ID: 1118668667

View in Genome Browser
Species Human (GRCh38)
Location 14:68099154-68099176
Sequence TCACTTCCTACTCTTTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118668663_1118668667 17 Left 1118668663 14:68099114-68099136 CCTAACTTGGGAAAGTCTCTTTG 0: 1
1: 0
2: 1
3: 19
4: 148
Right 1118668667 14:68099154-68099176 TCACTTCCTACTCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 194
1118668662_1118668667 18 Left 1118668662 14:68099113-68099135 CCCTAACTTGGGAAAGTCTCTTT 0: 1
1: 0
2: 0
3: 17
4: 210
Right 1118668667 14:68099154-68099176 TCACTTCCTACTCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 194
1118668664_1118668667 -10 Left 1118668664 14:68099141-68099163 CCCCAGCTGCTAATCACTTCCTA 0: 1
1: 0
2: 1
3: 19
4: 271
Right 1118668667 14:68099154-68099176 TCACTTCCTACTCTTTGTTGTGG 0: 1
1: 0
2: 0
3: 17
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118668667 Original CRISPR TCACTTCCTACTCTTTGTTG TGG Intronic
901613270 1:10516597-10516619 ACCCTTTCTAGTCTTTGTTGTGG + Intronic
902874759 1:19334141-19334163 TCTCTGCCTACTGTTTGGTGGGG - Intergenic
904199133 1:28807961-28807983 TGACTTTCTAGTCTTTGTTCTGG + Intergenic
908641376 1:66227865-66227887 TGACTTCCTCATCTTAGTTGAGG + Intronic
908840679 1:68277140-68277162 TCACTTCCCCTTGTTTGTTGTGG - Intergenic
909284805 1:73802281-73802303 TCACTTCATGCTTTTTGTTATGG + Intergenic
913163214 1:116164219-116164241 TCACTTCCTGCTCTTTCCTGTGG + Intergenic
913997153 1:143660894-143660916 AAACTTCAAACTCTTTGTTGTGG - Intergenic
914846452 1:151286418-151286440 TCACTTCCTACACCTGGTTCTGG - Exonic
914929984 1:151922422-151922444 TCACTTCCACTTCTTTGTTCAGG + Intergenic
915211385 1:154312363-154312385 TCTCTTCCTTATCTTTGCTGGGG + Intergenic
916123437 1:161549347-161549369 TCAATTTCTACCCTTTCTTGTGG - Intronic
916339768 1:163718934-163718956 ACCCTTCCTTCTGTTTGTTGTGG + Intergenic
918010015 1:180577924-180577946 TCACTTACAACTCTTGCTTGTGG - Intergenic
918856671 1:189764450-189764472 TCAACTCCTTCTCTCTGTTGTGG + Intergenic
919276908 1:195430500-195430522 TTACTTCCTACTCTTTCCAGAGG + Intergenic
920423099 1:205849428-205849450 CCACTGCCCACTCTTTGCTGTGG + Intronic
920447698 1:206031818-206031840 TCACTTCTTACTCTGTGATTAGG + Intergenic
920761409 1:208786836-208786858 TCACTTCCTCCTGTTAGGTGTGG - Intergenic
921220300 1:212968852-212968874 TAACTTCAGACTCTTTGTTGAGG + Intronic
922508940 1:226146649-226146671 ACAACTCCTACTCTTTGTGGCGG - Exonic
1063540578 10:6929725-6929747 TCTCTTCCAATTGTTTGTTGAGG - Intergenic
1070324008 10:75375929-75375951 TCACTTCCTCCTCTGTGAAGAGG - Intergenic
1070750088 10:78958908-78958930 TGACTTCCTTCTCTGTGTAGAGG - Intergenic
1071300804 10:84254504-84254526 TCACATCCAATTCTTTGTTCGGG - Intronic
1073744561 10:106451294-106451316 ACACTTCCTATTCTTTCTTATGG + Intergenic
1075110837 10:119581986-119582008 TCACTTCCATGTGTTTGTTGGGG - Exonic
1075321835 10:121497591-121497613 TCATTGCCTACTGTTTGTTATGG - Intronic
1075621468 10:123931046-123931068 TTAGTTCTTACTCTCTGTTGTGG - Intronic
1078478428 11:11655013-11655035 TCACTCCCTCCTCCTTCTTGTGG - Intergenic
1080120611 11:28673219-28673241 TGACTTCCTCTTCTTTGTTTAGG + Intergenic
1081581373 11:44354608-44354630 TCACTTCCTCCTCTATGTTCGGG + Intergenic
1082939183 11:58686067-58686089 TCACCTCCTAGCCTTTGCTGAGG + Intronic
1085287325 11:75372106-75372128 CCCCTTCCTTCTCTTTATTGGGG + Intergenic
1089764148 11:120750865-120750887 TCACTTCCTCATCTGTGATGAGG - Intronic
1091288823 11:134425314-134425336 TGTCTTCCTCCTCTTTGCTGTGG + Intergenic
1091574276 12:1718415-1718437 TGACTTTGTACTCTTTGGTGAGG + Intronic
1092822068 12:12362036-12362058 TTATTTCCTAATCTTTGGTGGGG - Intronic
1093256640 12:16875861-16875883 CTACTTCCTACTCTTTGTATAGG + Intergenic
1094765864 12:33594106-33594128 TCACTTCCTACACTTTGGATAGG - Intergenic
1096745282 12:53722861-53722883 TGAGCTCCTACTCTCTGTTGCGG - Intronic
1096753870 12:53782676-53782698 TCACTTTCTACTTTGTATTGCGG - Intergenic
1099009449 12:77274629-77274651 TCACATCCTGCTCCTTGTTTGGG - Intergenic
1099156898 12:79188747-79188769 TCTCTCCTTACTCTTTGTGGGGG - Intronic
1099234112 12:80061867-80061889 TCACATCCTTTTTTTTGTTGTGG + Intergenic
1099392123 12:82094526-82094548 TCAGCTGCTACTATTTGTTGAGG + Intergenic
1100080730 12:90846931-90846953 TCTCCACCAACTCTTTGTTGGGG - Intergenic
1101580605 12:106038187-106038209 TCACCTCCTGCTGTTTTTTGAGG + Intergenic
1102390962 12:112548253-112548275 TCACTTACTCCTCTGTGATGGGG + Intergenic
1102811446 12:115827620-115827642 TCACTCCCTTCTCTGGGTTGTGG - Intergenic
1106870987 13:34020518-34020540 TCACTTCCTGCTCTGCGTTGGGG - Intergenic
1109558366 13:64012473-64012495 TAACTTCCTACTCTTAACTGTGG - Intergenic
1109872630 13:68353970-68353992 ACACTTCTTATTGTTTGTTGTGG + Intergenic
1110019002 13:70445071-70445093 TAATTTCCTAGTTTTTGTTGAGG - Intergenic
1110536757 13:76659423-76659445 AAACTTCCTTCTCTTTGCTGAGG - Intergenic
1110672821 13:78202133-78202155 TCAGCTCCTACTTATTGTTGAGG + Intergenic
1110977567 13:81859806-81859828 TCAAATCTTACTCTTTATTGAGG + Intergenic
1111396360 13:87672964-87672986 TCCCTTCCTTCTCTTTGGGGCGG + Intronic
1112523515 13:100120496-100120518 TGACATCCTATTCTTTGTTGAGG + Intronic
1112666083 13:101575254-101575276 GCACATGCTACTCTTTCTTGAGG - Intronic
1114907328 14:27146644-27146666 TGACTTGCTAGTATTTGTTGAGG + Intergenic
1115398305 14:32933567-32933589 CCACTTCCTCCTCTTTCTTCCGG - Intergenic
1116652066 14:47605870-47605892 TCCCTTCCCACTCTTTAGTGTGG + Intronic
1118668667 14:68099154-68099176 TCACTTCCTACTCTTTGTTGTGG + Intronic
1119529864 14:75352539-75352561 TCACCTCCTGCTCTGTGTTAAGG + Intergenic
1123580994 15:21714804-21714826 TCACTGCCTTCTCTTAGGTGGGG + Intergenic
1123617643 15:22157427-22157449 TCACTGCCTTCTCTTAGGTGGGG + Intergenic
1126583650 15:50262777-50262799 TTCCTTCCTTCTCTTTGGTGTGG + Intronic
1128554330 15:68620879-68620901 AGACTTTCTACCCTTTGTTGGGG - Intronic
1128610249 15:69067345-69067367 TCCCTTCCTGGTCTTTGGTGGGG - Intergenic
1130298190 15:82661974-82661996 TCACTTCCCACCCTGTGTAGAGG + Intronic
1130506353 15:84546772-84546794 TCAATTCATACTCTTAGTTTTGG - Intergenic
1132951082 16:2562847-2562869 GGACTTCCTTCTCTTTGTGGCGG + Intronic
1132963267 16:2637323-2637345 GGACTTCCTTCTCTTTGTGGCGG - Intergenic
1133597449 16:7306403-7306425 TCACTTCTAAATATTTGTTGTGG - Intronic
1134133509 16:11665446-11665468 TTCCTGCCTCCTCTTTGTTGGGG + Intergenic
1134751064 16:16625518-16625540 TCATTTCCTTCTCTTTCTTTTGG - Intergenic
1134994392 16:18728073-18728095 TCATTTCCTTCTCTTTCTTTTGG + Intergenic
1135797460 16:25459157-25459179 TCATTTCTCACTCTTTCTTGTGG - Intergenic
1136074418 16:27807066-27807088 TCACTTCAAACACTTTGCTGTGG - Intronic
1136956140 16:34788322-34788344 TCATGTCCTATTCTTTCTTGAGG + Intergenic
1137874677 16:51984603-51984625 TTTCTTCCCACTCTTTCTTGAGG - Intergenic
1138066137 16:53943154-53943176 TCAATTCCTACACATTTTTGAGG - Intronic
1139063800 16:63288766-63288788 TAACTTCCTGCTCATTCTTGGGG + Intergenic
1139609993 16:68049126-68049148 TCACTGCCTGCCCTTTGCTGAGG + Intronic
1140186257 16:72774829-72774851 TCACTTGCTACTCTTTTCTATGG - Intergenic
1140200744 16:72892839-72892861 TCACTGCCTTCTCTGTGATGAGG + Intronic
1140936491 16:79675574-79675596 TCACTTGCCAATATTTGTTGAGG + Intergenic
1141014075 16:80431479-80431501 GCACATCCTACTCTGTGTTTTGG - Intergenic
1142164548 16:88579173-88579195 CCACTTCCTACACTTCGCTGCGG - Intronic
1142903171 17:3026107-3026129 TCTCTTACTTCTCCTTGTTGGGG - Exonic
1143173226 17:4942215-4942237 TCACTTCCTCCTCCTTCCTGGGG - Intronic
1143880838 17:10028599-10028621 TATCTTCCTGCCCTTTGTTGAGG - Intronic
1146118340 17:30164081-30164103 TCACTTTCTTCCCTTTTTTGTGG + Intronic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1158370032 18:56790632-56790654 TCTCTTCCTGCTTTTTTTTGTGG + Intronic
1158556181 18:58476529-58476551 TATCTTCCAACTCTTTGCTGCGG - Intergenic
1158736392 18:60086890-60086912 TCCCTTCCCACTCTTTGTCTTGG + Intergenic
1158927964 18:62289822-62289844 CCTCTTTCTACTCTCTGTTGGGG - Intronic
1159909850 18:74135338-74135360 TCTCTTCCTTCTCTTTCTTTAGG + Intronic
1160173392 18:76572903-76572925 TCACTTCCTACTCTCTCTGTTGG + Intergenic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1164567658 19:29339469-29339491 CCTCTTCCTTCTCTTGGTTGAGG - Intergenic
1166007517 19:39917598-39917620 TCACTTCCTCCTCTTTCTCTTGG + Intronic
927981927 2:27379915-27379937 TCACTTCCATCACTTTGTTGAGG - Intronic
929868263 2:45736621-45736643 TCACTTTCTACCATGTGTTGTGG + Intronic
930247105 2:48995431-48995453 ACACTTGCTACTCTTAGTTTAGG - Intronic
933100576 2:78251537-78251559 TCATTTGCTACTGTTTCTTGTGG + Intergenic
933626867 2:84611002-84611024 TCACTTCCCACTCTAGGTTTGGG - Intronic
933910044 2:86931364-86931386 TGACTTCCTAATCTATGTTCTGG + Intronic
934022683 2:87972024-87972046 TGACTTCCTAATCTATGTTCTGG - Intergenic
935761359 2:106323611-106323633 TCTCCTCCTCCTCTTTTTTGAGG - Intergenic
936413594 2:112283075-112283097 TGACTTCCTAATCTATGTTCTGG + Intronic
937240972 2:120462475-120462497 TCCCATTCTACTCTTTGCTGTGG + Intergenic
937302458 2:120851659-120851681 TCACTGCCTCCTCTGTGTTCGGG - Intronic
938243871 2:129762856-129762878 ACACTTCCTAGTCTTTTTGGGGG - Intergenic
938519429 2:132052336-132052358 TCATGTCCTAGTCTTTCTTGAGG - Intergenic
942045782 2:172098566-172098588 CCACTTCATACTCTTGGTGGGGG - Intergenic
943517347 2:188905503-188905525 TCTCTTCCTTACCTTTGTTGTGG + Intergenic
946548683 2:220776277-220776299 TCAGTTCCTTCTCAGTGTTGAGG + Intergenic
1169538759 20:6577126-6577148 TCTCTTGCTACTCTTTCCTGTGG - Intergenic
1169648467 20:7840926-7840948 TCAGTTCATTATCTTTGTTGAGG - Intergenic
1169869472 20:10235901-10235923 TACCTTCCAAGTCTTTGTTGAGG + Intronic
1171567972 20:26212575-26212597 TCATTTCCTACTTTTTGGTATGG - Intergenic
1171867069 20:30494132-30494154 TTTCTTCCTATTCTTGGTTGTGG - Intergenic
1172267457 20:33628895-33628917 TCACTCCCTAATCTTTGTGATGG + Intronic
1172895148 20:38295125-38295147 GCAGTTATTACTCTTTGTTGGGG - Intronic
1175518972 20:59587648-59587670 TCACTTCCTGCTCGTTCTGGTGG + Intronic
1175563049 20:59948890-59948912 CCACTTACTACTCCATGTTGAGG + Intergenic
1177510725 21:22084198-22084220 TCACTGCCTACATTTTGCTGAGG + Intergenic
1178515020 21:33239264-33239286 TCCCTTCCTTCTCTTATTTGGGG - Intronic
1178616885 21:34142578-34142600 TCACTTCTTCCTCTTCTTTGTGG - Exonic
1182034528 22:27187320-27187342 TCACTGCCTACCATGTGTTGAGG + Intergenic
1184002084 22:41682456-41682478 TCACTTCCTGCTCTTGGGGGCGG - Exonic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951926076 3:27910014-27910036 TTTCTTCCTACTCTGTGTTATGG - Intergenic
956355254 3:68384241-68384263 TGGTTTCCTACTTTTTGTTGTGG + Intronic
956487352 3:69737118-69737140 TCTCATCCTACTCCTTGTTCAGG - Intergenic
957110869 3:75955422-75955444 TCCTTTCCTACTTTTTGATGTGG + Intronic
964945807 3:162222332-162222354 TTTCTTCCTACTCTCTGTTGCGG + Intergenic
965630690 3:170729574-170729596 TCACTTCCTTCCAATTGTTGAGG - Intronic
966126380 3:176581580-176581602 GCACTTCATACTCTTTGATTAGG - Intergenic
967038275 3:185664744-185664766 CCACTTCCCACTCTTTGTCTTGG - Intronic
968755375 4:2413188-2413210 TCATTTCCTGCGCTTTGCTGAGG - Intronic
969215517 4:5719315-5719337 TCTCTTCCTCCTCCTTGATGGGG - Exonic
971775606 4:30960433-30960455 TCACTTCCTACTGCTTATTGAGG + Intronic
972400315 4:38695785-38695807 TCACCTCAAACTCTTTGATGTGG + Intronic
975488101 4:74957465-74957487 TCTCTCCCTACACTTTGTTCTGG + Intronic
975909087 4:79247513-79247535 TCTCTTCTTATTCTTAGTTGTGG - Intronic
976376280 4:84349193-84349215 TCATTTCCAAATCTTTTTTGGGG - Intergenic
976420364 4:84835786-84835808 TCGCTTCCTACTCTCAGTAGTGG + Intronic
976738086 4:88331034-88331056 TCACTCCATCCTCTTTGCTGGGG - Intergenic
977316303 4:95452907-95452929 ATACTCACTACTCTTTGTTGTGG + Intronic
977350943 4:95886180-95886202 TCATTTTCTCCTCTTGGTTGGGG + Intergenic
978131017 4:105197638-105197660 TCACTTTTTACTCTTTGGTCAGG - Intronic
978238432 4:106487995-106488017 TCACCTCCTCCTCCTTGTTCTGG + Intergenic
978501057 4:109410414-109410436 TCACTTCCTGCCCTTTGTTATGG - Intergenic
983768796 4:171521619-171521641 TCTTTTCCCCCTCTTTGTTGGGG - Intergenic
986389407 5:7269661-7269683 TCACTTCCTTATCTTTGCTTGGG + Intergenic
986389659 5:7272843-7272865 TCACTTCCTTACCTTTGCTGGGG + Intergenic
988586015 5:32508163-32508185 CCACCTCCGACTCTTTGTTGTGG + Intergenic
990165702 5:52990639-52990661 CCACTTGCTATTCTTTATTGTGG + Intronic
992279985 5:75164454-75164476 TCATTTATTACTCTTTGGTGAGG + Intronic
993277214 5:85875783-85875805 CTAGTTCCTACTCTTTGTTTGGG - Intergenic
993779105 5:92043291-92043313 TAACTACCTACACTTTGTAGTGG + Intergenic
1000687988 5:164276582-164276604 TCACTTTCTAATATTTGTTTTGG - Intergenic
1000924592 5:167178396-167178418 TCACTTCCTTCACCTTGTTCTGG - Intergenic
1001062354 5:168503570-168503592 TAACTTCATATTTTTTGTTGTGG + Intronic
1004474927 6:15962410-15962432 TCAGCCTCTACTCTTTGTTGAGG - Intergenic
1007047753 6:38795060-38795082 CCACTCCCCACTCTTTGTTTTGG + Intronic
1009741182 6:67748043-67748065 TCTCTTCCTTACCTTTGTTGAGG - Intergenic
1010113967 6:72278427-72278449 TCACTTGATACTCTTGGTTGAGG - Intronic
1011669649 6:89670804-89670826 TCACATCCTGCTATTTGTGGTGG + Intronic
1011720005 6:90145762-90145784 TGATATCCTACTCTTTGTAGTGG - Intronic
1016014800 6:139172793-139172815 TCACTTCCTACTCTCAGAAGTGG + Intronic
1018351517 6:162964762-162964784 TCACTTCCTAATCTTAGCTCAGG - Intronic
1020092804 7:5350642-5350664 TCACTTGCTTCCCTTTCTTGGGG + Intronic
1022141188 7:27494354-27494376 TCACCCCCTACTCTTTGTCTTGG + Intergenic
1026354607 7:69546603-69546625 TCATTTCTTACTGTTTGATGTGG + Intergenic
1027377192 7:77563292-77563314 TTACTCCCTACTATTTGTTATGG + Intronic
1030280042 7:107764380-107764402 CGACTTCCTACTCTTTTTAGAGG + Intergenic
1030445070 7:109638846-109638868 TCATTCCTTACTCTTTGTTGTGG - Intergenic
1031375729 7:121023395-121023417 AAACTTCCTACTTTTTGTTCTGG - Intronic
1033605188 7:142921860-142921882 TCAGTTCCTAGACTTTGGTGAGG + Intronic
1034088503 7:148342226-148342248 TCATTTCTGACTCTTTATTGAGG - Intronic
1034466651 7:151233693-151233715 TTACTTCCTCCTCTTTTTAGTGG + Exonic
1035630730 8:1104838-1104860 CCACTTCCTGCTCTCTGGTGAGG - Intergenic
1036494154 8:9254088-9254110 TCACTTCCTAGTCTTCCTCGAGG - Intergenic
1041635936 8:60144335-60144357 TCACTTCTTACCCATTTTTGAGG - Intergenic
1043238351 8:77898904-77898926 TCACTTTCTTATCTTTTTTGCGG + Intergenic
1043423301 8:80122746-80122768 TCACGTCCAATTCTTTGTTCAGG + Intronic
1046481510 8:114825110-114825132 CCATTTCCTACTATTTGTTATGG - Intergenic
1048017352 8:130509321-130509343 TCACTTCCTACTGTTTTCTGAGG - Intergenic
1051067453 9:13121809-13121831 ACACTTCCTCCTCTTTGTATGGG + Exonic
1052763610 9:32618122-32618144 TCACATCCTACTCTTTCTTCAGG - Intergenic
1055204977 9:73718351-73718373 TCACTTTCTATGCTTTTTTGAGG + Intergenic
1056864887 9:90220428-90220450 TCACCTCCTGCTCTATGATGGGG + Intergenic
1057581816 9:96293882-96293904 TCACTTCCAGCTCATTGATGTGG + Intronic
1062059598 9:134487902-134487924 TCCCTGCCTACTCTTGGTAGAGG - Intergenic
1062077709 9:134600913-134600935 TCACTTCCTACTCTACCTGGTGG + Intergenic
1185754551 X:2643021-2643043 TTCCTTCCTCCTCTTTGCTGTGG - Intergenic
1187578137 X:20579602-20579624 TGACTTCCTACCCTGGGTTGGGG + Intergenic
1190561289 X:51687953-51687975 TCACTTCCAAATCTTTGGTGAGG + Intergenic
1190563002 X:51705364-51705386 TCACTTCCAAATCTTTGGTGAGG - Intergenic
1192537766 X:71942916-71942938 TGACTTCCTAGTCTTTGTCGAGG + Intergenic
1194350562 X:92821519-92821541 TCACTTCCTACACGGTGTGGGGG - Intergenic
1197586892 X:128359330-128359352 TCACTTCCTGCTCTCTGCTATGG - Intergenic
1198005815 X:132491352-132491374 ACACTGCCTACTTTTTGCTGTGG - Intergenic
1199502868 X:148528391-148528413 TCACTTCCTACTCTTGTTAAAGG + Intronic
1199807243 X:151312455-151312477 TCCCTTCCTCCTCATTGCTGAGG - Intergenic
1200658876 Y:5938159-5938181 TCACTTCCTACACGGTGTGGGGG - Intergenic
1201354370 Y:13082264-13082286 TCGCTTTCTAGTCTTGGTTGTGG - Intergenic