ID: 1118667342

View in Genome Browser
Species Human (GRCh38)
Location 14:68085398-68085420
Sequence CCTTATGAGCAGCTTTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118667340_1118667342 -10 Left 1118667340 14:68085385-68085407 CCTAGTATAGCAACCTTATGAGC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1118667342 14:68085398-68085420 CCTTATGAGCAGCTTTTTCAAGG 0: 1
1: 0
2: 0
3: 13
4: 135
1118667337_1118667342 16 Left 1118667337 14:68085359-68085381 CCAAGGAGAATGCATAGAGAAGA 0: 1
1: 0
2: 2
3: 41
4: 311
Right 1118667342 14:68085398-68085420 CCTTATGAGCAGCTTTTTCAAGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118667342 Original CRISPR CCTTATGAGCAGCTTTTTCA AGG Intronic
900691139 1:3981376-3981398 CCTTTTGAGCTGCTTTTGCTGGG - Intergenic
901078167 1:6568612-6568634 GCTTATGGGCAGCTTTGTTAAGG + Intronic
901387824 1:8922646-8922668 CTTTGTGAGCAGCTTTGTTAAGG - Intergenic
904848256 1:33437121-33437143 GCTTATGAGCTGCTTTCCCAAGG - Intergenic
906800422 1:48732413-48732435 CTTTATGAGCATCTTGTTCAGGG - Intronic
907757665 1:57326662-57326684 CCTGATGAGGGTCTTTTTCATGG + Intronic
908147999 1:61267825-61267847 CCTGATTAGGAGCTTTTTGAGGG + Intronic
909287089 1:73833352-73833374 ACTTATTACCAGCATTTTCATGG - Intergenic
913052917 1:115132654-115132676 TCTTAGCAGCAGCATTTTCATGG + Intergenic
918068399 1:181117523-181117545 CTTTCTGAGCAGCTCTCTCAAGG - Intergenic
918114483 1:181484685-181484707 CCTGATGAGCTGCTCTTTCTTGG - Intronic
918570516 1:185986321-185986343 CCTTAAAATCAGATTTTTCAAGG - Intronic
919509259 1:198440404-198440426 CCTTACAAGCAGATTTTTCAGGG + Intergenic
921925475 1:220707132-220707154 CCGTTGGAGCAGCTTTCTCAGGG - Intergenic
923863695 1:237917407-237917429 CCTGCTGAGCAGGTCTTTCATGG - Intergenic
1063926484 10:10982579-10982601 TCTGATGAGCAGCTCTTTCCTGG - Intergenic
1067164081 10:43851634-43851656 ACAAATGAGCAGCCTTTTCAAGG + Intergenic
1067757273 10:49014745-49014767 CCCTAGGAGCAGCTTTCTCCTGG + Exonic
1067943069 10:50672283-50672305 ACTTATGATCAGCCCTTTCAGGG - Intergenic
1071728080 10:88219674-88219696 CCTTAAGAGGAGCTTTTATATGG - Intergenic
1072636617 10:97182505-97182527 CTCTTTGAGCAGCTCTTTCACGG + Intronic
1073632992 10:105167379-105167401 GCTAATGAGCAGCTTTTTAGTGG + Intronic
1073822149 10:107275962-107275984 CATAATGAGCAGCTTTTTGTTGG + Intergenic
1074504086 10:114052196-114052218 CTTTAAGAGCAGTTTTTACAAGG - Intergenic
1075803532 10:125168274-125168296 CCTTATTTGTAGATTTTTCAGGG + Intergenic
1077298445 11:1836671-1836693 CCTGATGGGCAGCATTTTCGGGG + Intronic
1078664917 11:13316282-13316304 CCTTAAGAGAAGCTGCTTCATGG + Intronic
1078955124 11:16185175-16185197 CATTAGGGGCAGCTTTATCATGG - Intronic
1087282427 11:96226509-96226531 CCTCTAGAGCAGCTTTTCCAGGG - Intronic
1089044588 11:115489330-115489352 TCTTATTATCAGCTTTTTTAGGG - Intronic
1089326609 11:117661750-117661772 GCTAATGAGCAGCTTTTTCCTGG + Intronic
1089778584 11:120856952-120856974 CCTTGTGGGCAGCTTCTGCAAGG - Intronic
1093560084 12:20528046-20528068 CCTTTTGAGCAGGTTTTAAAAGG + Intronic
1093844482 12:23951746-23951768 CCTTGTTAACAGCTTTTTCAGGG - Intergenic
1097090243 12:56499078-56499100 CCTGCTGAGCAGGTCTTTCATGG + Intergenic
1097801534 12:63919733-63919755 ACTTATGAGCATATTTTTAAGGG - Intronic
1099960092 12:89388609-89388631 CATCATCAGAAGCTTTTTCAGGG + Intergenic
1100909585 12:99343510-99343532 CATTGTCAGCTGCTTTTTCAGGG + Intronic
1107996797 13:45869149-45869171 CCTGATGATCAGCATTCTCATGG + Intergenic
1108771414 13:53705517-53705539 CCTAAGGAACTGCTTTTTCAAGG + Intergenic
1108955538 13:56152347-56152369 TCTTCTGAGAAGTTTTTTCATGG + Intergenic
1109183129 13:59238199-59238221 TCTTATGACCTGATTTTTCATGG - Intergenic
1110642290 13:77839660-77839682 TCTTATGATCACATTTTTCAGGG + Intergenic
1112674243 13:101680007-101680029 AGTTATGAGCAACTTTTTCTTGG + Intronic
1113608882 13:111629273-111629295 CCTTATGCACAGCCTGTTCAGGG + Intronic
1114167879 14:20240261-20240283 CCTATTGAGCACCTTATTCAAGG + Intergenic
1117153037 14:52908766-52908788 CCTTTTGATCAGCTTTGTTAAGG - Intronic
1118667342 14:68085398-68085420 CCTTATGAGCAGCTTTTTCAAGG + Intronic
1121590591 14:95103990-95104012 CTTGATGTGCAGCATTTTCAGGG + Exonic
1122506597 14:102235587-102235609 CCTTATGGGCAGTTTTGTTAAGG - Intronic
1124986563 15:34622319-34622341 CTTTATGATTAGCTTTTTCCTGG + Intergenic
1129939721 15:79484560-79484582 CCTTATGACTAGCATTTACAGGG - Intergenic
1132967719 16:2668334-2668356 CCTGCTGAGCAGGTCTTTCATGG + Intergenic
1134669543 16:16044615-16044637 CCTCATGAGCTTCTTCTTCAAGG + Exonic
1135855281 16:26004147-26004169 CCTTAAGAAAACCTTTTTCAGGG - Intronic
1137765054 16:50971643-50971665 CCAGATGAGAAGCTTTTTGAGGG - Intergenic
1139029137 16:62858202-62858224 GCTTATAAGCAGCTCTTACATGG + Intergenic
1140726545 16:77818469-77818491 TCTTATGTGCAGCACTTTCAGGG - Intronic
1141919241 16:87124215-87124237 CCTAGTGAGCATCTTTCTCAAGG - Intronic
1144674329 17:17152317-17152339 CTTCATGAGCAGCTTTCTCCAGG + Intronic
1147837809 17:43347492-43347514 CCTGCTGAGCAGGTCTTTCATGG + Intergenic
1149014496 17:51892015-51892037 CCTTTTGAGTAGCTAGTTCATGG + Intronic
1157431316 18:47629292-47629314 CCATGTGTTCAGCTTTTTCATGG + Intergenic
1158118370 18:54022406-54022428 CCACATGAGCAGCTTATTAATGG + Intergenic
1164084411 19:21888316-21888338 CCTGCTGAGCAGGTCTTTCATGG + Intergenic
1164355446 19:27421685-27421707 CATTTTGAGAAACTTTTTCATGG + Intergenic
1164421613 19:28098696-28098718 CTTTGTGAGCTGATTTTTCAGGG + Intergenic
1166955781 19:46464006-46464028 CCAAATGGGCAGCTTTTTCTTGG + Intergenic
925726673 2:6879350-6879372 TCTTATGAGCATCGTTGTCAAGG + Intronic
926550244 2:14292900-14292922 CCTTGTAAGCAGCATTTTTAAGG - Intergenic
940120021 2:150253938-150253960 CCTTATATGCAGCTCTTCCAGGG - Intergenic
941764763 2:169284764-169284786 CCTTAGGTGGAGCTTTCTCAGGG - Intronic
945541797 2:211097166-211097188 CCTCATGAGTAACTTTTTGATGG + Intergenic
1173388172 20:42607910-42607932 CCTTATGAGCTGGTGTTTCAGGG - Intronic
1173757141 20:45526449-45526471 CCAAATGAGCAGCCTTTTCAGGG + Intergenic
1174928948 20:54792731-54792753 CCTTATCTGCATCTCTTTCAGGG + Intergenic
1177498423 21:21918607-21918629 GCTTATCAGCAGGTTTTTGATGG - Intergenic
1177625694 21:23656596-23656618 CCTTTTGAGCAGCTTAGTAATGG - Intergenic
1177838104 21:26208235-26208257 CATAATGAGCAACTCTTTCAAGG - Intergenic
1177904460 21:26958798-26958820 CATTATGAACAGATTGTTCAGGG + Intronic
1179323052 21:40311633-40311655 CATTATGAAAAGCTATTTCATGG + Intronic
1180400373 22:12413948-12413970 CATTCTGAGGAACTTTTTCATGG + Intergenic
1182758554 22:32701502-32701524 ACTTAATAGCAGCTTTTTAATGG - Intronic
1183798258 22:40138923-40138945 CCTTTTCAGCAGCTTTATTAAGG + Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953060055 3:39419878-39419900 GCTTAAAAGCAGGTTTTTCATGG - Intergenic
959098077 3:101978207-101978229 GCTTTTGAGGATCTTTTTCATGG - Intergenic
959156604 3:102674093-102674115 CCCCATGAGCTGCTTGTTCACGG - Intergenic
963382308 3:144546771-144546793 CTTTCTGAGCAGCTGTGTCAGGG - Intergenic
964777694 3:160296126-160296148 CCTTTTTAACAGATTTTTCAGGG - Intronic
966559568 3:181304908-181304930 CACTATGAGCATCTTTTACAAGG - Intergenic
967616127 3:191568862-191568884 CAATATTAGCAGCTATTTCATGG - Intergenic
969276925 4:6142036-6142058 CCTTCTGGGCTGCTTTTCCAGGG + Intronic
971905597 4:32720813-32720835 ACTTTTGAGCATCTTTGTCATGG + Intergenic
977036742 4:91962963-91962985 CATTCTGACCAGCATTTTCAGGG - Intergenic
980941922 4:139282985-139283007 CCTGATAAGCATATTTTTCATGG + Intronic
984051495 4:174870281-174870303 CCTTATGGTCAGATTATTCAGGG + Intronic
984180181 4:176473175-176473197 CCTTATGAGTAGCTTTGTCTAGG - Intergenic
984351855 4:178604550-178604572 CCTAATTAGCTGCATTTTCAAGG + Intergenic
985503447 5:263611-263633 TTTTATGACCAGCTTTTTTATGG - Intergenic
985530405 5:430716-430738 GCTTATGAGCAGCTTCTGCCTGG + Intronic
985979444 5:3450294-3450316 CCTTAAGAGCTGCCTTTTCATGG - Intergenic
987683647 5:21168482-21168504 ACTTATCAAAAGCTTTTTCAAGG + Intergenic
988213613 5:28242704-28242726 CCTTAAGAGACGCTTATTCAGGG - Intergenic
988298173 5:29391822-29391844 CTTTGTGAGCAGCTTTGTTAAGG - Intergenic
992311857 5:75510150-75510172 TCTTATGACCAGCTTGTTGAGGG + Intronic
996768947 5:127065270-127065292 ACTTCTGACCAGATTTTTCATGG - Intronic
1000834220 5:166134856-166134878 CTTTATGGGCAGCTTTGTTAAGG + Intergenic
1000844440 5:166261723-166261745 CCTTATGAACAACATTCTCAAGG + Intergenic
1001075913 5:168627920-168627942 CTTTAAGAGCAGCCTCTTCATGG + Intergenic
1005953777 6:30649552-30649574 CCTTAGGACCAGCTTTATCCAGG + Exonic
1008853228 6:56050212-56050234 CCTCACGTGCAGATTTTTCATGG - Intergenic
1011008007 6:82669735-82669757 TCCTATGAGCATCTCTTTCAAGG - Intergenic
1011253520 6:85398159-85398181 TATTTTGAGCATCTTTTTCATGG - Intergenic
1013150823 6:107444599-107444621 ACTTATGAAGAACTTTTTCATGG - Intronic
1016719710 6:147281779-147281801 CCTTCTGAACAGATTCTTCAAGG - Intronic
1016785603 6:148007478-148007500 CCATAAGAGCATCTTTTTCCAGG - Intergenic
1018351203 6:162961170-162961192 GGTTATGAGCAGCTTTCACATGG - Intronic
1018964969 6:168477945-168477967 CTTTATGAGCAGTTTTCTCCTGG - Intronic
1021541865 7:21768612-21768634 CCGTATCATCAGCTTTTTCAGGG + Intronic
1025143501 7:56484556-56484578 CCTCACCAGCACCTTTTTCACGG + Intergenic
1025875597 7:65477620-65477642 CCTTATGGGCTGCTTTGTTAAGG - Intergenic
1026978674 7:74514224-74514246 CCCTAAGATCAGCTGTTTCAGGG + Intronic
1030793899 7:113763241-113763263 CCAAATGAGCAGCTTTGTCATGG + Intergenic
1031133559 7:117861340-117861362 CCTTAGGAAAAGATTTTTCATGG - Intronic
1032828939 7:135602924-135602946 CCTTTAGAACAGCTTTTGCAGGG + Exonic
1039360515 8:36872096-36872118 CCTTATCATCATCTTTCTCAGGG + Intronic
1040499953 8:47997304-47997326 CCTTATGGGCAGTTTTGTTAAGG + Intergenic
1045551972 8:103180953-103180975 CCTTTTGAGCTGTGTTTTCAGGG - Intronic
1047260613 8:123256069-123256091 TCTCATTAGCAGCTTTCTCATGG + Exonic
1047277020 8:123413782-123413804 CCTTATTTGCAGCTTTTCCCAGG - Intronic
1049301038 8:141870564-141870586 CCTGCTGCGCAGCTTTGTCAGGG + Intergenic
1053083318 9:35195640-35195662 CCTTATGAACACCCTTTTCTTGG - Intronic
1055318061 9:75053951-75053973 CCCCATGAGCAGCTTTTCCATGG - Intergenic
1056546659 9:87619469-87619491 CGCAATGAGGAGCTTTTTCATGG + Intronic
1056957002 9:91090594-91090616 CCTTGTGATCAGCTTCTTGAAGG - Intergenic
1057441994 9:95089981-95090003 CCTTGTGAGCAGGTGTTTCTTGG - Intergenic
1060618221 9:125038440-125038462 CCTTTTGAGCTGCTGTTTCTTGG + Intronic
1185779739 X:2833966-2833988 GCTTATGAGGAGCTATTTGAGGG - Intronic
1186629987 X:11338246-11338268 GCTTATGAGCAGCGTTATTAGGG + Intronic
1187276789 X:17823410-17823432 TCTTCTCAGCAGCTTTTCCATGG + Intronic
1187996348 X:24931036-24931058 CCGTATGATCAGCTGTTGCATGG + Intronic
1190487841 X:50946446-50946468 CATTATGTGCAGTTTTTCCATGG + Intergenic
1191778582 X:64844355-64844377 CTTTATGGGCAGCTTTGTTAAGG - Intergenic
1192151110 X:68712964-68712986 CAGTATGTGCAGCTTTTTGAAGG + Exonic
1199664791 X:150088159-150088181 CCTTCTCAGCAGCTTTTGAAAGG - Intergenic
1201290301 Y:12416025-12416047 GCTTATGAGGAGCTATTTCAGGG + Intergenic
1201310888 Y:12597397-12597419 CCTTATGGGCAGCTTTGTTAAGG + Intergenic
1201707725 Y:16955130-16955152 CCTGCTGAGCAGGTCTTTCATGG - Intergenic