ID: 1118668776

View in Genome Browser
Species Human (GRCh38)
Location 14:68100178-68100200
Sequence CCTCAACTATAGAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118668776 Original CRISPR CCTCAACTATAGAAGGTAGA AGG Intronic
904848988 1:33442850-33442872 CATGAACTTTAGAAGGCAGAGGG - Intergenic
905582060 1:39089826-39089848 CCTTATCTATAAAAGGGAGATGG + Intronic
905900482 1:41578790-41578812 CCTAAGCTATAGAAGGGAGATGG + Intronic
906369949 1:45245045-45245067 GCTCATCTTTAGAAGGGAGAGGG - Intronic
909878490 1:80841956-80841978 TCCCAAGTATAGGAGGTAGAAGG + Intergenic
909878585 1:80843652-80843674 TCCCAAGTATAGAAGGCAGAAGG - Intergenic
912024223 1:105146768-105146790 TCTCAACGATAGGAGGAAGAGGG + Intergenic
913701886 1:121382199-121382221 GCTCAACTCTAGATGGGAGAAGG - Intronic
914042445 1:144062668-144062690 GCTCAACTCTAGATGGGAGAAGG - Intergenic
914135643 1:144897820-144897842 GCTCAACTCTAGATGGGAGAAGG + Intronic
915471549 1:156128732-156128754 CCTCATCTATAAAAGGGAGAGGG + Intronic
916096050 1:161351254-161351276 ACTAAAGTATAGAAGATAGATGG - Intronic
916738454 1:167628706-167628728 CCTCACCTATACAATGTAGTAGG - Intergenic
916796959 1:168176472-168176494 CCTAAACTTTAAAAGGGAGAAGG - Intergenic
917425907 1:174913564-174913586 TCTCTACTATAGAAGTTACAGGG - Intronic
917740534 1:177958131-177958153 GCTCTACTATGGAAGGAAGAAGG - Exonic
918098093 1:181350785-181350807 CCTTAACTATATAAGGTTGTAGG - Intergenic
919776014 1:201194397-201194419 CCTCAAGGATAGGAGGGAGATGG - Intronic
920489309 1:206400919-206400941 GCTCAACTCTAGATGGGAGAAGG - Intronic
924094378 1:240536139-240536161 CCTCAATTATGGCAGTTAGAAGG + Intronic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1063618085 10:7619869-7619891 CCTTAACTATATAAAATAGAAGG + Intronic
1063820652 10:9831393-9831415 ACTCAACTATAGAAAATAGGAGG + Intergenic
1070090045 10:73275718-73275740 CCTCAACTTCAAAAGGTAAAGGG + Intronic
1070247498 10:74745975-74745997 CCACAACTTTAAAAGGTAGCTGG - Intergenic
1074897050 10:117786291-117786313 TCTTAACTATAGGAGGCAGAAGG - Intergenic
1077467850 11:2742081-2742103 TCTCCACATTAGAAGGTAGAAGG + Intronic
1080751573 11:35155361-35155383 CCACAACTCTAGCAGGTAAATGG - Intronic
1080865203 11:36188200-36188222 CCTCAACTATTGAAGGCACCTGG - Intronic
1081495512 11:43606094-43606116 CCTAAAATATTCAAGGTAGAAGG + Intronic
1085767606 11:79296778-79296800 CCACAACTCTATAACGTAGAAGG - Intronic
1087069425 11:94062882-94062904 CCTGTGCTATACAAGGTAGAGGG - Intronic
1090030698 11:123203638-123203660 CCTCCACCATAGAAGCTAAAAGG + Intergenic
1091616733 12:2055194-2055216 CATCAGCTACAGAAGGGAGAGGG - Intronic
1093240904 12:16671956-16671978 CCTAAACTATTGTAGGCAGATGG + Intergenic
1093392383 12:18638138-18638160 CCTCAACTTTAGAAGCCAGCTGG + Intronic
1097315947 12:58171715-58171737 CTTCCATTATATAAGGTAGAAGG - Intergenic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1102912448 12:116727735-116727757 CCTCAACTATACAAACAAGAAGG + Intronic
1106473024 13:30074932-30074954 CCTCAACTATAAGTGATAGATGG - Intergenic
1110108509 13:71711383-71711405 CCTCAACTATTCAAGATAAATGG - Intronic
1111122626 13:83873650-83873672 CCTCAAATATAGATGATAAATGG - Intergenic
1111554540 13:89863060-89863082 CCTAAACTATAAAAGGCAGGGGG + Intergenic
1114240191 14:20859964-20859986 CCTCCACTATAGTAAGAAGAGGG + Intergenic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1115807217 14:37064481-37064503 CCACAACTGGAGTAGGTAGATGG - Intronic
1116295718 14:43105657-43105679 CTGCAACTATGGAAGGTAAAGGG - Intergenic
1116649780 14:47574934-47574956 CCTTAATGATAGAAGATAGAGGG - Intronic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118668776 14:68100178-68100200 CCTCAACTATAGAAGGTAGAAGG + Intronic
1121989754 14:98544635-98544657 CCTCATCTATAGAAGGGAGCTGG - Intergenic
1124238013 15:28006056-28006078 CCTCAACTATAAAATGGAGGTGG + Intronic
1124898679 15:33801666-33801688 CCTAAACTCTAAAAGGGAGAGGG + Intronic
1126535670 15:49760410-49760432 CTTCAAGTAGAAAAGGTAGATGG + Intergenic
1127324939 15:57885803-57885825 TCTCAGCAATAGAAGGCAGAAGG - Intergenic
1131545863 15:93314947-93314969 TCTCAATCATAGACGGTAGAGGG + Intergenic
1131657158 15:94473572-94473594 CCTCTACAATAGAAGGAATATGG - Intronic
1132402025 15:101516741-101516763 ATTGAACTATAGAAGGTAGTAGG - Intronic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1132474315 16:125797-125819 CCTCAGCTACAGAAAGGAGAGGG + Intronic
1137586854 16:49668884-49668906 CCTCAACTATAAAATGAAGATGG + Intronic
1138156691 16:54712262-54712284 CTTCATCTATAGAAGGAAGGAGG - Intergenic
1139870525 16:70104901-70104923 CCTAAATTATTGAAGGTAAAAGG + Intergenic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1143381430 17:6498620-6498642 CCTCAACTAGAGAAGGGATGGGG + Intronic
1143858412 17:9869892-9869914 CCTCCACTTTTGAAGGCAGAAGG + Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1153463836 18:5366808-5366830 CCTCAACAAAAGAAGAAAGAGGG + Intergenic
1154191460 18:12234293-12234315 CCTCGACTAAGGAAGGTAGGAGG - Intergenic
1157782884 18:50455943-50455965 CCTCAAGTATTGGAGGGAGATGG + Intergenic
1167423779 19:49418942-49418964 CCTCAACACTAGGAAGTAGATGG + Intergenic
926268819 2:11349317-11349339 CCTCTACTATAAAGGGTACAGGG + Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
928590859 2:32813605-32813627 CCTCTACTTTGGAAGGAAGAGGG - Intronic
930948851 2:57111922-57111944 CCTCTACTATAAAAAGTAAAAGG - Intergenic
932502330 2:72194289-72194311 CATCTAGTAGAGAAGGTAGAAGG + Intronic
934911602 2:98261730-98261752 CATCAACTATGGAAGCCAGAAGG - Intronic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
935929854 2:108112838-108112860 CCTCAAAGATTGAAGGTAGATGG - Intergenic
937399948 2:121573808-121573830 CCTCAACTTTAAAAGGGAGAAGG + Intronic
937507099 2:122549951-122549973 CCTGAACTATAGATAGTAGAGGG + Intergenic
940372128 2:152915200-152915222 CCTCATCTATAGAAGGGCAAAGG - Intergenic
941246175 2:163100172-163100194 TCTCAACTATAGAAGCCAGATGG + Intergenic
941489297 2:166124212-166124234 CCTGTACAATAGAAGATAGAAGG - Intronic
942550860 2:177117531-177117553 CTTCAACTTTAGAAGTTAGCAGG + Intergenic
944634893 2:201666179-201666201 CCAGAACTACAGAAGATAGATGG + Intronic
945488727 2:210429162-210429184 CCACAGCTTTAGAAGGAAGAGGG + Intergenic
947519441 2:230832777-230832799 CTGCAACTATAGAAGCCAGAAGG + Intergenic
1179077137 21:38133076-38133098 CCTCAATTATAGAAAGAAGAAGG + Intronic
1181488832 22:23248768-23248790 CCCAAACACTAGAAGGTAGAAGG - Intronic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1183689850 22:39382440-39382462 CCTCAACCATAAAATGGAGACGG - Exonic
950900405 3:16492435-16492457 CCTCATCTATAAAAGGAACACGG - Intronic
950971042 3:17188188-17188210 CATTAACTATACAAGTTAGAGGG - Intronic
953825190 3:46246050-46246072 CCTAGACTATAGAAGGAAGTAGG - Intronic
954002374 3:47567709-47567731 CCCCATCTATAAAAGGAAGAAGG + Intronic
958725540 3:97901223-97901245 GTACAACTATAGAAGGAAGAGGG + Intronic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
965768441 3:172155515-172155537 CCTCAAGTCTAGTAGGTAGGTGG + Intronic
970775107 4:19664318-19664340 TCTGAAAAATAGAAGGTAGATGG + Intergenic
974873176 4:67669253-67669275 AATCAACTAGAGAAGGTAAAAGG + Intronic
976518329 4:85997235-85997257 CCACAAGCATTGAAGGTAGATGG + Intronic
978756685 4:112310296-112310318 ACTCAACTAGAGATGGTAGAAGG + Intronic
986252979 5:6078029-6078051 GCTCAACTAGAGAAGATAGCAGG - Intergenic
987122657 5:14781685-14781707 CCTCAATTCAAGATGGTAGAAGG + Intronic
988294272 5:29334744-29334766 CCTGAACTAAAGGAGATAGAGGG + Intergenic
990152416 5:52834292-52834314 CCTCTGCTCTAGAAGCTAGAAGG + Intronic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
993184713 5:84602311-84602333 CCTCAACTAATGAAGTTGGACGG + Intergenic
994028174 5:95109143-95109165 CCTCAACTCTGGAAGGTCAATGG - Intronic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
1001927240 5:175647251-175647273 CTTCCACTATAGAAGTTGGAAGG + Intergenic
1003333824 6:5152154-5152176 CCTCATCTATAGAATGAAGTTGG - Intronic
1005707648 6:28471162-28471184 CCCCAACTCTAGAAGATAGTTGG - Intergenic
1008652758 6:53579881-53579903 ACTCTACCAAAGAAGGTAGATGG - Intronic
1010960161 6:82136737-82136759 CCTCAACTTTAGGTGTTAGATGG + Intergenic
1014057685 6:117035403-117035425 CCTCATCTATAAAAAGGAGATGG - Intergenic
1021142751 7:17047821-17047843 TCCCAACTATACAAGGAAGAAGG + Intergenic
1021741640 7:23692168-23692190 TCTAAACTATTAAAGGTAGATGG + Intronic
1022417771 7:30192550-30192572 CCTCATCTATAAAAAGAAGATGG + Intergenic
1023119968 7:36899313-36899335 CCTCAACTAGAGCAGGAATAAGG - Intronic
1023524873 7:41090587-41090609 CCTCTATTATAGAGGGTAGAAGG - Intergenic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1035271344 7:157721881-157721903 CCTCTACTCTAGAAGGAAGGAGG - Intronic
1037576934 8:20215025-20215047 CTTCAACTCGAAAAGGTAGATGG - Intronic
1038500547 8:28040035-28040057 CCTCTTCTGGAGAAGGTAGATGG - Intronic
1041975518 8:63794808-63794830 TCTCAACTAGAGAAGGGAGTAGG - Intergenic
1044197944 8:89401285-89401307 CCTCAGCCATAGAACGTAGGAGG + Intergenic
1051655550 9:19378360-19378382 CCTTAAATAAAGAAGGTAGGAGG - Exonic
1052165624 9:25323432-25323454 CATTCACTAAAGAAGGTAGATGG + Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1061300042 9:129698911-129698933 CCTAAACTCTAGGAAGTAGAGGG + Intronic
1189870177 X:45372711-45372733 AATCAACTAAACAAGGTAGAAGG + Intergenic
1195406986 X:104525267-104525289 CATCAGATTTAGAAGGTAGAAGG - Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1200735308 Y:6787763-6787785 CCTAAACTATGGACTGTAGAGGG - Intergenic