AATCAATACTAGCAGTGGGGTGG + Intronic
950963242 3:17127892-17127914 AGTTAATTGTACCAGTAGAGTGG + Intergenic
953216792 3:40926233-40926255 AATTAATGGTGGTAGTTGGGGGG - Intergenic
958914435 3:100033027-100033049 CATCAATGGTAACAGTAGAGTGG - Intronic
960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG + Intergenic
960219014 3:115080858-115080880 GAGTAATGGTAGAAGCAGGGAGG + Intronic
965755537 3:172022447-172022469 AATTAATGGTAACATGAGGTAGG - Intergenic
972021405 4:34320142-34320164 AATTGATGGTAGCTATAGGTAGG - Intergenic
973023966 4:45242888-45242910 AATTAATGTTAGTATTAGGGTGG - Intergenic
973309231 4:48689786-48689808 AATTAATGGTTGGATTAGGAGGG - Intronic
973317992 4:48780934-48780956 AATCAATGGTATGAGTAGGGCGG - Intergenic
977758475 4:100701878-100701900 CATTAATGGTAGCCCTTGGGTGG + Intronic
980939884 4:139263800-139263822 AATTAGTGTTAGCTGTAGGTGGG + Intergenic
982997119 4:162363521-162363543 AATTGCTGGTAGCAGAAGAGTGG + Intergenic
985387175 4:189460574-189460596 AATGAATGAAAGAAGTAGGGAGG + Intergenic
987816485 5:22907512-22907534 ATTAAATGGTATCAGAAGGGTGG - Intergenic
988237324 5:28561953-28561975 AAGAAATGGTAGCAGTGGGCTGG - Intergenic
988800079 5:34688469-34688491 AAAAACTGGTGGCAGTAGGGAGG + Intronic
988832243 5:34999206-34999228 TATGAATGGTTGCAGAAGGGTGG - Intronic
989511078 5:42288287-42288309 AATTAATGGTAGCACAAAGAAGG + Intergenic
994782461 5:104109459-104109481 AAGTAATGTTAGCAGAAGGGAGG - Intergenic
994782555 5:104110877-104110899 AAGTAATGTTAGCAGAAGGGAGG + Intergenic
995214640 5:109581560-109581582 AATAAATGGTAGCCGCAGTGAGG + Intergenic
996614715 5:125427020-125427042 CATGAATGGTAGCAGCAGAGGGG + Intergenic
996691055 5:126340528-126340550 AATTAATTGTATAAGCAGGGAGG - Intergenic
997376066 5:133398443-133398465 ATTTAATGGTAGCTGGAGAGTGG - Intronic
1000433221 5:161176394-161176416 ATGTAATGGTACTAGTAGGGTGG - Intergenic
1004320179 6:14625945-14625967 AATGAATGCCACCAGTAGGGAGG + Intergenic
1004524115 6:16390157-16390179 GAGTACTAGTAGCAGTAGGGTGG - Intronic
1004643140 6:17534922-17534944 ACTCACTGGTTGCAGTAGGGGGG - Intronic
1008300907 6:49838095-49838117 AATTATGGGTTGCAGTAAGGGGG + Intronic
1010239993 6:73606433-73606455 AAATAGTTGTAGCAGTTGGGAGG - Intronic
1011895918 6:92224943-92224965 AATAAATTGCAGCAGTTGGGAGG + Intergenic
1013428883 6:110038409-110038431 AATTAATGGTGGAATTAGGCTGG + Intergenic
1017452950 6:154571458-154571480 AATCAAAGGTAGCAATAGTGGGG - Intergenic
1018065115 6:160119111-160119133 AAATGATGGCAGCAGCAGGGAGG - Intergenic
1021989558 7:26128932-26128954 AATGAATGGTGTCAGGAGGGGGG + Intergenic
1023539056 7:41245393-41245415 AGTTAATGGTGGTTGTAGGGAGG - Intergenic
1026186469 7:68085545-68085567 ATATAATTTTAGCAGTAGGGAGG - Intergenic
1028278611 7:88892085-88892107 CATTTATGTTAACAGTAGGGTGG - Intronic
1030204003 7:106934819-106934841 TATTGTTTGTAGCAGTAGGGGGG - Intergenic
1031125770 7:117771928-117771950 AGGTAATGGCAGCAGCAGGGAGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035013726 7:155744630-155744652 CAGGAATGGCAGCAGTAGGGAGG - Intronic
1035291664 7:157843377-157843399 AATTAATTGTGGTGGTAGGGGGG + Intronic
1035538323 8:409519-409541 TATTAATGGAAACAGTAGGCAGG + Intronic
1035831832 8:2703251-2703273 AAATAATTCTAGAAGTAGGGTGG - Intergenic
1039363994 8:36911199-36911221 AATTATGGGGAGCAGGAGGGTGG + Intronic
1040705398 8:50120440-50120462 AGTTAATAGTTTCAGTAGGGTGG - Intronic
1041098855 8:54376517-54376539 AATTAATAAAAGCAATAGGGTGG - Intergenic
1041773878 8:61502858-61502880 ATTTAATGGTAGCATTACTGGGG - Exonic
1042551830 8:70001113-70001135 ATATAATGCTAGCATTAGGGAGG + Intergenic
1044634367 8:94307876-94307898 AATTAATGGCAGCATTTGGCAGG + Intergenic
1044947355 8:97401996-97402018 AACTATTGGTAGCTGTTGGGTGG - Intergenic
1046732598 8:117741242-117741264 AATAAATGCTAGCAGTTGTGAGG + Intergenic
1050173401 9:2845552-2845574 AATTATTGAAAGCAGTACGGAGG - Intergenic
1051332220 9:16034299-16034321 ATTTAATGGTTTCAGGAGGGAGG + Intronic
1052573759 9:30264789-30264811 AATAAATGTCAGCAGTAGCGAGG - Intergenic
1052705504 9:31989447-31989469 AAAAATTGGTACCAGTAGGGTGG - Intergenic
1053025009 9:34722205-34722227 GAGTGATGGTAGCAGTAGAGAGG + Intergenic
1053072026 9:35107443-35107465 AACTGTTGGCAGCAGTAGGGTGG + Exonic
1053115609 9:35498984-35499006 TATTAATGTTAACAGTAGTGAGG + Intronic
1054717574 9:68571737-68571759 AAGAAATGGTAGCAGTATTGAGG - Intergenic
1055654576 9:78439969-78439991 CATTTATGGTAGCAATTGGGAGG - Intergenic
1056160317 9:83884375-83884397 GATTATTGGTAGCAGGAGGCTGG - Intronic
1056359908 9:85845467-85845489 GATTATTGGTAGCAGGAGGCTGG + Intergenic
1056525013 9:87435054-87435076 CATTCATGGTAGCAGGAGGAAGG + Intergenic
1056604542 9:88076145-88076167 AATTAATGGGATCAGAAGGGCGG - Intergenic
1060447450 9:123704042-123704064 ATTTAATTGTATCAGTTGGGAGG - Intronic
1188755429 X:33955667-33955689 ATTGAGTTGTAGCAGTAGGGCGG - Intergenic
1197269638 X:124411593-124411615 ATTTAATGGTATCTGCAGGGTGG + Intronic