ID: 1118677810

View in Genome Browser
Species Human (GRCh38)
Location 14:68207314-68207336
Sequence CTGTGGGAATGAATTAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118677810_1118677814 9 Left 1118677810 14:68207314-68207336 CCAATTTTAATTCATTCCCACAG 0: 1
1: 0
2: 3
3: 38
4: 302
Right 1118677814 14:68207346-68207368 TTGCCCAATTCAGTTTTACATGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118677810 Original CRISPR CTGTGGGAATGAATTAAAAT TGG (reversed) Intronic
902126594 1:14218268-14218290 CTGTGGTACTGAATTTAAATTGG + Intergenic
905582469 1:39092717-39092739 GTGTATGAATGAAATAAAATTGG - Intronic
907632954 1:56102490-56102512 CTGTGGCAATTTCTTAAAATAGG + Intergenic
908013220 1:59804507-59804529 CTGTGGGAATGCCTTCACATTGG - Intergenic
908132427 1:61087397-61087419 CTATGGGAATGAAACAAAAAGGG - Intronic
908589515 1:65614682-65614704 ATGTGGCAATGAATTAGAGTTGG + Intronic
908873208 1:68638476-68638498 CTGAGGGCCTGAATTCAAATAGG - Intergenic
909475501 1:76076575-76076597 CTGTGGGAATGAAATAAGATAGG + Intronic
909567612 1:77071533-77071555 GTGTTGGAGTAAATTAAAATGGG - Intergenic
909621224 1:77669885-77669907 AGGTGGGAATGACTTAAAACAGG + Intronic
910007126 1:82411508-82411530 AAATGTGAATGAATTAAAATGGG - Intergenic
911247672 1:95536423-95536445 CTGTGCAACTGAATTAAAATTGG - Intergenic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
916180568 1:162079928-162079950 CTTTGGGAAGGAATAAAAAGGGG + Intronic
917145996 1:171892512-171892534 ATGTGGTGATGAATTAGAATTGG - Intronic
917988143 1:180343054-180343076 CTATTCTAATGAATTAAAATAGG + Intronic
920381783 1:205538892-205538914 GTGTGGGAATGAACTAATCTGGG + Intergenic
920903037 1:210131637-210131659 CTGTGGTGCTGAATTAAAATTGG - Intronic
921768368 1:219001394-219001416 CTGTGGTAATGGATTACAGTTGG - Intergenic
921847581 1:219900354-219900376 CTGTGTGATGGAACTAAAATGGG + Intronic
922011201 1:221589876-221589898 CTGTAGGCATGGATTAGAATAGG + Intergenic
922600026 1:226843861-226843883 CTGTGGGAAGGTTTTAAATTAGG + Intergenic
922940791 1:229463677-229463699 CTGTGGGAATGAGAAAAGATGGG + Intronic
1063844125 10:10106518-10106540 ATGTGGTAATGGATTAATATTGG + Intergenic
1064063435 10:12159328-12159350 CTGTGGGACTGAATTTTCATTGG + Intronic
1064614081 10:17134784-17134806 CTGTGGGAATTATTTAAAGGAGG - Intergenic
1064631258 10:17314476-17314498 CTTTGAGAAAGAATTAAGATTGG + Intergenic
1066633820 10:37481617-37481639 CTGAGGGACTGGATTATAATAGG - Intergenic
1067464105 10:46481987-46482009 CTGTGGAAATGACTTTAAATAGG - Intergenic
1067623090 10:47902664-47902686 CTGTGGAAATGACTTTAAATAGG + Intergenic
1069092367 10:64216438-64216460 CTATGAGAATGAATGTAAATTGG + Intergenic
1071175716 10:82924367-82924389 GCTTGGGAATGAATTATAATGGG - Intronic
1071280114 10:84094166-84094188 GTGTGAGAATGAACTAATATAGG - Intergenic
1072316997 10:94212871-94212893 ATGTGGGAATAATTCAAAATTGG + Intronic
1073167694 10:101472161-101472183 CTGTGGGGTTGAATTAGAATTGG - Intronic
1073383961 10:103106998-103107020 CTGTGGGAATGAAAGAATAAAGG - Intronic
1075775857 10:124987032-124987054 CTGTGGGAAAGAATTAAAGATGG + Exonic
1075847893 10:125560908-125560930 CTGTGGCAATTTCTTAAAATAGG - Intergenic
1076115606 10:127895506-127895528 CTGTTGGCAGGAATTTAAATTGG - Intergenic
1078382943 11:10860382-10860404 GTGTGAGAATGGATTAATATAGG + Intergenic
1079739095 11:24035514-24035536 GTGTGAAAATGAATTAATATGGG + Intergenic
1081594050 11:44446983-44447005 CTGTGGGACTGATTCACAATAGG + Intergenic
1082775719 11:57242976-57242998 CTGAGTGAATGAATTAGGATGGG - Intergenic
1083360633 11:62104960-62104982 GTGTGGGAATGAACTAATACAGG + Intergenic
1085144224 11:74178409-74178431 CCAAGGGAATGAATCAAAATTGG - Intronic
1085233064 11:74989315-74989337 CTGTGAGAACGAATAAAAATAGG - Intronic
1085235572 11:75012356-75012378 ATGTGGCAATGAGTTTAAATTGG + Intronic
1086413082 11:86561541-86561563 ATGTGGTAATGAATTCACATTGG - Intronic
1087398398 11:97632844-97632866 CTGTTTAGATGAATTAAAATAGG + Intergenic
1088382736 11:109214689-109214711 GTGTTGGAATGACTAAAAATGGG - Intergenic
1091167536 11:133492898-133492920 CTGTGGGAGTCATTTAAAACAGG + Intronic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1093487926 12:19672695-19672717 AAGTGGGAAGGAATTAAAGTTGG + Intronic
1096564051 12:52461304-52461326 ATGTGGTAATGAATTCAAGTTGG - Intergenic
1098076656 12:66738737-66738759 CTGTGAGAAGGAATGGAAATGGG + Intronic
1098115499 12:67172161-67172183 ATGTGGGAATGACTTAAAAATGG - Intergenic
1098711822 12:73772441-73772463 CTGTGGAAATGACTTTAAATGGG - Intergenic
1098876968 12:75875974-75875996 TGGTGGGAATGTAGTAAAATGGG + Intergenic
1099292743 12:80791775-80791797 CTGTGGAAATGACTTAAGATAGG - Intergenic
1099293092 12:80796500-80796522 CTATGGGAATATATTAAAGTTGG + Exonic
1099390469 12:82072972-82072994 ATGTGGGAATGGGTTAGAATTGG - Intergenic
1100016138 12:90013109-90013131 TTGTGAGAATTAAGTAAAATGGG + Intergenic
1101264557 12:103070062-103070084 CAGTGGCAAGGAAATAAAATTGG - Intergenic
1101325936 12:103716047-103716069 CTTTGGGAATGAGGTGAAATGGG + Intronic
1101513662 12:105414979-105415001 CTGTGGGAAGGAACAAAAAGAGG + Intergenic
1101552208 12:105773521-105773543 CTGTGGGAAAAAATAAAAACAGG + Intergenic
1102102682 12:110292808-110292830 CGGTAGCAAGGAATTAAAATGGG + Intronic
1104533924 12:129599965-129599987 CTGTGGCAATGTCTTAAAAAAGG + Intronic
1106638623 13:31559015-31559037 TTGTGGGAATGCAATAAAAATGG + Intergenic
1108223596 13:48264483-48264505 ATGTGGTTATGAATTAATATGGG + Exonic
1108396023 13:49992356-49992378 CTGTAAGAATAAAGTAAAATAGG - Intergenic
1108594933 13:51941408-51941430 ATGTGGGTATGAATTAAGATGGG + Intronic
1108669454 13:52669395-52669417 TTCAGTGAATGAATTAAAATTGG + Intronic
1108726049 13:53182748-53182770 CTGTGGGAAAGGATTAATAGAGG - Intergenic
1109383625 13:61598653-61598675 CTGTGGGGATGAAATCAAACAGG - Intergenic
1109616445 13:64839685-64839707 CTGTGGCAATTTCTTAAAATTGG + Intergenic
1110365969 13:74686063-74686085 ATGTGGTAATGCATTAGAATTGG + Intergenic
1111508715 13:89231366-89231388 CTGTGGAACTGAGGTAAAATTGG - Intergenic
1112242818 13:97698857-97698879 CTGTGGTAATGGATTAGAATTGG + Intergenic
1112649746 13:101382182-101382204 CTTTAGAAATGAATTAAACTCGG + Intronic
1114849088 14:26360855-26360877 CTGTGGGAATGAGGTAATGTGGG - Intergenic
1115389736 14:32841615-32841637 CTGTGAGAATGGACTAAAATTGG - Intergenic
1115902675 14:38170917-38170939 CTGTATGATTGAATTAAAATGGG + Intergenic
1116119261 14:40700855-40700877 CTTTGGGATTGAATTAGAATTGG + Intergenic
1116739688 14:48738580-48738602 CTATGGCCATAAATTAAAATGGG + Intergenic
1117595467 14:57322985-57323007 CTATGGTAATGAAGCAAAATTGG - Intergenic
1117679858 14:58192855-58192877 CAGTAGGAATGGAGTAAAATAGG + Intronic
1118014780 14:61648810-61648832 ATGTGGTAATGAATTAGAGTTGG + Intronic
1118400099 14:65371999-65372021 CTGTGATACTGAATTAGAATTGG - Intergenic
1118669377 14:68105905-68105927 CTATGGGAATGAAATAGAAGTGG + Intronic
1118677810 14:68207314-68207336 CTGTGGGAATGAATTAAAATTGG - Intronic
1118685581 14:68287235-68287257 TTGTGGGAAGGCATTAAAAATGG + Intronic
1119379533 14:74219675-74219697 ATCTGTGAATGAATTAAAAATGG + Intergenic
1119875676 14:78057137-78057159 GTGTGAGAATGAACTAATATAGG + Intergenic
1120510876 14:85412899-85412921 CTCTGAGAGTGAATTGAAATGGG - Intergenic
1125099436 15:35893797-35893819 CTGTGGCAATTTCTTAAAATAGG + Intergenic
1126240472 15:46436773-46436795 CTGTGGCAATTTCTTAAAATAGG - Intergenic
1126551374 15:49934091-49934113 CTGATGGAATCCATTAAAATGGG - Exonic
1126736080 15:51733426-51733448 CTGAGGGAAAGAAAAAAAATTGG + Intronic
1127574833 15:60281199-60281221 CTGTGGAATTGTAATAAAATGGG - Intergenic
1127741426 15:61910643-61910665 ATGTATTAATGAATTAAAATGGG - Intronic
1129306397 15:74667197-74667219 ATGTGGTAATGGATTAAAGTTGG + Intronic
1129575261 15:76736349-76736371 CTGTGGCAATTTCTTAAAATAGG + Intronic
1131315300 15:91330424-91330446 ATGTGGTGATGAATTAAAGTTGG - Intergenic
1131768595 15:95709090-95709112 ATGTAGGATTGAAATAAAATTGG + Intergenic
1137832048 16:51553243-51553265 CTGTGGGAATTAATGGAATTTGG + Intergenic
1137989747 16:53142011-53142033 CTTTGGGAAAGGAATAAAATAGG + Intronic
1138640852 16:58385536-58385558 CTGTGGGAAGAATCTAAAATTGG + Intronic
1139338724 16:66252589-66252611 CTGAGAGAATGAATTAGAAATGG - Intergenic
1141790147 16:86228773-86228795 ATGTGAGAATGAACTAATATGGG - Intergenic
1144240853 17:13310027-13310049 CCATGGGAATGGATAAAAATAGG + Intergenic
1146945023 17:36867680-36867702 ATGTGGGAGGGAATTAACATGGG - Intergenic
1148216166 17:45835023-45835045 ACATGGGAATGAATTGAAATGGG + Exonic
1148532719 17:48410257-48410279 ATGTGGTAATGAATTAGAATTGG + Intronic
1150514047 17:65788995-65789017 CTATCGGAATGGATTAAAAAGGG - Intronic
1150962656 17:69931622-69931644 CCCTGGGAATGAATCAAATTCGG - Intergenic
1152666937 17:81576283-81576305 CTGGGGGAAAGAATTACAGTTGG + Intronic
1153013723 18:564755-564777 CTGTGGGAAGGACTTCAAATTGG + Intergenic
1155102232 18:22622963-22622985 CTGTGGCAATTTCTTAAAATAGG - Intergenic
1156770384 18:40714116-40714138 ATCTGGGAGTGATTTAAAATGGG - Intergenic
1156893811 18:42220374-42220396 ATGTGGTAATGAATTAGAATTGG - Intergenic
1158132397 18:54167190-54167212 TTGTGGGAATGACTGAAAATGGG + Intronic
1158523732 18:58194084-58194106 CTGTGGGAAAGAATGAAGGTTGG + Intronic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159348175 18:67234665-67234687 ATTTTGGAATGAATTTAAATTGG - Intergenic
1159495819 18:69202926-69202948 CTATGTAAATGAATAAAAATTGG + Intergenic
1159495863 18:69203741-69203763 CTATGTAAATGAATAAAAATTGG - Intergenic
1160320442 18:77888033-77888055 CTGTGGCAATTTCTTAAAATAGG + Intergenic
1160753090 19:744059-744081 CTGTGGCAATCAATCAAACTAGG + Intronic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1163851535 19:19667083-19667105 GTATGGGAAAGAATTAATATTGG - Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1166125781 19:40714747-40714769 CTGTGGGAATCTATTAATAGTGG - Intronic
926537139 2:14127373-14127395 GTGTGAGAATGGATTAATATAGG - Intergenic
926849813 2:17183278-17183300 CTGTCGGTAGGAATGAAAATTGG + Intergenic
927531857 2:23812871-23812893 ATGTTTGAATGCATTAAAATTGG - Intronic
927620171 2:24647453-24647475 ATGAGGGAATTAATTAACATAGG + Intronic
928320161 2:30276883-30276905 CTTTGGGAATGACTACAAATAGG - Intronic
928736163 2:34291924-34291946 CGGTGGGTATGTTTTAAAATGGG + Intergenic
930361173 2:50381902-50381924 CAGTAGGAATGATTTAAGATGGG + Intronic
932443643 2:71756721-71756743 CTGTGGGAAAGAATTAGGACAGG + Intergenic
933326531 2:80844865-80844887 CAGTGTGAATGAATGATAATTGG - Intergenic
935141360 2:100355710-100355732 GTGTGGGAAGGGATTAAAATTGG + Intergenic
935312985 2:101803914-101803936 CTGTGGGTTTGATCTAAAATGGG + Intronic
935455561 2:103263819-103263841 CTGTGGGAATCGATGAAATTAGG + Intergenic
937323165 2:120972990-120973012 CTGTGGTAATGAATGAAGACTGG - Intronic
937637663 2:124174853-124174875 CTGTGGCAATTTCTTAAAATAGG - Intronic
937648170 2:124288891-124288913 TTGTGTGAATAAATGAAAATTGG + Intronic
937884166 2:126888874-126888896 TAGTGGGAATTATTTAAAATAGG - Intergenic
938131702 2:128721519-128721541 CTGTAGTATTAAATTAAAATTGG + Intergenic
938840546 2:135158047-135158069 CAGTGGCAATGAATTGGAATTGG + Intronic
939320363 2:140612269-140612291 CTGTGTGATTGAAGTAAAAGTGG - Intronic
939600755 2:144187366-144187388 CTGTGGAAATGAATTAGTTTTGG - Intronic
939601234 2:144193368-144193390 GTGTAGTAATGGATTAAAATAGG - Intronic
939900069 2:147841093-147841115 CTGTGGTAATGAATTTAAAGTGG + Intergenic
939939505 2:148332764-148332786 CTGGCTGAATGAATGAAAATAGG - Intronic
940859754 2:158759616-158759638 CTGTGGGAATGACATAGGATGGG - Intergenic
941727512 2:168879161-168879183 CTGTGGCAATTTATTATAATAGG + Intronic
943532936 2:189109785-189109807 CTGTGGCACTGAATTACATTAGG + Intronic
943743050 2:191431823-191431845 CTGTGGCTTTGAATTTAAATGGG + Intergenic
943878472 2:193105651-193105673 CTTTGGGGATGCATTCAAATTGG + Intergenic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
944978045 2:205080111-205080133 CTGTGGGACTGAAACAAAATAGG - Intronic
945003966 2:205383230-205383252 CTGTGGTATTGGATTAGAATTGG - Intronic
945631181 2:212278842-212278864 GTGTGGGAATGAATGTTAATTGG - Intronic
946655128 2:221938050-221938072 CTGAGGGAAAGAATTATATTTGG - Intergenic
947020608 2:225671076-225671098 CTGTGGCAATTTCTTAAAATAGG + Intergenic
947921460 2:233878604-233878626 ATGTGGTAATGGATTAGAATTGG - Intergenic
948331488 2:237170208-237170230 CTTTGGGATTCAAATAAAATTGG - Intergenic
1170317063 20:15054343-15054365 CTGTGGCAATTTCTTAAAATAGG - Intronic
1170482980 20:16786501-16786523 AAGGTGGAATGAATTAAAATGGG + Intergenic
1170604447 20:17865232-17865254 CTGGGGGAAGGAATTTAAAGAGG + Intergenic
1170971112 20:21117435-21117457 TTTTGGGAATGAATTTAAACTGG - Intergenic
1171181233 20:23092185-23092207 CAGTGGGATTAAATTAAAAGAGG + Intergenic
1171329974 20:24328951-24328973 CTGTGTGAATGATTTCCAATAGG - Intergenic
1172348777 20:34224561-34224583 CTGTGGGGATGAGTTAAAAAGGG + Intronic
1172718918 20:36984508-36984530 CTGTGGGGATGAATTACACCTGG + Intergenic
1172906767 20:38376229-38376251 CTGTGGGAAAGAACTGAACTTGG + Intronic
1173381968 20:42553535-42553557 CTGTGAGAATGAAGTAAACATGG - Intronic
1173540919 20:43850339-43850361 CTCTGGGAATGAGTTAAAATGGG - Intergenic
1174875918 20:54226317-54226339 TTATAGGACTGAATTAAAATGGG - Intronic
1174897518 20:54466698-54466720 CTGTGAGGATTAATTAACATTGG + Intergenic
1177290587 21:19106154-19106176 GTCTGGGAATGAATCACAATTGG - Intergenic
1177298371 21:19206489-19206511 CTGTGGCAATTTATTAAAATAGG + Intergenic
1178583839 21:33857043-33857065 CTGTGGGAATGACTCAATGTTGG - Intronic
1178720618 21:35006058-35006080 CTTAGAGAATGACTTAAAATTGG - Intronic
1179827147 21:43972507-43972529 CTGTCCCAATGAAATAAAATGGG + Intronic
1181658870 22:24325655-24325677 CTGTGGCCATGAATGAAAAAAGG + Intronic
1182350076 22:29694436-29694458 ATGTGAGAATCTATTAAAATAGG + Intronic
950416127 3:12869834-12869856 CAGTGGAAATGAAAAAAAATAGG - Intronic
951328143 3:21330652-21330674 ATGTGGTAATGAATTAGCATTGG + Intergenic
951388318 3:22070103-22070125 TTGTGGGAAATTATTAAAATAGG - Intronic
952014757 3:28943101-28943123 CTTTAGGAATGAAAAAAAATTGG + Intergenic
954311775 3:49774620-49774642 CTGTGGAAATGACTTTTAATGGG + Intronic
955170735 3:56562377-56562399 CTGTGGTAATGAAGTAAACTTGG + Intronic
957126152 3:76163885-76163907 CTGTGGCAATTTCTTAAAATAGG + Intronic
959413732 3:106058807-106058829 TTGTTGAATTGAATTAAAATAGG + Intergenic
959440585 3:106369830-106369852 CAGATGAAATGAATTAAAATAGG - Intergenic
961497090 3:127301594-127301616 ATGTGGCAATGGATTAGAATTGG - Intergenic
961857601 3:129888238-129888260 ATGTGGTAATGAATTAGAGTTGG + Intronic
962514552 3:136138219-136138241 CTGTTGAAATAAATTAAAATTGG - Intronic
962875112 3:139530031-139530053 CAGTGGGAATGAAGAAAAACAGG + Intronic
964184732 3:153929160-153929182 CTATGGGCAAGAAATAAAATTGG - Intergenic
966653424 3:182326529-182326551 CTGTTCTAATGAATTTAAATGGG - Intergenic
966928950 3:184663420-184663442 GTATGGGAATGAATTCATATGGG - Intronic
967610132 3:191495497-191495519 ATGTGGTAATGGATTAGAATTGG - Intergenic
968420517 4:480099-480121 ATGTGGGGCTGAATTAAAATAGG + Intronic
970110355 4:12630855-12630877 CAATGGGAATGAAGTAGAATTGG - Intergenic
970433938 4:16014990-16015012 CTGCAGGAATGTATTAAAAAGGG + Intronic
972050820 4:34730996-34731018 TTGAGGTAATGAATTAAAGTAGG - Intergenic
973612168 4:52646093-52646115 CTGTGAGAATGGACTAATATAGG + Intronic
973657964 4:53070230-53070252 CTTTTGAAATGAATTAAATTAGG + Intronic
974022199 4:56701705-56701727 TTGTGGGAAAGATTTAAATTGGG - Intergenic
974327442 4:60432809-60432831 CTGTTGGAAGGAGTTTAAATTGG - Intergenic
974567494 4:63596259-63596281 ATGTAGTAATGAATTAAAATTGG + Intergenic
975282371 4:72575859-72575881 CTGTGTTTATGAAATAAAATTGG - Intergenic
976575538 4:86666457-86666479 CTGTGGTATAGACTTAAAATGGG + Intronic
976718978 4:88152233-88152255 TTATGGGAAAGAAGTAAAATTGG - Intronic
977372288 4:96154098-96154120 TTGTGGTGATGAATTAAAATTGG + Intergenic
979076775 4:116280910-116280932 GTGTGGGAATGTAGTAAAGTAGG + Intergenic
980262584 4:130471444-130471466 CAGTGGGAATGAAAAAAATTTGG + Intergenic
980264492 4:130497591-130497613 CTGTGGTTTTGAATTAATATAGG + Intergenic
981459247 4:144992907-144992929 CTGTGGCAATTTCTTAAAATAGG - Intronic
982522309 4:156433589-156433611 CTGTGGGAATGGATTAGAATTGG + Intergenic
983139264 4:164128099-164128121 ATTTGGAAATCAATTAAAATTGG + Intronic
984054952 4:174916582-174916604 CTGTGGCCATGAGTTACAATTGG + Intronic
985106003 4:186500855-186500877 CTGTGGGAATGAAGCACAACAGG + Intronic
986093539 5:4534739-4534761 ATGTGAGAATGGATTAATATAGG - Intergenic
986515261 5:8555340-8555362 ATGTGGCAATGAATTAGAGTTGG + Intergenic
986550480 5:8948653-8948675 CTTTTGGAATAAAATAAAATTGG + Intergenic
987519464 5:18961066-18961088 CTCTGGGAATTAATTATAATTGG - Intergenic
988180149 5:27780892-27780914 CTGTCGAAATAAATAAAAATTGG - Intergenic
988812442 5:34798821-34798843 CAGTGGGAACCAATTGAAATTGG + Intronic
989154352 5:38329997-38330019 CTGTAGGAAAGTATTTAAATCGG - Intronic
989394922 5:40944257-40944279 CTGTGGGAATGAAACAAATCAGG - Intronic
990056928 5:51593457-51593479 CTGGGGGAATTAATTATTATAGG - Intergenic
991204357 5:64033364-64033386 CAGTGGGAATAAATAAACATAGG - Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
994397671 5:99239153-99239175 CTGTGGGACTGGCTTTAAATAGG + Intergenic
994751903 5:103748395-103748417 CTGTAGGAATAAAGGAAAATTGG - Intergenic
995273146 5:110246132-110246154 CTGTTGGAAGGAATGTAAATTGG + Intergenic
995419244 5:111944618-111944640 CTGTGGGAAACAAATAAAATTGG - Intronic
995795357 5:115935826-115935848 ATGTGGTAATGGATTAGAATTGG + Intergenic
995887131 5:116908118-116908140 CTGTGGCAATTCACTAAAATAGG - Intergenic
999676501 5:154008927-154008949 CTGTAGGGATGGATTAAAATTGG + Intronic
999835019 5:155360359-155360381 CTGTGGCAATTTCTTAAAATAGG + Intergenic
1000532438 5:162440097-162440119 CTGTGGCAATTTCTTAAAATAGG - Intergenic
1000735174 5:164890392-164890414 ATAAAGGAATGAATTAAAATAGG + Intergenic
1000740091 5:164957922-164957944 ATGTGGCAATAAATTAGAATTGG + Intergenic
1001717785 5:173831066-173831088 GTTTGGGAATGAATGAAAAATGG - Intergenic
1002564956 5:180106594-180106616 CAGTGGGATTAAATTATAATCGG - Intronic
1002575917 5:180173603-180173625 TTGGGGGAATGAGTTAAAACTGG + Intronic
1003518253 6:6835638-6835660 CTGTAGGAATGAATCAACTTTGG - Intergenic
1003767385 6:9254559-9254581 TCATGGGAATAAATTAAAATGGG - Intergenic
1005259623 6:24044092-24044114 TTGAGGGAAAGAAATAAAATTGG - Intergenic
1005707694 6:28471689-28471711 AGGTGGTAATGGATTAAAATTGG - Intergenic
1005761930 6:28975439-28975461 CTGTGGGAATGGACTACAAAAGG + Intergenic
1006713967 6:36101875-36101897 CTGTTGGACTGTATTAAAACAGG + Intronic
1008837868 6:55859257-55859279 CTGTGTAAATGCATTAAAAAAGG + Intronic
1009038804 6:58152292-58152314 CTGTTGGAAGGAATGTAAATTGG - Intergenic
1009214696 6:60907144-60907166 CTGTTGGAAGGAATGTAAATTGG - Intergenic
1010131589 6:72500449-72500471 CTGTGGTACTGCATTGAAATTGG + Intergenic
1011023454 6:82839941-82839963 CTATGGTAATGAATTAGAGTTGG + Intergenic
1011290124 6:85768266-85768288 GTGTGGGAATAAATGACAATGGG + Intergenic
1012340246 6:98112416-98112438 CTGGTAGGATGAATTAAAATAGG + Intergenic
1015299598 6:131637841-131637863 CTCTAGGAGTGAAGTAAAATAGG - Intronic
1016224616 6:141720392-141720414 CTCTGGGATTGAATTTACATGGG + Intergenic
1017772289 6:157652656-157652678 TTGATGGAATGAATAAAAATGGG - Intronic
1018601398 6:165546773-165546795 ATGTGGTAATGAATTAAAGTTGG + Intronic
1018880936 6:167879522-167879544 CTGAGGGAAGAAATTAAGATAGG - Intronic
1019869832 7:3749917-3749939 CTGTGTGAATCAATATAAATTGG + Intronic
1020528601 7:9298264-9298286 CATTAGGAATGAATAAAAATAGG + Intergenic
1020626491 7:10587521-10587543 CTGTGGGAATGAATTATTGTGGG + Intergenic
1021232684 7:18104720-18104742 CTGAGGGAGTGAATTAAATAGGG - Intronic
1021674069 7:23062835-23062857 CTCTGGGAATGAATCATAATTGG + Intergenic
1021834259 7:24652462-24652484 CTGGGGAAATGAATTCAAGTAGG + Intronic
1022562216 7:31361388-31361410 CTGCATGAATGAATTAAAAAAGG - Intergenic
1022937658 7:35196408-35196430 CTGTGGGAGTGCATTGGAATTGG + Intergenic
1025996092 7:66528382-66528404 CAGTGGCACTGAATTAAATTAGG + Intergenic
1026393220 7:69924362-69924384 CTGTGTTCATGAATAAAAATTGG + Intronic
1028331033 7:89592320-89592342 ATGTGGGGATGCATTAGAATAGG + Intergenic
1028372470 7:90109188-90109210 CTGTGGGAGTGCATTGGAATTGG - Intergenic
1029160996 7:98551787-98551809 CTGTGGGCATGAATGAATAATGG + Intergenic
1030425413 7:109370755-109370777 TTGTGAGAATGGATTAGAATTGG + Intergenic
1030822238 7:114108562-114108584 GTTTGGGAATGTATTAAAATGGG + Intronic
1031492463 7:122405805-122405827 CTTTGGAAATGAAATGAAATTGG + Intronic
1031622895 7:123956941-123956963 CTATGGAAATACATTAAAATTGG - Intronic
1033680560 7:143590780-143590802 CTGTGGTTTTGAAGTAAAATTGG - Intergenic
1033704334 7:143871032-143871054 CTGTGGTTTTGAAGTAAAATTGG + Intronic
1033726792 7:144127344-144127366 CTGTGGGAGGGAATTGCAATTGG + Intergenic
1033731974 7:144188908-144188930 CTGTGGACATCAGTTAAAATAGG + Intronic
1033742823 7:144287491-144287513 CTGTGGACATCAGTTAAAATAGG + Intergenic
1033751079 7:144362123-144362145 CTGTGGACATCAGTTAAAATAGG - Intronic
1034605693 7:152311432-152311454 ATTTGGGCATGAATGAAAATAGG - Intronic
1036401914 8:8416403-8416425 TTGTGGGAATTAAATACAATAGG - Intergenic
1037102925 8:15069587-15069609 CTGTCAGAGTGAATTAAAAGTGG - Intronic
1038382398 8:27108502-27108524 CTCTGAGAATGAATTGAATTGGG - Intergenic
1039652806 8:39360829-39360851 CTGTGGCAATATCTTAAAATAGG - Intergenic
1041137133 8:54772083-54772105 TTGTGGGAATTAATTAAACATGG - Intergenic
1041273059 8:56127775-56127797 TTGTTGGACTGAATAAAAATAGG + Intergenic
1041399893 8:57431106-57431128 CTGTGGCATTGAATTGGAATTGG - Intergenic
1041656327 8:60354182-60354204 CTGTGTGAATGAAGTACCATTGG + Intergenic
1042154219 8:65824573-65824595 CTGTGGCAATTTCTTAAAATAGG - Intronic
1042506213 8:69563666-69563688 TTTTGGCAATGAATTGAAATAGG + Intronic
1043127559 8:76418809-76418831 CAGAGGTCATGAATTAAAATAGG + Intergenic
1045473070 8:102529505-102529527 CTCTGGGACTGAAATAAAACGGG - Exonic
1045654731 8:104375257-104375279 ATGAGGGAATGAATTAACCTTGG - Intronic
1046023675 8:108697089-108697111 CTGTGGAACTGGATTAGAATGGG + Intronic
1047767156 8:127999435-127999457 ATGTGGTAATGAATTAGAGTTGG - Intergenic
1048116119 8:131525028-131525050 CTTTGAGAATGAATGAAACTGGG + Intergenic
1049039810 8:140104049-140104071 CTGAGTGAATGAATAAACATAGG - Intronic
1050187484 9:2990095-2990117 CTGCGGGAGGGAATAAAAATTGG + Intergenic
1050967528 9:11825562-11825584 CTGTGGCAATTTCTTAAAATAGG - Intergenic
1051589951 9:18767637-18767659 CTGTGGCATTGAATTGAAGTTGG - Intronic
1051892089 9:21952843-21952865 CTGTGGTAATGGATTACAGTTGG + Intronic
1052777496 9:32747263-32747285 CTGTGGGAATTAAGTAAGAATGG + Intergenic
1053465363 9:38303397-38303419 CTGTGGCAATTTCTTAAAATTGG + Intergenic
1053549175 9:39057380-39057402 AAGTGGGACTGAATTAAAAAGGG + Intergenic
1055213451 9:73828884-73828906 CTGTGGGAGAGAATGTAAATTGG - Intergenic
1055593732 9:77844555-77844577 CTGTAGGAAGAAATTAAAAATGG + Intronic
1055878049 9:80966723-80966745 GTGTGGGCATGAAGTCAAATGGG - Intergenic
1057018800 9:91679764-91679786 CTGTGTGGGTGGATTAAAATTGG - Intronic
1187371201 X:18707846-18707868 CTGTGGTTATGAATGAAAAGGGG + Intronic
1188094777 X:26007910-26007932 ATCTGGTAATGAATTAAAGTGGG + Intergenic
1188140678 X:26546826-26546848 CTGTGAGAATGAACTAATACAGG + Intergenic
1189679159 X:43497115-43497137 CTTTGGCCATGAATTCAAATGGG + Intergenic
1189931785 X:46019680-46019702 ATGTGGTAATGAATTAGAGTTGG - Intergenic
1190114454 X:47617507-47617529 TTGGGGGTATGAATTAAAGTTGG + Intronic
1191086631 X:56574851-56574873 CTTTGGCAATGGATTAGAATTGG - Intergenic
1192051273 X:67726016-67726038 CAGAGTGAATCAATTAAAATGGG - Exonic
1192961595 X:76137251-76137273 CTGTGGGAAGGAATAGAAAAAGG - Intergenic
1193470419 X:81895265-81895287 CTGTGGCAATTTCTTAAAATAGG + Intergenic
1193740660 X:85213711-85213733 CTGTGTGATTGAATAAAAACAGG + Intergenic
1194178719 X:90687414-90687436 GTGTGAGAATGAAGTAAAACAGG - Intergenic
1194325381 X:92509014-92509036 CTATGAGAGTGAATAAAAATAGG - Intronic
1194494343 X:94593108-94593130 CTGTGGTACTGAATTTGAATTGG - Intergenic
1198374164 X:136021246-136021268 ATGTGGTAATGAATTAAAGTTGG - Intronic
1198438399 X:136638827-136638849 CTGTGGGCAAAAATTAACATGGG + Intergenic
1198621099 X:138510924-138510946 CTGTTGGTAGGAATGAAAATTGG + Intergenic
1200023524 X:153233291-153233313 TTGTGGGAATTATTTAGAATAGG - Intergenic
1200219425 X:154383887-154383909 CTTTTGGAATGAATGAAAAGGGG - Intergenic
1200525386 Y:4269585-4269607 GTGTGAGAATGAAGTAAAACAGG - Intergenic
1200634110 Y:5628178-5628200 CTATGAGAGTGAATAAAAATAGG - Intronic
1201327812 Y:12783791-12783813 TTGTGGAACTGAACTAAAATTGG - Intronic