ID: 1118677262

View in Genome Browser
Species Human (GRCh38)
Location 14:68200618-68200640
Sequence CAATTTTACTTGAAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118677262 Original CRISPR CAATTTTACTTGAAGGAAGT TGG Intronic
901909143 1:12440573-12440595 CAATTTAAAGTGAAGGAAGGAGG + Intronic
909148568 1:71970296-71970318 AAATGTTACTTCAAGGAATTTGG + Intronic
909428452 1:75556179-75556201 TAATTTTGCTTGGAGGAAGAGGG - Intronic
910079923 1:83329459-83329481 CAAGTTTACAGGAAGGAAGCTGG - Intergenic
910478101 1:87629345-87629367 CATTTTTACTTGAAAGAACTAGG - Intergenic
911356597 1:96828558-96828580 AATTTTTACTTGAATGAATTTGG - Intergenic
911808532 1:102243331-102243353 CCATTATACTTGGAGAAAGTAGG + Intergenic
911930409 1:103895695-103895717 CCATTTTACTTGAAGCACATGGG - Intergenic
912145963 1:106794872-106794894 CAATTTGACTTGGAGTAAATTGG - Intergenic
912435911 1:109660969-109660991 CAACATTACTTAAAGGAAGTTGG + Intronic
912437855 1:109674551-109674573 CAACATTACTTAAAGGAAGTTGG + Intronic
912440365 1:109693010-109693032 CAACATTACTTAAAGGAAGTTGG + Intronic
912443664 1:109717145-109717167 TAACATTACTTAAAGGAAGTTGG + Intronic
914983799 1:152439657-152439679 GAATTTCCCTTGAAGGAACTCGG - Intergenic
915157520 1:153890644-153890666 CAATTTCACTTTAAATAAGTTGG - Intronic
916371315 1:164098332-164098354 CAATTATACTTTAATGAAGTTGG - Intergenic
917880970 1:179335515-179335537 CCATTTTTTATGAAGGAAGTTGG + Exonic
917888664 1:179414771-179414793 CAATTTTATTTTTAGGAATTTGG + Intronic
918140611 1:181716545-181716567 AAATTTCACATGATGGAAGTAGG - Intronic
918429561 1:184444664-184444686 CATTTTTATATAAAGGAAGTAGG - Intronic
918473088 1:184895048-184895070 AAATTTTACTTGAAAGTAGAGGG - Intronic
919526479 1:198659072-198659094 TAATTTTACTTGAAATAAGTTGG - Intronic
921915400 1:220604597-220604619 CAATTTTATTTTAACCAAGTAGG + Intronic
922684570 1:227629232-227629254 CAGTTTAACTTGAAGGGAATGGG + Intronic
923687987 1:236167113-236167135 CAATTATACTTCAATGAAGCCGG - Intronic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1065266926 10:23986064-23986086 CAACTTTACTTGAAGGCTTTGGG - Intronic
1065781136 10:29168912-29168934 CAATTCTACTAGTAGGAAGCAGG - Intergenic
1066528128 10:36304751-36304773 TAATTATTCTTAAAGGAAGTGGG - Intergenic
1068738640 10:60443590-60443612 CATTTTAACTTGAAGTAAATTGG - Intronic
1070980491 10:80641868-80641890 AAATTTTAATTGATAGAAGTTGG - Intronic
1070992331 10:80743310-80743332 CAGTATTAGTTGAAGAAAGTAGG + Intergenic
1073145591 10:101279126-101279148 CAATGTTACATGAAATAAGTTGG - Intergenic
1074166202 10:110877785-110877807 CTCTTTTACTTGGAGGAAGTAGG + Intronic
1075935756 10:126339810-126339832 AAATTTTATTTGAGTGAAGTGGG + Intronic
1079339135 11:19597756-19597778 CATTTTTAGCTGAAGGAGGTGGG + Intronic
1080407441 11:31992136-31992158 CAATTTTAAGTGAAAAAAGTAGG + Intronic
1081106415 11:39075483-39075505 CTATTTTATTTGAGGTAAGTTGG - Intergenic
1084139023 11:67211206-67211228 CAATTTTACCTCAATAAAGTTGG - Intronic
1087544317 11:99565154-99565176 CAACTTGTCTTAAAGGAAGTTGG + Intronic
1088018825 11:105094042-105094064 CTATCTTAGTTGAAGGAAGTAGG + Intronic
1089932034 11:122322541-122322563 GAAGTTGAGTTGAAGGAAGTGGG - Intergenic
1092110017 12:5953414-5953436 AAATTTTTCTTCAAGGAAGAGGG - Intronic
1095171124 12:39037629-39037651 GAATTTCCCTTGAAGGAATTCGG - Intergenic
1095459019 12:42421898-42421920 TAATTTTACTTTAAGGAAGATGG + Intronic
1096821308 12:54237276-54237298 CACTTTTACTTGCTGTAAGTGGG + Exonic
1097866500 12:64563517-64563539 GGATTTTACTTTAGGGAAGTAGG - Intergenic
1098815526 12:75156966-75156988 AAATATTTCTTGAAGTAAGTTGG - Intronic
1101282242 12:103270304-103270326 CATTTCTACTAGATGGAAGTAGG + Intronic
1102397484 12:112599543-112599565 CAATTTGATTTGTAGGAATTTGG + Intronic
1102586243 12:113924964-113924986 CAGTTTTAGAAGAAGGAAGTAGG + Intronic
1102806014 12:115781720-115781742 CAATTAAACATGGAGGAAGTAGG - Intergenic
1104310196 12:127647673-127647695 CCTTTTTTCTTGAAAGAAGTGGG - Intergenic
1105804204 13:23940536-23940558 CAAATTAACTTGTGGGAAGTCGG - Intergenic
1106293372 13:28387419-28387441 CTAAGTTACTTGATGGAAGTAGG + Intronic
1106931683 13:34672759-34672781 AAATTCTACTGGTAGGAAGTAGG + Intergenic
1107564508 13:41588083-41588105 CAATTTTACTTGTACGTATTGGG + Intronic
1110784009 13:79501833-79501855 AAACTTTCCATGAAGGAAGTTGG + Intronic
1111159363 13:84373440-84373462 ATATTTCACTTAAAGGAAGTAGG + Intergenic
1116765196 14:49062012-49062034 CAATTTTTCTTGATGAAAGATGG + Intergenic
1116982757 14:51188887-51188909 GAATTTTGCTTGATGGAAGATGG - Intergenic
1118470957 14:66074955-66074977 CCATTTTACTTGAAGGGATGGGG - Intergenic
1118497948 14:66327547-66327569 GAATTTCACATGAAAGAAGTAGG + Intergenic
1118677262 14:68200618-68200640 CAATTTTACTTGAAGGAAGTTGG + Intronic
1121149551 14:91619352-91619374 TAAAATTACTTGAAGGAAATAGG + Intronic
1121507537 14:94488058-94488080 CAATTTTACTTGCAGAAAACAGG + Intronic
1124445608 15:29729113-29729135 ACATTTCACCTGAAGGAAGTTGG - Intronic
1124720187 15:32104982-32105004 CAATTTTATTTAAAGGATGGTGG + Intronic
1124804648 15:32869362-32869384 CAATTTTACTTAAAGTAGTTAGG + Intronic
1125119104 15:36131887-36131909 TAATTCTACTTGAACAAAGTTGG - Intergenic
1126341311 15:47644344-47644366 CAATTTTACTTAAATGAATATGG - Intronic
1131594713 15:93785391-93785413 CAATTATACTTCAATGAAGCCGG + Intergenic
1133410123 16:5561255-5561277 CAATTTTTTTTAAAGAAAGTTGG - Intergenic
1135460040 16:22634367-22634389 CTATTTTCCTTTATGGAAGTTGG - Intergenic
1135860085 16:26048386-26048408 GAATGTTACTTAAAGGAATTGGG + Intronic
1136038180 16:27556952-27556974 CACTTTAACTTATAGGAAGTCGG + Intronic
1139112681 16:63910610-63910632 CAATTATACCTCAAGAAAGTTGG + Intergenic
1139154570 16:64424920-64424942 CAATTGTACCAGAAGGAAGAGGG - Intergenic
1140228196 16:73095808-73095830 CAATTTCATTTGAAAGAAGGCGG + Intergenic
1141455463 16:84138600-84138622 CAATTATACTTCGATGAAGTTGG + Intronic
1146152744 17:30489934-30489956 TATTTTCACTTGAAAGAAGTTGG + Intronic
1149336449 17:55640942-55640964 AAATTTTACTGGAAGGAGGTGGG + Intergenic
1154458386 18:14552073-14552095 CACTTTTACATAAAGGAAGTAGG - Intergenic
1155313540 18:24548466-24548488 GAAATTTACTTTAAGGAATTGGG + Intergenic
1156658821 18:39320983-39321005 CAATCTGAGTTGAAGTAAGTTGG - Intergenic
1158425277 18:57334445-57334467 CAATTTTACTTGAAGAGTGGGGG - Intergenic
1158823334 18:61186568-61186590 GAATTTTACTTTAATAAAGTAGG - Intergenic
1159139660 18:64378015-64378037 CAATTTTACTTCAATAAAGCTGG - Intergenic
1160179957 18:76625457-76625479 CAATTTTACTTGTAGGAGAACGG + Intergenic
1160277884 18:77455508-77455530 CAATTTTAATTGAGGAAAATAGG - Intergenic
1160376543 18:78418044-78418066 CTATGTTTCTTGAAGGAAGTTGG + Intergenic
1162274479 19:9641931-9641953 CAATTTTTTTTGTAGGCAGTGGG + Intronic
1165041364 19:33070147-33070169 GAATTTTACTTGGAGGAACTGGG - Intergenic
1166865965 19:45837692-45837714 AAATTTTACTTGAAGGAAGTTGG + Intronic
1167827702 19:51988789-51988811 CAATTTTATTTAGAGGAAGACGG - Intergenic
1168547148 19:57262752-57262774 GAGTTTCACTTGGAGGAAGTGGG + Intergenic
925442643 2:3901548-3901570 CACTTTTACTTGAAAGTACTCGG + Intergenic
926131663 2:10306808-10306830 CAATTTTACTTGAAACAACATGG - Intronic
926310141 2:11669341-11669363 CCATTTTACTAGAAGGAGGGAGG - Intronic
928444192 2:31318695-31318717 CAATTCTGCCTGAAGGAGGTGGG - Intergenic
928841050 2:35605144-35605166 GAATTTTTCTTGTAGGAAGAGGG - Intergenic
928992298 2:37246513-37246535 AAATTTTTCTTGAATGAAGGGGG - Intronic
929850442 2:45583813-45583835 GAATATTCCTTGAAGTAAGTGGG - Intronic
929986511 2:46738775-46738797 TCATTTCACTTGAAGGAACTAGG + Intronic
931200676 2:60094619-60094641 CATTTTTCCTTGAATGGAGTTGG - Intergenic
931403888 2:61957061-61957083 TAGTTTTAATTGAAGGAAGATGG + Intronic
931636083 2:64341739-64341761 GAACTTTACTGGAAGGCAGTTGG - Intergenic
931953489 2:67391751-67391773 CAATTTTTTTTCTAGGAAGTAGG + Intergenic
933302570 2:80559092-80559114 CAGATATCCTTGAAGGAAGTGGG + Intronic
938761171 2:134427489-134427511 CGATTTTATTTGAGGGGAGTAGG - Intronic
939735404 2:145838203-145838225 GAAATTTAATTGAAGGAAGAAGG - Intergenic
940048704 2:149437813-149437835 CAGTCTTACTTGAAGGATGGAGG - Exonic
942719346 2:178933002-178933024 TAATATTATTTGAAGGAACTTGG + Intronic
942859570 2:180593114-180593136 CAATTTTACTTGCAGGAGAAGGG - Intergenic
942873991 2:180769981-180770003 CAATTCTACTTGTAGGACGATGG - Intergenic
943933191 2:193881646-193881668 TAATTTAACTTGATAGAAGTTGG - Intergenic
944346470 2:198671970-198671992 AAATTTTACTTGAATAAAGAAGG + Intergenic
1170531584 20:17298234-17298256 CAATTTTAATTGATAGAGGTGGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1173904863 20:46619075-46619097 CAATTTGACTGCAAGGAATTTGG - Intronic
1176815764 21:13601263-13601285 CACTTTTACATAAAGGAAGTAGG + Intergenic
1176890253 21:14308031-14308053 CAATTATACCTCAAAGAAGTTGG + Intergenic
1178009035 21:28261030-28261052 CAATTTTATTTATAGGAAGCTGG + Intergenic
1179225562 21:39450081-39450103 AAATATTACTTGAAGAAAGTGGG - Intronic
1181984136 22:26787607-26787629 GAATTTCCCTTGAAGGAACTCGG + Intergenic
1182246123 22:28959147-28959169 CCATTTTTCTTGGAGGAAGAAGG + Intronic
949177328 3:1080933-1080955 CAATTTTATATTAAGGAATTGGG - Intergenic
950130626 3:10543491-10543513 ACAATTTACTTGAAGGTAGTTGG - Intronic
956102701 3:65785192-65785214 TAATTTTTATTTAAGGAAGTAGG + Intronic
956156202 3:66300301-66300323 CAATATTACTTGAAGTGAGCAGG + Intronic
956700518 3:71955006-71955028 CAATATAATTTGTAGGAAGTAGG - Intergenic
957251955 3:77783366-77783388 CACTTTTACACAAAGGAAGTAGG - Intergenic
959192063 3:103126468-103126490 CAATTTTACTTCAAAGATATTGG - Intergenic
959381787 3:105649753-105649775 CATCTTTACTTGAAGAAAGAAGG - Intergenic
959670518 3:108971972-108971994 CAAATTTCCTGGAAGAAAGTAGG + Intronic
960419882 3:117431379-117431401 CAATTCTACTTCTAGGAATTTGG + Intergenic
962146894 3:132849066-132849088 CAATTCTACTTGTAGGTAGCAGG - Intergenic
962226262 3:133612590-133612612 CATTTTTCCTAGAAAGAAGTTGG - Intronic
962959457 3:140297031-140297053 GAATTTCACCTGAAGGAAGCTGG - Intronic
964835367 3:160932188-160932210 CAATTTGACTTGACTGAAATAGG + Intronic
967856031 3:194118161-194118183 CACTTTTACTTGAAGGGCGGAGG + Intergenic
970713502 4:18892732-18892754 CTATTTTACTTAAAGGCAGCTGG + Intergenic
970860372 4:20695772-20695794 CAATTGTACTTCAATAAAGTTGG + Intergenic
974081045 4:57212910-57212932 CAATTATACTTTAATGAGGTAGG + Intergenic
974448218 4:62014294-62014316 CAATTTCACTTAAAAGCAGTAGG + Intronic
974620885 4:64352273-64352295 CAATTTCTCTTGAAGAAACTAGG + Intronic
975133733 4:70853549-70853571 AATTTTTACTTAGAGGAAGTTGG + Intergenic
976155270 4:82137511-82137533 CAATTATACTTTAATAAAGTAGG - Intergenic
977338908 4:95732246-95732268 CCATTTTAATTGCAGGAAGATGG - Intergenic
977448556 4:97163608-97163630 CTATTTTACTTGAAGGATCTAGG - Intergenic
978310929 4:107384179-107384201 CAGTATTAGTTGAAGAAAGTAGG + Intergenic
979350563 4:119639777-119639799 CAAATGAACTTGAAGGAATTAGG - Intergenic
981636414 4:146885906-146885928 CAATTTGATTTTTAGGAAGTTGG + Intronic
981922743 4:150103532-150103554 CAATTTAACTTTATGGAATTTGG - Intronic
983002757 4:162438817-162438839 AAATTTTGCATGAGGGAAGTAGG + Intergenic
983097364 4:163579901-163579923 CAATTTTACTTAAAGTACTTGGG - Intronic
983115548 4:163811669-163811691 CAATTTTATTAGAAAAAAGTAGG + Intronic
983574514 4:169246681-169246703 TAATTTGATTTGTAGGAAGTGGG - Intronic
983666001 4:170183993-170184015 CAATTTTACCTTAAAAAAGTTGG - Intergenic
984653835 4:182296402-182296424 CAATTGTACTTGAAGGCTATGGG + Intronic
987181201 5:15370213-15370235 CAATTATACTTCAATGAAGCTGG + Intergenic
987752641 5:22060933-22060955 CTATGTTACTTGAAGGCAATGGG + Intronic
988681207 5:33485834-33485856 GAGTTTTACTAGAAGGAAATCGG - Intergenic
989107001 5:37872496-37872518 CAAGTCTCCTTGAAGGAAGAGGG + Intergenic
990770747 5:59241694-59241716 AAATTTGACTTGAAATAAGTAGG + Intronic
993131986 5:83909768-83909790 CAATTTAAGGTGCAGGAAGTTGG + Intergenic
996718310 5:126605333-126605355 AAATTTTTCTTTAAGGAACTGGG + Intronic
997370875 5:133358847-133358869 GCATTTTACTTAAAAGAAGTGGG - Intronic
998201039 5:140121453-140121475 CAATTTTAAATGCAGGTAGTTGG + Exonic
1000480239 5:161764490-161764512 TAATGTTACATGAAGGTAGTAGG - Intergenic
1000655618 5:163874823-163874845 CAATTATAGGTGAAGGGAGTGGG + Intergenic
1003134421 6:3423309-3423331 TACTTTTTCTTGAAGGAAATAGG + Intronic
1004407882 6:15351516-15351538 CCATTTTACATGAGGAAAGTGGG - Intronic
1004859114 6:19782975-19782997 CAGTTTTCCTTCAATGAAGTTGG + Intergenic
1007261899 6:40569767-40569789 CAATTTGCCTTTAAGGAACTTGG - Intronic
1009334391 6:62468611-62468633 TTTTTTTACTGGAAGGAAGTAGG + Intergenic
1010516095 6:76773753-76773775 CAATATTATATGAAGGAAATTGG + Intergenic
1010552998 6:77245961-77245983 CAATATTACTTGATGGGAGAAGG - Intergenic
1010702060 6:79062518-79062540 AAATTTTACTTTAAAGAAGATGG + Intronic
1011124335 6:83990626-83990648 CATTTTTACTTGAATGAACAAGG + Intergenic
1011134187 6:84081908-84081930 CAATTTTAGTGGAAGGCAGAGGG - Intronic
1011957682 6:93043663-93043685 CAATTGGACTTGAAGGAAAATGG - Intergenic
1014468197 6:121782456-121782478 CATTTTAACTTGAAGAAAGGTGG - Intergenic
1014957147 6:127634673-127634695 CAATTTTGCTTTATGAAAGTTGG - Intergenic
1015992676 6:138963191-138963213 AAATGTTACAGGAAGGAAGTAGG - Intronic
1016234174 6:141842287-141842309 CAATTTTACTTGGACGAATGAGG - Intergenic
1017864588 6:158431962-158431984 CCATTTTATTTAAAGGCAGTGGG - Intronic
1018486150 6:164242976-164242998 TAATGTTACTGTAAGGAAGTAGG - Intergenic
1020285181 7:6673347-6673369 CTATTTTTCTTGAAGAAACTGGG - Intergenic
1020287150 7:6692542-6692564 CTATTTTTCTTGAAGGAACAGGG + Exonic
1020497218 7:8870977-8870999 AAAGTTAACTTGAAGGAAGCAGG - Intergenic
1023454150 7:40320435-40320457 CAATTATACTTAAAGACAGTAGG + Intronic
1024355163 7:48407046-48407068 CAATTATACTTTAATGAAGCTGG - Intronic
1025711659 7:63916700-63916722 AAAATTTATTTGGAGGAAGTGGG - Intergenic
1027297686 7:76794738-76794760 CAAGTTTACAGGAAGGAAGCTGG - Intergenic
1028396233 7:90371389-90371411 CATATTTTTTTGAAGGAAGTAGG - Intronic
1030926651 7:115464902-115464924 CATTTTTAATTTAAGTAAGTTGG + Intergenic
1030940659 7:115644533-115644555 CAATTTTGCATGAAGAAATTTGG + Intergenic
1031485991 7:122325209-122325231 CACAGTTACCTGAAGGAAGTAGG - Intronic
1034786051 7:153926574-153926596 GACTGTTACTTGAAGGAAGGGGG + Intronic
1036155650 8:6339724-6339746 CAACTTTTCTGGAAGGAACTTGG - Intergenic
1036480894 8:9138808-9138830 CAAGTATACTTGTAGGAAGTTGG - Exonic
1038887997 8:31687244-31687266 CAATTAGACTTGAACGAACTAGG + Intronic
1039199041 8:35066866-35066888 CTATTTTACTGGAAGGAAACAGG - Intergenic
1040621697 8:49099157-49099179 CAATATTAGTAGAAGAAAGTAGG + Intergenic
1040818405 8:51532961-51532983 CAATTCTAATTGAATCAAGTAGG + Intronic
1041812022 8:61922186-61922208 CAAATTTATATGAAGGAACTTGG - Intergenic
1041978442 8:63826747-63826769 AAATTTTACTTCAAGTCAGTTGG + Intergenic
1042274641 8:66991542-66991564 CAATTTTACTGGGGAGAAGTGGG + Intronic
1042402812 8:68369486-68369508 CAATTTTCCATGAAGGACATAGG + Intronic
1042516060 8:69660957-69660979 CAATTTTACTTGCAAGAAATGGG - Intergenic
1043731083 8:83682975-83682997 CAATTTGACTAGCAGGAAGATGG - Intergenic
1044359346 8:91263100-91263122 CAATTTTACAGAAAGGAAATTGG + Intronic
1044410664 8:91879082-91879104 TTATTTTTCTTGAAGTAAGTAGG + Intergenic
1047728933 8:127709849-127709871 CTATTTTGCTTGAAGCCAGTGGG - Intergenic
1048000896 8:130378818-130378840 CACATTTATTGGAAGGAAGTAGG - Intronic
1048321973 8:133407079-133407101 CCATTTTACGTGCAGGAAATGGG - Intergenic
1048347941 8:133592073-133592095 CAATTTAAAATGAAGGAAGGGGG + Intergenic
1049263062 8:141650055-141650077 CATTTTAACTGGCAGGAAGTTGG + Intergenic
1050480596 9:6083442-6083464 CAGTATTAGTTGAAGAAAGTAGG + Intergenic
1053080493 9:35172007-35172029 AAATTTTAAATGAAGGAAATAGG - Intronic
1053676493 9:40435397-40435419 CAATTGTTGTTGCAGGAAGTTGG + Intergenic
1055686104 9:78776603-78776625 CATTTTTACTTGAAATATGTTGG + Intergenic
1058234485 9:102472320-102472342 CAATTTTGCTTTGAGGAAATTGG + Intergenic
1059161266 9:112037429-112037451 CAATTTTACTTCCAGGAATGTGG + Intergenic
1059357628 9:113712074-113712096 CAAGTTTACTCCAAGGAAGAAGG + Intergenic
1060420200 9:123462969-123462991 CATTTTTACTTGCAGGACGCAGG - Intronic
1203531593 Un_GL000213v1:148198-148220 CACTTTTACATAAAGGAAGTAGG - Intergenic
1186121684 X:6370327-6370349 CTATTTTACTGGAAGGAAAAAGG - Intergenic
1187962035 X:24575760-24575782 CAATATTGCTTGAAATAAGTGGG + Intronic
1192034215 X:67545798-67545820 TAATTGTCCTTGGAGGAAGTGGG - Exonic
1194199636 X:90938827-90938849 CCATTTTAATTGAAAGAAATTGG + Intergenic
1194579762 X:95657732-95657754 TGATATTACTTGGAGGAAGTAGG + Intergenic
1196829226 X:119763254-119763276 CAATTTTACATGGAGGAGATAGG - Intergenic
1196970619 X:121104416-121104438 CAGTTCTACTTGAAGGAGGCAGG + Intergenic
1197948678 X:131870992-131871014 AAATTTTACATAAAGGAAATGGG - Intergenic
1198639479 X:138741114-138741136 TATTTTTGTTTGAAGGAAGTTGG - Intronic
1199551871 X:149069605-149069627 CAATTTTACCTGTGGGAACTGGG + Intergenic
1200545625 Y:4515244-4515266 CCATTTTAATTGAAAGAAATTGG + Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic
1201863044 Y:18620507-18620529 AAATTTAACTTAAAGGAAATTGG - Intergenic
1201870279 Y:18699871-18699893 AAATTTAACTTAAAGGAAATTGG + Intergenic