ID: 1118678183

View in Genome Browser
Species Human (GRCh38)
Location 14:68211333-68211355
Sequence GTTTCAATGGGGAAAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118678183_1118678191 19 Left 1118678183 14:68211333-68211355 CCACCCGCTTTCCCCATTGAAAC 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118678183 Original CRISPR GTTTCAATGGGGAAAGCGGG TGG (reversed) Intronic
900364497 1:2305565-2305587 ATTTTAATGGGGAGAGTGGGGGG + Intronic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
902895718 1:19478683-19478705 GGTTAAATGGAGGAAGCGGGTGG - Intronic
903257339 1:22111705-22111727 GCTTCAACTGGGAAAGAGGGAGG - Intergenic
904914584 1:33960651-33960673 GTTTCCATGGGAAATGCGTGCGG - Intronic
906411952 1:45585524-45585546 GAATCAATGGGGAAAGAGGCAGG - Intronic
909326977 1:74363604-74363626 GCTTCATTGGGGAAAGCATGAGG + Intronic
911237335 1:95425521-95425543 GTTTGAATGGGGAAATTGGCTGG + Intergenic
916476916 1:165178311-165178333 GTGTCAAGGGGGAAACCAGGTGG - Intergenic
917250038 1:173048949-173048971 GTTTCTATGGGAAAAGCCAGTGG - Intronic
918197991 1:182240629-182240651 GTTTCCATGAGGAAAGCTGAAGG - Intergenic
919183207 1:194112015-194112037 GGTTCAAAGGAGCAAGCGGGCGG - Intergenic
920129535 1:203721190-203721212 CTTTCAATGGGGAATCCTGGCGG - Exonic
921595259 1:217047669-217047691 GTTCCAATGGGGGAAGCAGATGG + Intronic
924088787 1:240481646-240481668 GTTTCATCGGGGGAAGAGGGAGG + Intergenic
924467824 1:244314095-244314117 GGATCAATGGGGAAAGCCTGGGG + Intergenic
1064741529 10:18439595-18439617 ATTTCAAAGGTGATAGCGGGAGG - Intronic
1066441280 10:35441461-35441483 TTTTCAATGGAAAAAGCGGTAGG + Intronic
1070313293 10:75289002-75289024 GTTACCATGGGGAAGGCTGGAGG + Intergenic
1070556602 10:77532661-77532683 GTTTCCATGGGGGAAGAGGGTGG + Intronic
1071300770 10:84254307-84254329 GTTTCTACAGGGAGAGCGGGTGG - Exonic
1073822123 10:107275672-107275694 GTTTCATTGGAGAAAGAGGATGG - Intergenic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1078641758 11:13103448-13103470 ACTTCACTGGGGAAAGGGGGTGG - Intergenic
1080977888 11:37364294-37364316 GTCTCCATGGGGAAAGCTTGCGG + Intergenic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1082688086 11:56264392-56264414 ATTTCACTGGGGATAGTGGGTGG - Intergenic
1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG + Intronic
1087170352 11:95043423-95043445 GTTTCTAGGAGGAAATCGGGAGG + Intergenic
1089043899 11:115481917-115481939 GTGTCAATGAGGGGAGCGGGAGG - Intronic
1093062352 12:14620403-14620425 GCTTCAATGGGCAAGGTGGGCGG - Intronic
1094307557 12:29037703-29037725 ATGAGAATGGGGAAAGCGGGAGG - Intergenic
1102232902 12:111275827-111275849 GGTTCAAAGGGGAGAGCTGGTGG - Intronic
1103152831 12:118656209-118656231 GTTTCAGTGGGGAGATGGGGAGG + Intergenic
1111567820 13:90039691-90039713 GTGTCAATTGGGAAAGAGGTAGG + Intergenic
1111993282 13:95137968-95137990 TTTTCTTTGGGGAAAGTGGGCGG + Intronic
1112241013 13:97680948-97680970 GTTGCCATGGGGTTAGCGGGAGG - Intergenic
1113264161 13:108598625-108598647 GTTTCAATGGTGAAATAGGCAGG + Intronic
1113400631 13:109989428-109989450 ATTTGAATGGGCAAAGCCGGTGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119543803 14:75457536-75457558 GTTTCAATGGGGAAGGTATGAGG + Intronic
1123922243 15:25078537-25078559 ATTTCAATGGGGAGAGCTGCAGG - Intergenic
1125731643 15:41895536-41895558 GTCTCCCTGGGGTAAGCGGGTGG - Intergenic
1126427322 15:48542673-48542695 GGTTCCATGGGGAAAACTGGGGG - Intronic
1128661459 15:69504186-69504208 GTTTCAGTGTGGAATGGGGGTGG + Intergenic
1133041957 16:3065596-3065618 GGTTTTATGGGGAAAGTGGGGGG - Exonic
1141380188 16:83569260-83569282 GTTCCAATGGGGAGAGGGAGGGG - Intronic
1147914863 17:43880139-43880161 GTGCCAATGGGGAGAGTGGGGGG - Intronic
1152061301 17:78077668-78077690 GTTGCCATGAGGAAAGAGGGTGG - Intronic
1154406176 18:14093295-14093317 GTTTTAAAGGAGAAAGCGGCAGG - Intronic
1156427973 18:37036689-37036711 GTTTTCATGTGGAAAGAGGGTGG - Intronic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1161943217 19:7418778-7418800 GATTCAAGGGGGAGAGAGGGAGG + Intronic
1163083114 19:14957682-14957704 ATTCTAATGGGGAAAGCAGGAGG + Intronic
1163578897 19:18126460-18126482 CTTTCAATGGGGACAGTGGCAGG - Intronic
1163748672 19:19062845-19062867 GTTTCATTTGGAAAAGAGGGGGG - Intergenic
1165310094 19:35024517-35024539 GTGTCGAGGGGGAAAGCGGATGG + Intronic
925362336 2:3288274-3288296 GTTTCAATGAGGTATGAGGGTGG - Intronic
926657486 2:15424666-15424688 TTTTAAATCGGGAAAACGGGGGG - Intronic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
927749700 2:25656593-25656615 GTTGAAATGGGAAAAGAGGGTGG - Intronic
928102944 2:28449991-28450013 GTTTCACTGGGGTCAGTGGGTGG - Intergenic
932077844 2:68681725-68681747 ATTTCAATGGGAAAAGTGGATGG + Intronic
932112093 2:69011121-69011143 GCTTGAATGTGGAAAGCGGGTGG - Intergenic
933449934 2:82435780-82435802 CTTACAATGGAGAAACCGGGAGG - Intergenic
933506846 2:83187482-83187504 GTTTCAAAGGGCAAAACTGGGGG - Intergenic
944258591 2:197651373-197651395 ATTTCAATGGCCAGAGCGGGTGG + Intronic
947722757 2:232379613-232379635 GTTGCACTGGTTAAAGCGGGCGG - Exonic
947727096 2:232407694-232407716 GTTGCACTGGTTAAAGCGGGCGG - Exonic
947736258 2:232456999-232457021 GTTGCACTGGTTAAAGCGGGCGG - Exonic
948211479 2:236196433-236196455 GTCTCAGTGGGGAAAGGGTGGGG + Intronic
1170813906 20:19696924-19696946 GTGGCAATGGGGAAGGAGGGAGG + Intronic
1172162685 20:32879404-32879426 GGTTCAGTGGGCACAGCGGGTGG - Intronic
1174021545 20:47534100-47534122 GTTTCAGTGGGGGGGGCGGGGGG + Intronic
1176070616 20:63224467-63224489 GTATTAATGGGGAGGGCGGGAGG - Intergenic
1176851607 21:13921772-13921794 TTTTCACTGAGGAAAGCTGGCGG + Intergenic
1177779787 21:25609703-25609725 TTTTCAATGGAGAAATCTGGTGG + Intergenic
1179568088 21:42261541-42261563 GTTTCAGTGGAGAGAGGGGGTGG - Intronic
1179596675 21:42447345-42447367 GTTACAAAGGCGAAAGCCGGAGG - Exonic
949125025 3:436811-436833 GCTTTAATGGGGAAAGACGGAGG + Intergenic
952467876 3:33610351-33610373 GTTTCAGTGGGAAAAGAAGGTGG - Intronic
954816631 3:53287161-53287183 GTTTCTATGGGGTAGGCTGGGGG + Exonic
955351506 3:58196759-58196781 CCTTCAATGGGGACAGAGGGGGG - Intronic
955723762 3:61910742-61910764 GGTTCTGTGGGGAAAGCAGGTGG - Intronic
958015385 3:87934347-87934369 GTTGGAATGGGGACAGAGGGTGG - Intergenic
959426744 3:106199006-106199028 GTTTCAATTGGGAAACAGAGGGG + Intergenic
961643404 3:128379291-128379313 GCTTCAATGGCCAAAGCGGGAGG - Intronic
963904946 3:150765622-150765644 GTGTCAATGGGGCAAGGGTGAGG - Intergenic
970258457 4:14196445-14196467 GTTTCAATGAAGAAAGCTGGGGG - Intergenic
971150452 4:24025837-24025859 AATTCAATGGGGAAAGGAGGAGG + Intergenic
973530953 4:51836381-51836403 TTTTCAATGGGGTAAGCTAGTGG + Intergenic
978819065 4:112944580-112944602 GTCCCAATGGGGAAGGGGGGTGG - Intronic
979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG + Intronic
980278688 4:130689331-130689353 GGTTCACTGGGGTAAGCAGGAGG - Intergenic
980843149 4:138291191-138291213 CTTTCAATGGGAGAAGGGGGAGG - Intergenic
987050337 5:14143327-14143349 ATTTCAATGGGGAAGGAAGGAGG - Intergenic
993352529 5:86867867-86867889 GTTTTCATGGGGAAAGCAGAAGG - Intergenic
993784668 5:92114994-92115016 CTTTCAAGGGGGAAAGTGTGAGG - Intergenic
997906826 5:137825642-137825664 ATTTCATTAGGGAAAGCTGGAGG + Intergenic
999040841 5:148410098-148410120 TTTTCAATGGAGGAAGTGGGAGG + Intronic
1001521865 5:172400134-172400156 GTTTCAAAGGAGAAAGGGAGAGG - Intronic
1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG + Intergenic
1003454277 6:6266732-6266754 GTTACAAAGTGGAAAGTGGGGGG - Exonic
1004727508 6:18325468-18325490 GTTTCAGTGAGGAATGGGGGAGG + Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1006426746 6:33968124-33968146 GCTGCAATGGGGAATGCAGGAGG - Intergenic
1009265100 6:61544544-61544566 GTTTAACTGGGGAAAGTGGTAGG + Intergenic
1011743923 6:90390763-90390785 GTTTAAATGGAGAAAATGGGTGG - Intergenic
1014665551 6:124232628-124232650 GATTCAATCAGGAAAGTGGGGGG - Intronic
1016135644 6:140538690-140538712 TTTTCAATGGGGAAAAAGGCAGG - Intergenic
1022177861 7:27889281-27889303 GGTTCAATGGGGAAATATGGGGG + Intronic
1022575744 7:31495323-31495345 GTTTAAAAGGGGAAAGCAGCTGG + Intergenic
1023315206 7:38929210-38929232 TTGTCAATGGGGACAGGGGGAGG - Intronic
1027682285 7:81235890-81235912 GTTCCAATGGGGAAAGTGGAAGG - Intergenic
1028608620 7:92683064-92683086 GTTTCTATGGTGAAAGCAGAGGG - Intronic
1029974037 7:104815890-104815912 TCTTCAAAGGGGAAAGGGGGAGG - Intronic
1029995499 7:105004059-105004081 GTTTCATTAGGGAAAGGGTGGGG - Intergenic
1030969334 7:116034941-116034963 GTTTCAGTGGGGGAAGATGGGGG - Intronic
1031832672 7:126646481-126646503 GTTTCAATGCTGAGAGAGGGAGG - Intronic
1033003384 7:137532713-137532735 GGCTGAATTGGGAAAGCGGGAGG - Intronic
1033539773 7:142345681-142345703 GTTTCCATGGGGACTGCGGGGGG - Intergenic
1042511592 8:69617982-69618004 GATTCCATGGGGAAGGCAGGAGG - Intronic
1045709548 8:104966998-104967020 GTGTGAGTGGGGAAAGTGGGAGG - Intronic
1046029204 8:108763189-108763211 GTTACAATGGGGAAAAGGGTTGG - Intronic
1047434689 8:124826376-124826398 GTTTCAATGGGGAGAGTGCCTGG - Intergenic
1060983661 9:127807790-127807812 GTTTCAATGGGGAAATAGTCTGG - Intronic
1061510057 9:131055050-131055072 GTTGTAATGGGGAAAACTGGAGG - Intronic
1188224484 X:27580294-27580316 GTTTCAATGGGGAAAAAGACAGG + Intergenic
1191671767 X:63754895-63754917 CTTTCAAAGGGAAAGGCGGGGGG + Exonic
1194371199 X:93074308-93074330 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1200678998 Y:6186196-6186218 GTTTCATTGCTGAAAGTGGGGGG - Intergenic