ID: 1118669205

View in Genome Browser
Species Human (GRCh38)
Location 14:68103635-68103657
Sequence GTGTTAGTACAAATTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118669202_1118669205 20 Left 1118669202 14:68103592-68103614 CCATTTCTCATTTCTTTTTCCTA 0: 1
1: 1
2: 22
3: 226
4: 2111
Right 1118669205 14:68103635-68103657 GTGTTAGTACAAATTGAGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 131
1118669201_1118669205 21 Left 1118669201 14:68103591-68103613 CCCATTTCTCATTTCTTTTTCCT 0: 1
1: 1
2: 31
3: 256
4: 2374
Right 1118669205 14:68103635-68103657 GTGTTAGTACAAATTGAGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 131
1118669203_1118669205 1 Left 1118669203 14:68103611-68103633 CCTAGTGTGCAAAGTTAATTTAA 0: 1
1: 0
2: 2
3: 32
4: 300
Right 1118669205 14:68103635-68103657 GTGTTAGTACAAATTGAGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118669205 Original CRISPR GTGTTAGTACAAATTGAGGA AGG Intronic
901300465 1:8196651-8196673 GTGTTAGACAAAATTGAAGAAGG + Intergenic
908946365 1:69502747-69502769 GTATTATTAAAAATTGAGAAAGG + Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
915255923 1:154628471-154628493 GTGTAAACACAAATTCAGGATGG - Intergenic
919415023 1:197297376-197297398 GTGTTAGGAAAAGATGAGGAAGG + Intronic
919451482 1:197776777-197776799 CTGTTAGTAAAAAATGAGGACGG + Intergenic
923998221 1:239520885-239520907 CTGTTAGTACAAACTTATGAAGG + Intronic
1066974331 10:42352350-42352372 GTTTTAGTACTAACTGAGGTTGG - Intergenic
1067357579 10:45544896-45544918 GGGGTAGTACAAAATGAGGTGGG - Intronic
1071115231 10:82210968-82210990 CTGTAAGTACAAAATGATGATGG - Intronic
1071393933 10:85202996-85203018 GTCTTAGTATATATTGTGGACGG - Intergenic
1074898346 10:117795993-117796015 GTGGTTGTACAAATTGGGCAAGG + Intergenic
1076583041 10:131526800-131526822 GTAATAGGACAAATTGAGGTGGG + Intergenic
1080655786 11:34257112-34257134 GTGTTAGTACAAATAGCAGGTGG + Intronic
1082303641 11:50543564-50543586 GTGTTTGTCCAATTTGTGGATGG - Intergenic
1082592048 11:55023691-55023713 GTTTTTGTACAATCTGAGGAAGG - Intergenic
1085948512 11:81301349-81301371 GTGTTACTATCAACTGAGGAGGG + Intergenic
1086386434 11:86313737-86313759 ATGTTTGTACAAAGTGTGGAGGG + Intronic
1086994113 11:93336912-93336934 GTGTTAGTAGGATTTGGGGAGGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092858810 12:12700753-12700775 GTGATAGTCCAAATTGAGAAGGG + Intergenic
1093163414 12:15776728-15776750 GTGTTAGTAAAAATGGCTGATGG + Intronic
1095781824 12:46068385-46068407 GTGTCAGGACAAAGTGAGCAGGG - Intergenic
1097753844 12:63387365-63387387 GTGTTAGCATGATTTGAGGATGG + Intergenic
1099130266 12:78820155-78820177 ATTTTAGTACAAATTGAAAAAGG - Intergenic
1100482071 12:94988771-94988793 GCGTTAGCACCAAATGAGGATGG - Intronic
1100733304 12:97498043-97498065 GTAATAATACAAATAGAGGAGGG + Intergenic
1106273319 13:28176100-28176122 ATGGTAGTACAAATGGAGAAAGG + Intronic
1108966597 13:56313483-56313505 GAGTGAACACAAATTGAGGATGG + Intergenic
1112082931 13:95995481-95995503 ATGTTAGTACAATTTTATGAGGG + Intronic
1112678887 13:101739406-101739428 GTATTATTACAAATTAAGAAAGG + Intronic
1114732110 14:25004100-25004122 GTGATCGTGCAAATTGAAGAGGG + Intronic
1117025188 14:51612194-51612216 TTGTTAATACAAAATAAGGATGG - Intronic
1117998884 14:61504593-61504615 GTGTTTTTACAAATTGAGAGGGG + Intronic
1118669205 14:68103635-68103657 GTGTTAGTACAAATTGAGGAAGG + Intronic
1129755053 15:78092971-78092993 ACTTTAGTACAAGTTGAGGATGG + Intronic
1130557683 15:84934294-84934316 GTGTGTGTACATGTTGAGGAGGG + Intronic
1131700066 15:94925561-94925583 GTGTTTGTACAACTTGAAGCTGG - Intergenic
1135644829 16:24152684-24152706 GTGTTAGTAAGCATTGAGGAAGG + Intronic
1140667955 16:77244913-77244935 GTTTTAGGGCAAATTGGGGAGGG - Intergenic
1145082466 17:19906286-19906308 CTATTATTACAAATTAAGGATGG + Intronic
1146051117 17:29554319-29554341 GAGTTAGTCCAAATTCAGGTGGG - Intergenic
1147864065 17:43541534-43541556 GGGTTAGTAAAAAAAGAGGAGGG + Intronic
1149382702 17:56109724-56109746 GTATTAATACAAATTGGGAAGGG + Intergenic
1153124554 18:1775424-1775446 GTGGTAGTAGAATTTAAGGATGG - Intergenic
1158442023 18:57484553-57484575 TTCTGATTACAAATTGAGGAAGG + Exonic
1159741338 18:72175000-72175022 GAGTTATTAAAATTTGAGGAGGG - Intergenic
1162643746 19:12033851-12033873 TTGATACTACAAATTGAAGAAGG + Intronic
925560033 2:5181732-5181754 ATGTTAAAACAAACTGAGGAGGG + Intergenic
926454497 2:13048460-13048482 GTGTTACCTCAAATTGAGTAAGG - Intergenic
927376386 2:22419847-22419869 GTGTCAGCACCAAATGAGGATGG + Intergenic
927531018 2:23801018-23801040 GTTTTTGTAGAAATTAAGGATGG - Intronic
932038674 2:68275313-68275335 GTCTTATTACAAAGTGAAGATGG + Intergenic
934106751 2:88702129-88702151 CTGGGAGTACAATTTGAGGAGGG + Intronic
935951205 2:108330559-108330581 TTGTTAGTACAAATAGAGCCAGG + Intergenic
937054249 2:118918253-118918275 TTGTAAGTTCAAAGTGAGGATGG - Intergenic
940446378 2:153783035-153783057 GAGTGAGTGAAAATTGAGGATGG + Intergenic
941103205 2:161321607-161321629 GTGTCAGTCCAAAGTGTGGATGG - Intronic
947040992 2:225919445-225919467 ATGTTAGTATCAAGTGAGGAAGG - Intergenic
947453766 2:230234139-230234161 GTGTCAGTAAAAATGGAGTAGGG + Intronic
1169357372 20:4918914-4918936 GTGTGTGCACACATTGAGGAGGG - Intronic
1170390060 20:15862846-15862868 GTTTTCTTTCAAATTGAGGATGG + Intronic
1173049215 20:39542915-39542937 GTGTGAGCAGAAATTGTGGAAGG - Intergenic
1174931847 20:54824767-54824789 GTGTTATTACAAAATGAGAGAGG + Intergenic
1175140123 20:56854794-56854816 GAGGAAGTGCAAATTGAGGAGGG - Intergenic
1184943759 22:47786742-47786764 GTGTTTTTAAAAATTCAGGAAGG + Intergenic
949389714 3:3545296-3545318 CTGTTAGTAAAAATCTAGGATGG - Intergenic
954653341 3:52178575-52178597 GTGTGAGAATAAATTGGGGAGGG + Intergenic
957657106 3:83094391-83094413 GTGTGGGTGCAAATTGAGTAAGG - Intergenic
958196525 3:90247959-90247981 GGAATAGTAAAAATTGAGGAGGG + Intergenic
958419715 3:93916596-93916618 GGAATAGTAAAAATTGAGGAGGG + Intronic
959370565 3:105520274-105520296 CTGTGAGTACAAATGTAGGAAGG + Intronic
960371083 3:116840757-116840779 GTTTTAGTAAAAGTTGAAGAAGG + Intronic
960906562 3:122607585-122607607 GTTGTAGTACTAATTGAGTAAGG - Intronic
961034657 3:123634214-123634236 GTGTTAGTAAAAGTTGAAGGTGG + Intronic
970965342 4:21921904-21921926 GTGTTAGGACACTATGAGGAGGG - Intronic
970966126 4:21930141-21930163 GCTTTAGTACATATTGAGGTTGG - Intronic
971940126 4:33203174-33203196 GATTTAATACAAATGGAGGAAGG - Intergenic
978815718 4:112902612-112902634 GTCTTAGTACAAATTCAGAAAGG - Intronic
979821721 4:125182088-125182110 GTGTTAGTACAATCTGAGGATGG - Intergenic
984671688 4:182496765-182496787 CTGTAAGGACAAATTGAGGCTGG + Intronic
986243244 5:5980443-5980465 TTGCTAGTACAAATAGAGGGAGG - Intergenic
986381689 5:7192913-7192935 GTTTTAGGAGAAAGTGAGGAGGG + Intergenic
986503191 5:8422858-8422880 GTGTTAGGAGAAATCCAGGATGG + Intergenic
987071039 5:14337389-14337411 GGGTGACTACAAATTGAGTAGGG + Intronic
987687354 5:21222010-21222032 GTGTTATTACAATTTGAAAAGGG - Intergenic
991405034 5:66293371-66293393 GTGATAGGAGAACTTGAGGAGGG + Intergenic
992046016 5:72890435-72890457 GTGTTAGTAGAAGAGGAGGATGG + Intronic
992490742 5:77241962-77241984 GTGTTGGGACAAGTTAAGGAAGG - Intronic
993548635 5:89245348-89245370 GGGTTAGCACATATTAAGGAAGG - Intergenic
993760143 5:91785090-91785112 TTGTTACTACATTTTGAGGAAGG + Intergenic
993880961 5:93360314-93360336 GGGTTAAAAAAAATTGAGGAGGG + Intergenic
994712927 5:103287399-103287421 TTGTTAGTACAAATTTTTGATGG - Intergenic
996072491 5:119149406-119149428 GTAATAGTACAAATTTAGAAAGG - Exonic
998638851 5:143986928-143986950 GTTATTGTACAGATTGAGGAAGG - Intergenic
1000965274 5:167648544-167648566 CTGTTAGGAGAAAATGAGGAAGG - Intronic
1003893884 6:10588634-10588656 GTGTTTGGAAAAAATGAGGAGGG + Intronic
1011453740 6:87524590-87524612 ATTACAGTACAAATTGAGGAGGG + Exonic
1011931673 6:92722734-92722756 GGGTTCTTACAAATGGAGGAGGG - Intergenic
1012723498 6:102779826-102779848 GTGTTATCCCAGATTGAGGAAGG + Intergenic
1012728769 6:102852404-102852426 GTGTGTGTACAAATGGAGTAAGG - Intergenic
1015428822 6:133105632-133105654 GGGTAAGTACAATTTGAGGTTGG + Intergenic
1018008263 6:159643433-159643455 GGGTTCGTCCAAATTGAGGGGGG - Intergenic
1021199112 7:17707629-17707651 GTGCTAGTACAAATTAAGAGAGG - Intergenic
1022578483 7:31523128-31523150 GTGTTAAGACAAATTTAGAAAGG - Intronic
1026079259 7:67202693-67202715 TTATTAGTAGAAATTGAGGCTGG - Intronic
1026447784 7:70500597-70500619 GTGGTAGAACAACTTGAGAAAGG - Intronic
1026697565 7:72609260-72609282 TTATTAGTAGAAATTGAGGCTGG + Intronic
1028496795 7:91470467-91470489 TTGTTAGTAGTAATTGAGGTTGG + Intergenic
1030544512 7:110875211-110875233 GTAATAGTATAAAATGAGGAAGG - Intronic
1030872141 7:114769090-114769112 TTTTTAGTATAAATTAAGGAAGG - Intergenic
1033632891 7:143178327-143178349 GTATTAGCACAAAGTAAGGAGGG + Intergenic
1034258406 7:149737244-149737266 GTGTTAATACAAAATAAGGCAGG - Intergenic
1035622777 8:1046623-1046645 GTGTTAGTACACGTTGAAAAGGG + Intergenic
1041627947 8:60052727-60052749 GTGATAGGACACATGGAGGAAGG - Intergenic
1043581095 8:81716219-81716241 GTGTTAGAACACATTGAACATGG + Intronic
1044025057 8:87158974-87158996 GTTTTTATACAATTTGAGGAAGG + Intronic
1045835275 8:106513303-106513325 GTGGTAATGCAATTTGAGGAGGG - Intronic
1046151605 8:110234037-110234059 GTGTTAGTACAATTAGAATATGG - Intergenic
1048889971 8:138938080-138938102 GTGCCAGTAGAAATTGTGGAGGG - Intergenic
1050988340 9:12112450-12112472 GAGTTAGTATAAATTGAGGTTGG + Intergenic
1053504874 9:38633643-38633665 GTGTAAATACAAATAGGGGATGG + Intergenic
1055436645 9:76298288-76298310 GTGATAGTAGAAAATGTGGAGGG - Intronic
1056897346 9:90563424-90563446 GTTTTAGTAGGAATGGAGGATGG - Intergenic
1059024858 9:110615552-110615574 GTATTAGTGCATATTCAGGAAGG + Intergenic
1059324247 9:113494083-113494105 GAATTAGTCCAAGTTGAGGATGG + Intronic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1189372853 X:40443713-40443735 AGGTTAGTGCAAATAGAGGAAGG + Intergenic
1189942087 X:46135042-46135064 GTATTATTAAAAATAGAGGATGG + Intergenic
1191150716 X:57219185-57219207 GCGTTAGCACCAAGTGAGGATGG - Intergenic
1192543476 X:71994322-71994344 GTGTGTGTAAAAGTTGAGGAAGG + Intergenic
1193403394 X:81072604-81072626 GTGATAAGACTAATTGAGGAAGG - Intergenic
1193731656 X:85109630-85109652 GTGTAAGTGAAAAATGAGGACGG - Intergenic
1194119636 X:89945099-89945121 TTGTTAGTGCCAATTAAGGAGGG + Intergenic
1195796488 X:108654044-108654066 GTGTATGTACTAAGTGAGGAAGG + Intronic
1197897400 X:131330073-131330095 GTGTTTGGACAAAATGAGTAGGG + Intronic
1198183194 X:134230027-134230049 GTGTATGCACAAATTAAGGAGGG - Intergenic
1200472505 Y:3602629-3602651 TTGTTAGTGCCAATTAAGGAGGG + Intergenic