ID: 1118663456

View in Genome Browser
Species Human (GRCh38)
Location 14:68040714-68040736
Sequence GACCTTACCCAGGTAAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118663456_1118663458 -8 Left 1118663456 14:68040714-68040736 CCAGAACTTACCTGGGTAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1118663458 14:68040729-68040751 GTAAGGTCCATATGAGCCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 120
1118663456_1118663463 22 Left 1118663456 14:68040714-68040736 CCAGAACTTACCTGGGTAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1118663463 14:68040759-68040781 AGCATTCTTAGAGAATCACCCGG 0: 1
1: 0
2: 0
3: 12
4: 132
1118663456_1118663464 23 Left 1118663456 14:68040714-68040736 CCAGAACTTACCTGGGTAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1118663464 14:68040760-68040782 GCATTCTTAGAGAATCACCCGGG 0: 1
1: 0
2: 1
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118663456 Original CRISPR GACCTTACCCAGGTAAGTTC TGG (reversed) Intronic
901080097 1:6579289-6579311 GTCCTTACCCAGGTAGCTGCAGG - Exonic
901345501 1:8537118-8537140 CACCTGAGCCAGGTAAGTTGAGG + Intronic
904315311 1:29656277-29656299 GACCTGGCCCAGGTGAGGTCAGG - Intergenic
908806315 1:67936891-67936913 GACCTCAACCAGGGAAGTTGAGG + Intergenic
1063429723 10:5977769-5977791 GACCTTACCCACGCAAGCCCGGG + Intronic
1067031095 10:42879234-42879256 GCACTTTCCCAGGTAGGTTCCGG - Intergenic
1067168370 10:43883533-43883555 GACCTTTCCCAGGACAGTCCTGG + Intergenic
1069905214 10:71728214-71728236 GATCTTCCCCAGCCAAGTTCTGG + Intronic
1071830055 10:89362647-89362669 TACCTTATCCAGGTAAGTCTGGG - Intronic
1073567884 10:104551060-104551082 GACTTCACACAGGTAATTTCTGG - Intergenic
1078368665 11:10727156-10727178 GATCTTACCTTGGAAAGTTCAGG + Intergenic
1082935718 11:58654591-58654613 GTTCTTACCCAGGTAAGTGTTGG + Intronic
1086830843 11:91561246-91561268 ATCCTTACCTATGTAAGTTCTGG - Intergenic
1097743236 12:63270120-63270142 GTCCTTGCCCATGGAAGTTCTGG + Intergenic
1102618315 12:114173903-114173925 GGCCTTCCCCAGGTGAGTGCAGG + Intergenic
1104482073 12:129116111-129116133 GACCTTACCCAGAGAAGTCTAGG + Intronic
1112254661 13:97818708-97818730 GACCTTACCTAGGGAGCTTCTGG + Intergenic
1114846089 14:26323889-26323911 GACCTCACAGATGTAAGTTCTGG - Intergenic
1115008106 14:28511178-28511200 CACCTTACACAGGAGAGTTCTGG - Intergenic
1115431264 14:33321398-33321420 TGCCTTACCCAGGTTATTTCAGG - Intronic
1118663456 14:68040714-68040736 GACCTTACCCAGGTAAGTTCTGG - Intronic
1119168170 14:72513094-72513116 TAATTTACCCAGGTGAGTTCTGG - Intronic
1126345308 15:47687389-47687411 GACATCACCCAGATAAGTTAGGG - Intronic
1128063182 15:64748088-64748110 GACCATACCCAGGTTAGGACTGG + Intronic
1141861964 16:86723493-86723515 GACCTTAGACCGGTAAATTCAGG + Intergenic
1147175155 17:38651036-38651058 TACCTTACCCAGTGAACTTCTGG + Intergenic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1147592711 17:41695159-41695181 GACATTCCCAAGGTAAGTTGTGG + Intergenic
1150552277 17:66221726-66221748 GAGCTTACCCAAGTAGCTTCAGG + Intronic
1153097174 18:1420126-1420148 GACACTTCCCAGGTAAGGTCAGG - Intergenic
1160176944 18:76602545-76602567 GACCACAGCCAGGTAAGTTTGGG - Intergenic
1162269302 19:9601048-9601070 GAACTGACCCAAGTAACTTCTGG + Intergenic
1162545804 19:11328731-11328753 GACCTAAGCCAGGGAAGTTGAGG + Intronic
1165576410 19:36823274-36823296 GACCTTGCCCAGGTGAGTGAGGG - Exonic
938259466 2:129884763-129884785 GACCTTACTCAGGTGTGTCCAGG + Intergenic
940139248 2:150475248-150475270 TACTTCACCCAGGTAACTTCAGG - Intronic
1171025215 20:21624014-21624036 GACCTTCCCCATGTCTGTTCTGG + Intergenic
1173039087 20:39443316-39443338 TAACTTACCCAGGTACGTACAGG - Intergenic
1174850389 20:53988268-53988290 GAGCTGTCCCAGGTAAATTCTGG - Intronic
1178030452 21:28520130-28520152 CACCATACCCAGCTAATTTCTGG + Intergenic
1182819601 22:33203845-33203867 GACCTTACCCTGGTAGAATCAGG + Intronic
949405490 3:3709556-3709578 GATCTTACAAAGGTAAGATCAGG - Intronic
949751671 3:7358963-7358985 CACCTCGCCCAGGTAAGTTTGGG - Intronic
953362062 3:42306094-42306116 GACCTTGTCAAGTTAAGTTCAGG - Intergenic
962738763 3:138348314-138348336 GATCTGACCCGGGTAAGTGCTGG + Exonic
965546734 3:169923714-169923736 GACCTGACCTAAGTAAGTCCAGG - Intronic
966599186 3:181758390-181758412 GACCTAACCTGGGTTAGTTCAGG + Intergenic
967428768 3:189357929-189357951 CACCTGACCCAGGGAAGTTGAGG + Intergenic
973985303 4:56346379-56346401 ATCTTTACCCAGGTGAGTTCTGG - Intronic
978194373 4:105953828-105953850 GGCATTACCCAGGCCAGTTCTGG - Intronic
978913453 4:114094594-114094616 AATCTTACCCATGTAAGTTTGGG - Intergenic
1000329448 5:160195606-160195628 CACCTTACCCAGATAATTTTTGG + Intronic
1003618265 6:7674439-7674461 CAGCTTACCCAGGTGAGTTCTGG + Intergenic
1005946503 6:30599672-30599694 GACCTTAGCCAGGTTAGTGTTGG - Intergenic
1006784168 6:36653770-36653792 CACCTGACCAAGGTCAGTTCAGG + Intergenic
1011193198 6:84754956-84754978 GAGCTTACCCAGGAAAATTTGGG - Intronic
1012281916 6:97337732-97337754 GACCATACCTAGGCAAATTCCGG + Intergenic
1016345748 6:143112299-143112321 GACATAACCAAGGTAAGTTTTGG - Intronic
1017825034 6:158075485-158075507 CACCATACCCAGGTAATTTTTGG - Intronic
1021091713 7:16490791-16490813 GACCTTGCCTAGTTCAGTTCTGG - Intronic
1024197070 7:47069580-47069602 GGCCTTGCCCAGGAAATTTCTGG + Intergenic
1029186919 7:98745946-98745968 GACCTCAGCTATGTAAGTTCAGG + Intergenic
1032673997 7:134111336-134111358 CATCATCCCCAGGTAAGTTCTGG + Intergenic
1035157567 7:156926409-156926431 GACCTAACACAAGTGAGTTCAGG - Intergenic
1038358145 8:26849358-26849380 GACCTTGCCTGGGAAAGTTCAGG - Intronic
1038672606 8:29594698-29594720 GAACATACCCAGGGAAGTACAGG + Intergenic
1041798915 8:61776813-61776835 GACCTTACCCTGCTCTGTTCAGG + Intergenic
1043855706 8:85262565-85262587 GATCTTACTGAGGTAAGTCCTGG + Intronic
1044805529 8:96004834-96004856 GAGATTACTCAGGTAAGTTGGGG + Intergenic
1053411262 9:37917516-37917538 GACCTCACACTGGCAAGTTCAGG - Intronic
1061325127 9:129859042-129859064 GACGTTACCCAGGTGGTTTCTGG - Intronic
1186240567 X:7561038-7561060 GACCCTAACCACATAAGTTCTGG - Intergenic
1194987912 X:100511343-100511365 TACCTTTCCCAGGTAAGTACGGG - Intergenic
1202031455 Y:20578463-20578485 GTCCTGACGCAGCTAAGTTCAGG + Intronic