ID: 1118659729

View in Genome Browser
Species Human (GRCh38)
Location 14:67995518-67995540
Sequence TCCATCCCAAGTTAGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118659726_1118659729 27 Left 1118659726 14:67995468-67995490 CCAAAACTGGGAACTTAGGATCT 0: 1
1: 0
2: 2
3: 9
4: 146
Right 1118659729 14:67995518-67995540 TCCATCCCAAGTTAGAAATATGG 0: 1
1: 0
2: 2
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118659729 Original CRISPR TCCATCCCAAGTTAGAAATA TGG Intronic
902164545 1:14559687-14559709 TCCTTCCCTAGTTAGAGGTAAGG + Intergenic
905591141 1:39164979-39165001 TCCACTCCAAGTCAGAAACAAGG - Intronic
906420261 1:45660150-45660172 TTCTTTCCAAGTTAGACATATGG + Intronic
909491279 1:76229310-76229332 TTCATCCTAAGTTAAAAATGGGG - Intronic
910455716 1:87395443-87395465 TCAACCCCAAGTTATAATTAAGG + Intergenic
910863130 1:91762934-91762956 TTCTTCCCAAGTGAGAGATAGGG - Intronic
911124378 1:94327022-94327044 TCCTTTCAAAGTTAAAAATAAGG + Intergenic
913056791 1:115169544-115169566 TCCATGCCAAGTTAGACACAAGG + Intergenic
916249467 1:162723329-162723351 CCCAGCCCAAGCTGGAAATAAGG - Intronic
919270352 1:195334373-195334395 TCCCTCTAAAGTTGGAAATAAGG - Intergenic
920836750 1:209518146-209518168 TCCATCCCATTTTATAAATGAGG - Intergenic
921442209 1:215200809-215200831 CCCACCCAAAGTTAGAATTATGG - Intronic
921725251 1:218516154-218516176 TCAATTCCCAGTTAGCAATAAGG - Intergenic
924842088 1:247723024-247723046 TCTTTCCAAAGTTACAAATAAGG + Intergenic
1063737845 10:8781005-8781027 TCCATCCCACCTTAGAAATATGG - Intergenic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1066406007 10:35119086-35119108 TCCATCCAATGTTAGATAAAAGG - Intergenic
1069308969 10:67009346-67009368 TGAAAACCAAGTTAGAAATATGG - Intronic
1074179070 10:111041812-111041834 TCCATCACAAGATACAAAGAAGG + Intergenic
1075493087 10:122891708-122891730 TCCCTCCTAAGTGAAAAATAAGG + Intergenic
1075913896 10:126149403-126149425 TTCCTCCCAAGTGAGAAAGAAGG + Intronic
1079373771 11:19873627-19873649 TTCATCCCAAGCTAGAAAGCAGG + Intronic
1081786823 11:45753656-45753678 GCCATCCCAAGTTTGAAAGTAGG + Intergenic
1082688423 11:56269068-56269090 TCAATCCCAAGTGAAAAATAAGG + Intergenic
1082701996 11:56443429-56443451 TCCTCCCCAAGATAGAAAGAAGG - Intergenic
1084071546 11:66739708-66739730 TCCAGCCCTACTTAGAGATAAGG + Intergenic
1086208239 11:84285965-84285987 TCTACCTCAATTTAGAAATAGGG - Intronic
1087825420 11:102759487-102759509 TTCATACCCAGTTAGAAGTAGGG - Intergenic
1089896374 11:121934358-121934380 TCTATCCCATTTTACAAATAAGG + Intergenic
1090185428 11:124736531-124736553 TCCATTCAAAGGTAGAAATCAGG - Intergenic
1094261463 12:28505180-28505202 CGCATCCCAAATTAGAAAAAAGG - Intronic
1095360107 12:41327136-41327158 ACCACCCCAAGTTAGCAAAATGG - Intronic
1095709223 12:45270287-45270309 GCCATCCCATGTTATAGATAAGG + Intronic
1098076457 12:66737287-66737309 TCCATCTCAAATTTGAAAAAAGG - Intronic
1098386955 12:69929814-69929836 TCAATCCCATTTTAAAAATAGGG - Intronic
1099063092 12:77937194-77937216 TGCAGCTGAAGTTAGAAATACGG + Intronic
1099175763 12:79419970-79419992 TACATCCCAAGAATGAAATATGG - Intronic
1099264374 12:80426489-80426511 TTAACCCCAGGTTAGAAATAAGG - Intronic
1101732151 12:107435761-107435783 TACATCCCAAGGAAGTAATAAGG - Intronic
1107567546 13:41621348-41621370 CCCATCGTAAGTTAGAAATATGG - Intronic
1108074891 13:46669746-46669768 TCTTTCCCAATTTAGAAAAAGGG - Intronic
1109720577 13:66270385-66270407 TTGATTCCAATTTAGAAATAAGG - Intergenic
1110572258 13:77018393-77018415 ACCATACCAATTTAGAAGTATGG + Intronic
1110742995 13:79019144-79019166 TCCATCCCCAGGCAGATATATGG - Intergenic
1112029357 13:95443110-95443132 CCCATAGGAAGTTAGAAATATGG - Intronic
1114031865 14:18585743-18585765 TCCATCCCAAGGTGGACATCAGG - Intergenic
1114075700 14:19160039-19160061 TCCATCCCAAGGTGGACATCAGG - Intergenic
1114076636 14:19164772-19164794 TCCATCCCAAGGTGGACATCAGG - Intergenic
1114085528 14:19234796-19234818 TCCATCCCAAGGTGGACATCAGG + Intergenic
1114384012 14:22237713-22237735 TCCCTCCCAATTTAGGTATACGG + Intergenic
1116533101 14:45996874-45996896 TGCACTACAAGTTAGAAATATGG - Intergenic
1117898005 14:60507815-60507837 TCCATCCCTAGACAGAAATCAGG - Intronic
1118610807 14:67538075-67538097 TCTATCACACATTAGAAATAGGG - Intronic
1118659729 14:67995518-67995540 TCCATCCCAAGTTAGAAATATGG + Intronic
1120180117 14:81334703-81334725 GCAATCCCAAGGCAGAAATAGGG + Intronic
1120303835 14:82742070-82742092 TCCTTCCAAACTTAGAAATTTGG - Intergenic
1120920739 14:89753344-89753366 TTCATCCCAATTTAGAAATGAGG + Intergenic
1202897074 14_GL000194v1_random:16510-16532 TCCATCCCAAGGTGGACATCAGG + Intergenic
1202898006 14_GL000194v1_random:21152-21174 TCCATCCCAAGGTGGACATGAGG + Intergenic
1124451384 15:29795039-29795061 ACCATCCAAAATTAAAAATAAGG + Intronic
1125453076 15:39829031-39829053 TCTATCCCATTTTAAAAATAAGG + Intronic
1125799038 15:42428363-42428385 TACATTCTAAGTTAGAAACATGG - Intronic
1126591030 15:50339897-50339919 TACTTCCCAATTTAGAAATCTGG + Intronic
1126778610 15:52119660-52119682 CCCATCCCATGTTACAAATGGGG + Exonic
1128461771 15:67874515-67874537 TCCATCCCAGGGAAGAAAAAAGG - Intergenic
1130214212 15:81953131-81953153 TCCATGCCAAACTACAAATAAGG - Intergenic
1133243174 16:4428249-4428271 TCCATCTCAAAATAAAAATAAGG - Intronic
1139060528 16:63245304-63245326 TCCTTCCCATGTTAGAGAAATGG + Intergenic
1140464442 16:75168470-75168492 TCCATTCCTATTTAGAGATAGGG - Intronic
1141601977 16:85132563-85132585 TCCATCCCTAGTTAGCCATGAGG + Intergenic
1143795892 17:9336439-9336461 TCCATCTCAAGAAAGAAAGAAGG - Intronic
1144227861 17:13168940-13168962 TCCAGCTGAAGTTAGAAACAGGG - Intergenic
1147767962 17:42849480-42849502 TCAAACCCAAGTTAGATACACGG + Intronic
1148988209 17:51642646-51642668 TCCATCTCAAATAAAAAATAAGG - Intronic
1149192348 17:54078389-54078411 TGCATCTTAAGTTATAAATATGG - Intergenic
1155326510 18:24670208-24670230 TCCTTCCCTAGTTAAAAAGAGGG - Intergenic
1156673692 18:39501821-39501843 TCCTTCCCAAATTAGAAATATGG - Intergenic
1157071325 18:44412195-44412217 TCCATCCCAGGCAAGAAAAAGGG + Intergenic
1159993333 18:74936758-74936780 ACCATCCCATTTCAGAAATATGG + Intronic
1161158993 19:2751255-2751277 TCCCACACAAGTTTGAAATAGGG - Intergenic
1167098523 19:47389589-47389611 TACTTCCCAAGTCAGCAATATGG + Intergenic
926726796 2:16004864-16004886 CCCATCCCATGTTAGAAGCATGG - Intergenic
926879776 2:17531897-17531919 TCTTTCCCAATTTATAAATAAGG + Intergenic
928392326 2:30919098-30919120 TCCATCCCAATTTAAAGAAAGGG - Intronic
928623882 2:33119517-33119539 TCCATCCCCACTTTGACATAAGG + Intronic
929195472 2:39180284-39180306 TCCATCATAAGAGAGAAATAAGG + Intronic
929222447 2:39478447-39478469 GCCATCCAAAGTTAGAAACCTGG - Intergenic
929460285 2:42098371-42098393 TCCATGACAAGATAAAAATAAGG + Intergenic
930129861 2:47838709-47838731 TCAATTCCAAGTTACAAATGGGG - Intronic
932032450 2:68204158-68204180 ATCATGCCAAGTTAGAACTAAGG + Intronic
932106757 2:68950592-68950614 TCCATCCCAAATAAGGCATATGG + Intronic
938490292 2:131757538-131757560 TCCATCCCAAGGTGGACATCAGG - Intronic
938491236 2:131762288-131762310 TCCATCCCAAGGTGGACATCAGG - Intronic
938496327 2:131800049-131800071 TCCATCCCAAGGTGGACATCAGG + Intronic
941175267 2:162190598-162190620 TCAATCCCAGGTTCAAAATAAGG - Intronic
945689435 2:213014664-213014686 TCCATAGCAACTTAGAAAAAAGG - Intronic
946275837 2:218630890-218630912 TCCATCCGAGGATAGAAAGAAGG - Intronic
947652677 2:231800350-231800372 TCAATCCCAAGTCAGAGAAAAGG - Intronic
947977879 2:234383188-234383210 ACTATCCCATGTGAGAAATAAGG - Intergenic
1168768529 20:398559-398581 TCCATCCCAAGAAAGAAATGTGG - Intergenic
1169488676 20:6053741-6053763 TTCATCCCCAGCTAGTAATAGGG - Intronic
1169771418 20:9205365-9205387 TCCATCCTAAGTTGAAAATACGG - Intronic
1169951418 20:11048505-11048527 TTCTTCCCCAGTTAAAAATAAGG + Intergenic
1170232086 20:14060302-14060324 CCTTTCCCAAGTTAGAAACATGG - Intronic
1170300796 20:14882165-14882187 TCCATCACAAGTGAGAAGCAAGG - Intronic
1170985194 20:21251473-21251495 TCCAGCCCACATTAGAAATGGGG - Intergenic
1172534367 20:35660849-35660871 TCCTTCTCAAGATAGACATACGG - Intronic
1173107648 20:40152771-40152793 TTTCTCCCAAGTTAGAAATCTGG - Intergenic
1174940202 20:54918601-54918623 TCCTTCCAAAGTTAGAACAAGGG + Intergenic
1175416955 20:58807934-58807956 TCCATCACAAGGGAGAAATGGGG + Intergenic
1175933968 20:62506672-62506694 TCCCTCCCAAGGTGGAGATAGGG + Intergenic
1176616760 21:9032499-9032521 TCCATCCCAAGGTGGACATCAGG + Intergenic
1176617687 21:9037141-9037163 TCCATCCCAAGGTGGACATGAGG + Intergenic
1177595576 21:23237504-23237526 TCCATCCTAATTTAGATATGTGG - Intergenic
1177821194 21:26032543-26032565 TCCATCCCATGTTAAAGATGAGG - Intronic
1177964908 21:27715764-27715786 TTCATCCCACTTTAGAATTATGG + Intergenic
1180212317 21:46302216-46302238 TCCAGCCCCAGTTAGGAACAGGG - Intronic
1180292445 22:10858397-10858419 TCCATCCCAAGGTGGACATCAGG - Intergenic
1180455979 22:15512800-15512822 TCCATCCCAAGGTGGACATCAGG - Intergenic
1180495251 22:15887819-15887841 TCCATCCCAAGGTGGACATCAGG - Intergenic
1180671453 22:17557025-17557047 TCCAACCCAAAAAAGAAATAGGG - Intronic
1184200971 22:42969182-42969204 TCCATTCTCAGTTTGAAATATGG + Intronic
950333490 3:12175741-12175763 TCCATCCCAGGCTAGAGGTAAGG - Intronic
951210922 3:19973993-19974015 TGCATACCAATTTGGAAATAGGG + Intronic
951687948 3:25365430-25365452 TCCCTCCCAAATTAAAAATATGG + Intronic
952598374 3:35047082-35047104 TACATCCAATGTTAGAGATAAGG + Intergenic
956533374 3:70247163-70247185 GTCATCCAAAGTTAGAAAAAAGG - Intergenic
956582735 3:70832551-70832573 TCCAAGTCAAGTTAAAAATAGGG - Intergenic
961985009 3:131122733-131122755 TCCAGCCCAAGGTAGAACTGTGG - Intronic
963093501 3:141509912-141509934 TCCATCTCAAGTCAGAATTGAGG - Intronic
964027023 3:152086962-152086984 TCCATCCCCAGTTAGACCAAGGG - Intergenic
965276667 3:166691909-166691931 TCCAGTTCAAGTTAGAATTAAGG - Intergenic
966149656 3:176853117-176853139 TCCTACCCAAGATAGAAATGAGG + Intergenic
967324493 3:188225841-188225863 TCCATGCCAAATGAGAAAGAAGG - Intronic
967764541 3:193264195-193264217 TCTATCCTAAGTAAGAAATGAGG + Intronic
969220601 4:5756159-5756181 TGCATCTCAGGTTAGAAAGAAGG - Intronic
971085553 4:23271013-23271035 TCCATCCCTATTTAGGAAAAAGG - Intergenic
971458800 4:26871977-26871999 TGCATCCCATTTTAGAGATAAGG - Intronic
971696942 4:29917126-29917148 TCCATCTCAAATTAAAAAAAAGG + Intergenic
972092425 4:35304105-35304127 TCTATACAAAGTAAGAAATAAGG + Intergenic
972143580 4:35992869-35992891 TGCCTCCCAATTTATAAATATGG - Intronic
973839923 4:54850890-54850912 TCAACCCCAAGTTAGAAATTTGG + Intergenic
974075054 4:57160889-57160911 TCCATCCTAAGTCAGACTTAGGG - Intergenic
977721096 4:100241367-100241389 TTCATCCCATGTTAAAAAAATGG + Intergenic
979627546 4:122862279-122862301 ACCTTCCCTATTTAGAAATAAGG - Intronic
988475413 5:31580726-31580748 TCGATTCCAAGTTACAAATAGGG + Intergenic
990674946 5:58173453-58173475 ACCAACCCAAGTTAGAAACTTGG + Intergenic
1000173152 5:158723730-158723752 TCCTTCCCAATTTAGAGATGAGG - Intronic
1000847732 5:166302305-166302327 TTTATACCTAGTTAGAAATAAGG - Intergenic
1007472302 6:42098878-42098900 CACTTCCAAAGTTAGAAATATGG + Intergenic
1008781024 6:55105110-55105132 TCCATCCCAAATTTGAAGGAAGG - Intergenic
1009230351 6:61053848-61053870 TCCTTCCCAAGTTAAACATTAGG + Intergenic
1010069873 6:71731409-71731431 TCTTTCCCAAGTTAAAAATTAGG - Intergenic
1011312500 6:85995551-85995573 TCAAACCCAAGGTAGCAATAGGG - Intergenic
1014642432 6:123929036-123929058 TCCATCCTATGTTAGAAATTAGG + Intronic
1021035507 7:15793741-15793763 ACCATCCCAAGTGACAAATCAGG + Intergenic
1021404126 7:20244668-20244690 TCCATTTCTAGTTAGAAATCTGG + Intergenic
1022422186 7:30233813-30233835 TCCTTTCCAAGCAAGAAATAGGG - Intergenic
1022669046 7:32438674-32438696 TTGGTCCCAAGTTAGAAATAGGG + Intergenic
1026571253 7:71533153-71533175 ACCAACACAAGTTAGTAATATGG + Intronic
1028029881 7:85897167-85897189 TGCATGCCCAGTGAGAAATAAGG + Intergenic
1030889980 7:114987538-114987560 TCCATCCCATGTTACAATAATGG + Intronic
1031014928 7:116563056-116563078 TCCACCCAATGTTAAAAATATGG - Intergenic
1036012818 8:4746945-4746967 GCCATCCCAAATTAGAGAGAGGG + Intronic
1037858570 8:22388844-22388866 TCTAACCCAATTTGGAAATATGG + Intronic
1041196424 8:55406282-55406304 TCCATTCCATATCAGAAATAGGG + Intronic
1041966249 8:63681107-63681129 TCCATCAGAATTTAGAAATGAGG - Intergenic
1042328573 8:67554754-67554776 TCCATCCCAAGGTAGAAGAGGGG + Intronic
1044910834 8:97056536-97056558 TCCATCACAGGTTTGAAATTTGG + Intronic
1046071780 8:109263806-109263828 TCCATACAAATTTAAAAATAGGG - Intronic
1048637114 8:136309162-136309184 ACCATCCCAATTTAGAGATGTGG + Intergenic
1049487922 8:142876107-142876129 ACAATCCCAAGTAAGAAATGTGG + Intronic
1050767368 9:9151397-9151419 TCCACTCCCACTTAGAAATAGGG - Intronic
1051106777 9:13589254-13589276 TCAATCCCTGGGTAGAAATATGG + Intergenic
1053627560 9:39890953-39890975 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1053730005 9:41044323-41044345 TACATCCAAAGACAGAAATAAGG + Intergenic
1053778433 9:41575070-41575092 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1054216327 9:62359750-62359772 TTCTTCCCATGTTAGAAAAAAGG - Intergenic
1054350103 9:64013130-64013152 TCCATCCCAAGGTGGACATGAGG + Intergenic
1054671154 9:67795593-67795615 TTCTTCCCATGTTAGAAAAAAGG + Intergenic
1054698494 9:68387743-68387765 TACATCCAAAGACAGAAATAAGG - Intronic
1057416610 9:94869388-94869410 CCCCACCCAAGCTAGAAATAGGG - Intronic
1059364401 9:113774791-113774813 TTCACCCCAAGTTAGAAGAAAGG + Intergenic
1059788870 9:117618088-117618110 GCTATCCCATATTAGAAATAAGG + Intergenic
1186007615 X:5090861-5090883 TGCATCCAAAGAGAGAAATATGG - Intergenic
1186944298 X:14548228-14548250 TCCATCCTAGGTTATATATAAGG - Intronic
1187146455 X:16641777-16641799 TTCATCCCAAGTAAGCAGTAAGG - Intronic
1187552186 X:20317181-20317203 TCCCTGAAAAGTTAGAAATATGG + Intergenic
1188540143 X:31240804-31240826 TCAATCCCATTTTATAAATAAGG + Intronic
1193307026 X:79961908-79961930 TCCATGCCAAGGAAGCAATATGG + Intergenic
1195770207 X:108342650-108342672 TGCATCCCTATTTAGAAACAAGG + Intronic
1197283039 X:124560431-124560453 TCAACCCCATTTTAGAAATAAGG + Intronic
1201150162 Y:11091350-11091372 TCCATCCCAAGGTGGACATCAGG + Intergenic
1201151075 Y:11095979-11096001 TCCATCCCAAGGTGGACATGAGG + Intergenic