ID: 1118670288

View in Genome Browser
Species Human (GRCh38)
Location 14:68118649-68118671
Sequence CTCAAAATACACCTGCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118670288_1118670290 12 Left 1118670288 14:68118649-68118671 CCATTGTGCAGGTGTATTTTGAG 0: 1
1: 0
2: 2
3: 16
4: 152
Right 1118670290 14:68118684-68118706 TTTTATAATGCTTTCACATTTGG 0: 1
1: 0
2: 4
3: 51
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118670288 Original CRISPR CTCAAAATACACCTGCACAA TGG (reversed) Intronic
902857610 1:19220423-19220445 CTCAAAATGCACCTTCTCAAAGG + Intronic
903092207 1:20931325-20931347 TTCAAAATACTACTGCACATTGG - Intronic
905977193 1:42184765-42184787 CTCAAAAAACACCTGCTCAGGGG - Intronic
906841340 1:49142849-49142871 CTCAAAATACCCTTGTACAATGG + Intronic
907081844 1:51630948-51630970 TTAAAAATACAACTGCCCAATGG + Intronic
908965444 1:69756658-69756680 CTCAAAATATACCTCAAAAAAGG - Intronic
909554929 1:76942927-76942949 CTCAAAATACCCCTTTAGAAGGG - Intronic
910867246 1:91799701-91799723 CTGAAAACACATCTGCAAAAAGG + Intronic
912203840 1:107488868-107488890 CTCAAAATCCATCTTCACACTGG + Intergenic
917140953 1:171835241-171835263 CTCAAAAGACACCTGCAGATAGG + Intergenic
917839103 1:178963202-178963224 CTCAAATTTCACCTTCTCAATGG - Intergenic
922093827 1:222423939-222423961 CTCCAAATACAACCGCACTAGGG + Intergenic
922853995 1:228758332-228758354 CACAAAATTCACCTGCCCAAAGG - Intergenic
923020729 1:230161354-230161376 CTTAATACACACCTGCACATTGG - Intronic
924921120 1:248629880-248629902 CTCAAAAGCCACCTGCTCAGAGG + Intergenic
1063330142 10:5150207-5150229 CTTTAAATACACTTGCAGAAAGG - Intergenic
1064033949 10:11900514-11900536 CTCAAATCACACCTGCAAAGAGG - Intergenic
1065920449 10:30388130-30388152 CTCCAAATACAGCCACACAAAGG + Intergenic
1067818406 10:49502502-49502524 CTCACAATCAACTTGCACAAAGG + Intronic
1073000930 10:100285830-100285852 CTCAAAATACACTTTCCCCAAGG + Intronic
1073911712 10:108352582-108352604 TAAAAAATACACCTGCAAAATGG + Intergenic
1074686905 10:115970112-115970134 CTCAAAAAACATCTGAATAATGG - Intergenic
1075806910 10:125195710-125195732 CTCAAAATCCACCTGCAGTGTGG - Intergenic
1077352308 11:2098675-2098697 CTGAAAATTCACCTTCACAGAGG + Intergenic
1077644162 11:3908882-3908904 CCTAAAATACACCTGGAAAAAGG + Intronic
1081478428 11:43460260-43460282 TTCAAAAAACACCTGTAGAAAGG - Intronic
1081760047 11:45570837-45570859 CTCAAAAGCCACCTGCAAAATGG + Intergenic
1084370792 11:68741378-68741400 CTCAAATGTCACCTTCACAACGG + Intronic
1085882630 11:80485754-80485776 CTCAAAATAAACCTTCACAATGG + Intergenic
1087186286 11:95200619-95200641 CTCAAAATTCTCCTTCATAATGG + Intronic
1087463203 11:98471318-98471340 CTCAAGGTAGACCTGCTCAAGGG + Intergenic
1088444644 11:109912421-109912443 ATAAAAATACACCTTCAGAATGG + Intergenic
1092040848 12:5382811-5382833 CTCAGAAGACACCTGCAAATAGG - Intergenic
1096979441 12:55719854-55719876 CCTAACAGACACCTGCACAAGGG - Intronic
1097053735 12:56238308-56238330 CCCAACACACACCTGCACACAGG + Exonic
1098217975 12:68239827-68239849 ATGAAAATACTCCTGAACAAGGG + Intergenic
1100628101 12:96357560-96357582 CTCAAAGTACAACTACAGAAAGG + Intronic
1103310847 12:120006605-120006627 CTCAAACTTCACCTCCCCAAAGG - Intronic
1103619555 12:122178463-122178485 CTCAAAATCAACATGCCCAAAGG + Intronic
1107034383 13:35885083-35885105 CTCACAGAACACCTGGACAAGGG - Intronic
1108432956 13:50372484-50372506 CTCAAATTAAAACTGCAGAAGGG - Intronic
1109636340 13:65122796-65122818 GTGAAAATACAACTGCAGAATGG - Intergenic
1112956692 13:105068082-105068104 GTCAAAATAAACCTGGAAAAAGG - Intergenic
1113074964 13:106459074-106459096 TCCAAACTACACCTGAACAAGGG + Intergenic
1114294841 14:21319794-21319816 AACAAAAGACACCTGCAGAATGG - Intronic
1115087131 14:29531195-29531217 CTCAAATTAAATCTGCAGAATGG - Intergenic
1118670288 14:68118649-68118671 CTCAAAATACACCTGCACAATGG - Intronic
1126905146 15:53356902-53356924 CTAAAATTATACCTGCAGAATGG - Intergenic
1129196385 15:73969700-73969722 CTGAACATACACGTGCACCATGG - Intergenic
1130538918 15:84807525-84807547 GTCAAAATAGACCTTCCCAAAGG + Intergenic
1132496904 16:268028-268050 CTCACAGTACACCTGCACACGGG + Intronic
1140801448 16:78491969-78491991 CTTAAAATGCACCTGGACCAGGG - Intronic
1140841325 16:78842078-78842100 TTCAAAACACACTTCCACAAAGG - Intronic
1141423011 16:83929175-83929197 CATAAATTACACCTGCACCATGG - Intronic
1142245718 16:88969267-88969289 CTCAAAACACACCTGGACTTGGG + Intronic
1145262326 17:21361758-21361780 CTAGAACTCCACCTGCACAAGGG + Intergenic
1148230259 17:45928472-45928494 CCCACAAGGCACCTGCACAAGGG + Intronic
1150263599 17:63817155-63817177 CTCAAAGTAGACCAGCACAAGGG - Intronic
1150535574 17:66035926-66035948 CTCCAAATACACATCCACACTGG + Intronic
1153637661 18:7127155-7127177 CTCCAACTCCACCTGCACCATGG - Intergenic
1153807885 18:8725469-8725491 CTCAATATACAACTATACAAAGG + Intronic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159524532 18:69570227-69570249 AACAAAATTCACCTGCAAAAAGG + Intronic
1160676226 19:392765-392787 CTCAGATTACACCAGCACATGGG - Intergenic
1161955144 19:7489671-7489693 CTCAAAATAATCCTACACCAAGG - Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
925665760 2:6253912-6253934 CTTGAAATACACCTGCCCCACGG - Intergenic
927096938 2:19754530-19754552 CTCAAAAATCACCTGACCAATGG + Intergenic
931107389 2:59071405-59071427 CTAGAAATACAACTGTACAAGGG + Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
939745179 2:145958685-145958707 CTCCAAATACAAATCCACAATGG - Intergenic
942052633 2:172154852-172154874 CTCAAAGTATCACTGCACAAAGG - Intergenic
942272930 2:174295607-174295629 TTCACAATACACCAGCAAAAGGG - Intergenic
945501566 2:210581972-210581994 CTCAAGATACAGCTGAAAAAAGG + Intronic
946709306 2:222490099-222490121 CTCAAAATTAACATCCACAAGGG - Intronic
947787729 2:232838823-232838845 CTCAAAATGCACCTGCCCTGGGG - Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170444080 20:16407085-16407107 TTCAGAAAACAACTGCACAAGGG + Intronic
1170788150 20:19485760-19485782 CCCAAAACACACCTGCTCCAAGG + Intronic
1171366353 20:24627413-24627435 CACAAAATTCACCAGCAGAAGGG - Intronic
1172560016 20:35879273-35879295 CTTACAATACAGCTGCATAATGG + Intronic
1173689217 20:44946646-44946668 CTCAGATGTCACCTGCACAAAGG + Intronic
1173922859 20:46759054-46759076 CTCAAAACACATCTGCTGAATGG - Intergenic
1174062009 20:47839509-47839531 CCCAAGATACAGCAGCACAAGGG - Intergenic
1174069498 20:47889722-47889744 CCCAAGATACAGCAGCACAAGGG + Intergenic
1176081589 20:63276080-63276102 CTCAAAACAAACCTGCAAAGGGG - Exonic
1178560515 21:33635307-33635329 CTTAAAATACATTTGCACATAGG + Intronic
1180027747 21:45177755-45177777 CTCAGACTACAACTGCACAGAGG - Intronic
949647980 3:6119935-6119957 CAAAAAATACATTTGCACAATGG - Intergenic
949831182 3:8216185-8216207 CTCAAAATGCACATGCACTGCGG - Intergenic
955437249 3:58915118-58915140 CTCAAAATATTCCTGCATCATGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
957552795 3:81729124-81729146 CTCAAAATGAACTTGCAAAATGG + Intronic
960250451 3:115445963-115445985 CATAAAATACATCTGCAAAAAGG - Intergenic
962936090 3:140082162-140082184 CTCAAAATTCTCCTGCTCTAGGG - Intronic
965875276 3:173310186-173310208 GACAAAATACTCCTGAACAATGG - Intergenic
966182392 3:177198394-177198416 CTAAATATATACCTGCACAGTGG + Intergenic
971387383 4:26153768-26153790 GTCAAAACACAGGTGCACAATGG - Intergenic
971872084 4:32254448-32254470 GGCAAAATTCACATGCACAATGG - Intergenic
972939052 4:44175012-44175034 CTAAAAAAGCACCTGTACAATGG - Exonic
973981083 4:56308820-56308842 CTCAGGATACCCCTGCACCAAGG - Intronic
975032243 4:69635356-69635378 CCCAAAAGACACATGCAAAATGG + Intronic
975865804 4:78722587-78722609 CTCAAAATGCACATGCTCAGAGG - Intergenic
976001545 4:80379864-80379886 CTAAAAATACACCTACAAGAGGG - Intronic
978784959 4:112599293-112599315 CCCAAAATTGACATGCACAATGG + Intronic
981320327 4:143384666-143384688 TGCAAAATACACCAGCAGAAGGG - Intronic
982250336 4:153399805-153399827 CTCATAATACTCATTCACAATGG - Intronic
983107431 4:163706059-163706081 CTGAATATACACCTTCACAGTGG + Intronic
984022376 4:174501498-174501520 CTATAAATAAACTTGCACAATGG - Intronic
984684721 4:182654135-182654157 CTCAATATACATCTGCAGAAGGG - Intronic
984838985 4:184050924-184050946 CTCAATAAACACCTGCCAAATGG - Intergenic
986096387 5:4558250-4558272 TTCAAAAAACACCTGCTCAGAGG - Intergenic
986618883 5:9649482-9649504 TTCAAAATACTCCTGAGCAATGG + Intronic
988324973 5:29753100-29753122 CTCAAAATATATCTGTACACTGG + Intergenic
988897978 5:35698827-35698849 CTCAAACTACAGCTGAACAAAGG + Intronic
989526945 5:42464584-42464606 CTCAGCACACACCTGCAGAATGG - Intronic
991267497 5:64739093-64739115 CTAAAAATAGACCCACACAAAGG - Intronic
996522757 5:124445589-124445611 CTCAAAATACAAGTGCTGAATGG - Intergenic
996999022 5:129736296-129736318 CCCAAAATACAGAAGCACAATGG + Intronic
998467727 5:142358855-142358877 CTCAAAATCCACCCGCACCAAGG - Intergenic
999784079 5:154875279-154875301 CTCAAAAAACAACTGCAGAATGG - Exonic
1000282874 5:159797390-159797412 CTCAAATTTCACCTGGAAAATGG + Intergenic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1002596597 5:180327816-180327838 CTCAAGCTTCACCTTCACAAAGG - Intronic
1006091092 6:31629493-31629515 CTCAAAGCACACATGGACAAAGG - Intronic
1009403503 6:63284249-63284271 CTCATTATACACCTTCTCAATGG - Intronic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1011072486 6:83400977-83400999 CTCAAAACTCACCTTCTCAATGG + Intronic
1011104707 6:83766782-83766804 GGCAAAATACAGCTGCAAAAAGG - Intergenic
1011862794 6:91781743-91781765 CACAAAAAACACATGCAGAAAGG - Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014795151 6:125716342-125716364 CTCAAAAGAAACCTAAACAATGG - Intergenic
1015594050 6:134849453-134849475 GTCTAAATAAACCTGCCCAAGGG + Intergenic
1018045996 6:159967325-159967347 CACAAAATACCTCTTCACAATGG - Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018095709 6:160385562-160385584 CTCAACACACACCTGCACCCAGG + Intronic
1018460929 6:163997501-163997523 CTCAAAATGCACCTGCCCTTTGG + Intergenic
1025232444 7:57211654-57211676 CCCAAGATACAGCAGCACAAGGG + Intergenic
1028545097 7:91989482-91989504 CTCCAAATAACCCTGCTCAAAGG - Intronic
1028918121 7:96282128-96282150 TTAAACATACACCTGCAAAATGG + Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1039340153 8:36639367-36639389 CTCAAAATACAAGTGTATAATGG + Intergenic
1040588287 8:48764920-48764942 CTCACAAGACACCTTGACAAGGG - Intergenic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1041240488 8:55845074-55845096 CTCTAAATATAACTGCCCAAGGG + Intergenic
1041533056 8:58893766-58893788 CTCAAGATACAACTGAACATTGG + Intronic
1043447152 8:80330318-80330340 CTCACAATAACCCTGCAAAATGG + Intergenic
1045405977 8:101867179-101867201 CTCAAAAGTCACCTTCTCAATGG + Intronic
1047422768 8:124720691-124720713 CTCTAAATACAGCTCCATAAGGG + Intronic
1048469495 8:134694951-134694973 CTCAAAAGACATCTCCACATTGG + Intronic
1050021476 9:1288806-1288828 ATTAAAATACATCTCCACAATGG + Intergenic
1050684863 9:8156968-8156990 CTAAAAATACACCTTGTCAATGG + Intergenic
1051762776 9:20486276-20486298 TTCAAAATACAACAGAACAAAGG + Intronic
1054755449 9:68952950-68952972 CTGAAAATAGACCTGCACCAAGG - Intronic
1055100144 9:72455851-72455873 GTCAACATACAACTCCACAAAGG - Intergenic
1055908182 9:81317541-81317563 CTCAAAATTCATCTTCACAGAGG + Intergenic
1056017902 9:82410559-82410581 CTCAAATGACACCTGCTTAATGG + Intergenic
1057550054 9:96045757-96045779 TGCAATATACACCAGCACAATGG + Intergenic
1057585286 9:96323392-96323414 CACAGCATACACCTCCACAAGGG + Intronic
1058937432 9:109781824-109781846 ATCAAAATACACATGCACAGGGG - Intronic
1059207926 9:112483985-112484007 CTTAAAAAACACATGCACAAAGG - Intronic
1061164040 9:128912221-128912243 CTCAAAAAACATCTGCACAAAGG - Intronic
1186746192 X:12572060-12572082 TTCAAAATACTCCTACCCAAAGG + Intronic
1188878351 X:35460740-35460762 CTCACAAAACACATTCACAAGGG - Intergenic
1193133217 X:77940735-77940757 CCCAAAATAAAAATGCACAATGG + Intronic
1193508166 X:82368698-82368720 TTCAAAATACACATTTACAAAGG - Intergenic
1194539987 X:95157747-95157769 CTACAAATAGACCAGCACAAAGG + Intergenic
1199522871 X:148756409-148756431 CTCATAATTCACCAGCAAAATGG - Intronic
1201426282 Y:13855393-13855415 CTCAAAACATAACTTCACAAGGG - Intergenic
1201499219 Y:14624021-14624043 CTCATCACACACATGCACAAAGG - Intronic