ID: 1118676114

View in Genome Browser
Species Human (GRCh38)
Location 14:68186187-68186209
Sequence CAATTTTTGCATATGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13915
Summary {0: 1, 1: 20, 2: 305, 3: 1423, 4: 12166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118676114 Original CRISPR CAATTTTTGCATATGGTGAA AGG (reversed) Intronic
Too many off-targets to display for this crispr