ID: 1118678191

View in Genome Browser
Species Human (GRCh38)
Location 14:68211375-68211397
Sequence AAGAATGAAAAGAACATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 609}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118678188_1118678191 7 Left 1118678188 14:68211345-68211367 CCCATTGAAACCAATGTTTGGAG 0: 1
1: 0
2: 1
3: 11
4: 122
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678189_1118678191 6 Left 1118678189 14:68211346-68211368 CCATTGAAACCAATGTTTGGAGA 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678187_1118678191 8 Left 1118678187 14:68211344-68211366 CCCCATTGAAACCAATGTTTGGA 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678179_1118678191 27 Left 1118678179 14:68211325-68211347 CCCTCCCTCCACCCGCTTTCCCC 0: 1
1: 0
2: 6
3: 124
4: 1374
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678180_1118678191 26 Left 1118678180 14:68211326-68211348 CCTCCCTCCACCCGCTTTCCCCA 0: 1
1: 0
2: 8
3: 91
4: 812
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678184_1118678191 16 Left 1118678184 14:68211336-68211358 CCCGCTTTCCCCATTGAAACCAA 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678183_1118678191 19 Left 1118678183 14:68211333-68211355 CCACCCGCTTTCCCCATTGAAAC 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678190_1118678191 -3 Left 1118678190 14:68211355-68211377 CCAATGTTTGGAGAAGATAGAAG 0: 1
1: 0
2: 3
3: 10
4: 194
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678185_1118678191 15 Left 1118678185 14:68211337-68211359 CCGCTTTCCCCATTGAAACCAAT 0: 1
1: 0
2: 3
3: 16
4: 241
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678181_1118678191 23 Left 1118678181 14:68211329-68211351 CCCTCCACCCGCTTTCCCCATTG 0: 1
1: 0
2: 1
3: 23
4: 270
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609
1118678182_1118678191 22 Left 1118678182 14:68211330-68211352 CCTCCACCCGCTTTCCCCATTGA 0: 1
1: 0
2: 1
3: 27
4: 271
Right 1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG 0: 1
1: 0
2: 2
3: 58
4: 609

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118678191 Original CRISPR AAGAATGAAAAGAACATCTC AGG Intronic
900569243 1:3350328-3350350 AAAAATGAAAAGAAAAGATCTGG + Intronic
901706544 1:11077760-11077782 AAGAGAGGAAAGAAAATCTCTGG - Intronic
901898248 1:12333858-12333880 AACACTGAAATGTACATCTCTGG + Intronic
901944812 1:12693143-12693165 AAGACTGGAAAGGGCATCTCCGG - Intergenic
903216057 1:21843934-21843956 AAAATAGAAAAGGACATCTCTGG - Intronic
903393451 1:22981446-22981468 AAAAAAGAAAAGAAAATCACTGG + Intergenic
903775630 1:25791675-25791697 AAGAATGAAAAGAAGGCCCCAGG - Intergenic
903807511 1:26016099-26016121 AAGAAAGAAAAGAAAAACCCGGG + Intergenic
904432640 1:30474783-30474805 AAGAGTGCAAAGATCAACTCCGG - Intergenic
904977208 1:34465858-34465880 AAAAAAGAAAAGAAAATATCAGG + Intergenic
905551769 1:38847125-38847147 AAAAAGGAAAAGAAAATGTCAGG + Intronic
906659105 1:47569928-47569950 AAGAATGATATGAAGATATCTGG - Intergenic
907608849 1:55847385-55847407 TAGAATGAAAAGCACATTTGAGG + Intergenic
908041037 1:60113549-60113571 AAGACTGACAAGTGCATCTCAGG + Intergenic
909039485 1:70631742-70631764 AGGAATTAAAAGGACACCTCAGG - Intergenic
909381355 1:75002522-75002544 AAGTAGGACATGAACATCTCTGG + Intergenic
909836208 1:80258742-80258764 AAGATTGAGAAAAACATCCCTGG + Intergenic
910242763 1:85105556-85105578 AAGAAAGAAAAGAAAATATGAGG + Intronic
910465460 1:87494413-87494435 AAGAAATAAAAGAAAATCACTGG + Intergenic
910703148 1:90098234-90098256 AAAAAAGAAAAGAAAATCACTGG + Intergenic
910890205 1:92010581-92010603 AAAAATTAAAAGAACAGCCCAGG - Intronic
911247758 1:95537575-95537597 AGGAACGGAAAGAACATCTATGG + Intergenic
911282661 1:95950823-95950845 AAGAAAGCAAAGAAGATCTGAGG - Intergenic
912378008 1:109228302-109228324 AATAAATAAAAGAAAATCTCTGG - Intronic
913194180 1:116441447-116441469 AAGAAAGAAAAGAAAATCGAGGG - Intergenic
913528735 1:119717497-119717519 AAGCATTAAAAGAAAATGTCAGG - Intronic
914337399 1:146727857-146727879 AAGAAATAAAAGTCCATCTCAGG - Intergenic
914360270 1:146929508-146929530 AAGAAATAAAAGAAAATCACTGG + Intergenic
914493478 1:148170389-148170411 AAGAAATAAAAGAAAATCACTGG - Intergenic
915007467 1:152652825-152652847 AAGCATGGAAAGAACATAGCTGG - Intergenic
915231688 1:154450422-154450444 AAGTAATAAAAGAACATTTCTGG - Intronic
915258062 1:154650904-154650926 AAGAAAGAAAAGAAAAGCCCAGG - Intergenic
915629802 1:157144021-157144043 AAGCATGAAAACAACTTCTGTGG + Intergenic
916434651 1:164766691-164766713 AGGAAAGAAAAGAAAATTTCTGG - Intronic
916437280 1:164788759-164788781 AAGAATGAAAAGAAAAGGGCGGG - Intronic
916557934 1:165909289-165909311 AACAATGAAATGAACATCTCTGG - Intronic
917488344 1:175475630-175475652 AAGAAGGAAAAGAGTATTTCAGG - Intronic
917851313 1:179066957-179066979 AAGTATGAAAAGCACTGCTCAGG - Intronic
918662339 1:187105294-187105316 AAGAAAGAAAAGAATATCTTAGG - Intergenic
918756525 1:188345210-188345232 GAGCATTAAAAGAACATCACTGG - Intergenic
919042238 1:192404598-192404620 AAGAATGGAAACAACAAATCTGG + Intergenic
919497605 1:198294706-198294728 AAAAATAAAAATAACATCTTTGG + Intronic
919514494 1:198505799-198505821 AATAATGAATAGAACATCAAGGG - Intergenic
919695576 1:200571369-200571391 AAGAAAGAAAATAACAGCTTAGG - Intronic
920891304 1:209988579-209988601 AAGACTGAAAGGAAAGTCTCAGG - Intronic
921481550 1:215669809-215669831 AAGCATGAAAAGAATATTTTAGG - Intronic
921550374 1:216528101-216528123 AGGAATGAAAAGACCATTGCAGG + Intronic
921599434 1:217090580-217090602 AAGGCTTTAAAGAACATCTCTGG - Intronic
921882519 1:220271591-220271613 AAGAAGGAAAATAACCTGTCAGG - Intronic
922773271 1:228201301-228201323 ATGAATGAAAAGAGCAGATCTGG - Intergenic
923320566 1:232828825-232828847 GAGAATGAAATCAACAACTCAGG + Intergenic
923376117 1:233364670-233364692 AGGAATTAAAAAAACAACTCAGG - Intronic
923414038 1:233737278-233737300 AAGAATGAAAAGTACAAAACTGG - Intergenic
923874339 1:238031443-238031465 ACGAGTGAAAAGAACAAATCTGG + Intergenic
1063873733 10:10449073-10449095 AAAAATGAAAAGAACTACTGTGG - Intergenic
1064724264 10:18261503-18261525 AAGACAGATAAAAACATCTCTGG - Intronic
1064871429 10:19941742-19941764 AAGAAGGAAAAGAAAACCTATGG - Intronic
1064877108 10:20006517-20006539 AAAAATGAGGAGAACATCTGAGG - Intronic
1065096469 10:22285847-22285869 AAGAATGTAAAGTAGATCTCAGG - Intergenic
1065409428 10:25407586-25407608 AAGAAGGGAAAGAACATATGTGG - Intronic
1065466008 10:26023060-26023082 AAGAAACAAAACAACATTTCTGG + Intronic
1066465236 10:35643938-35643960 AAGAATTAAAAGTACATTTGAGG + Intergenic
1067320926 10:45220186-45220208 AAAAAGGAAAAGAGCTTCTCAGG + Intergenic
1067496501 10:46765127-46765149 AAGAAAGAAAAGTAAATCTGTGG - Intergenic
1067598154 10:47575271-47575293 AAGAAAGAAAAGTAAATCTGTGG + Intergenic
1068281199 10:54872242-54872264 AAGAAATAAATGAACACCTCAGG - Intronic
1068836302 10:61558170-61558192 CAGAATGAGAAGGACATTTCTGG - Intergenic
1069459135 10:68577815-68577837 AAGAAACAAAAAAACATATCTGG + Intronic
1070340015 10:75489356-75489378 AATAATGAGATGAACATTTCTGG - Intronic
1070599895 10:77858127-77858149 AAGACTGAAAAGCACAGCACTGG - Intronic
1071273836 10:84034686-84034708 AAGAAAGCAAAAAGCATCTCTGG - Intergenic
1071376517 10:85010976-85010998 AAAAATGAAAAGGTCATCTCTGG - Intergenic
1071592983 10:86893794-86893816 AAAAAAGAAAAGAAATTCTCAGG + Intronic
1071691474 10:87824612-87824634 TATAATGAAAATAACATCTGAGG - Intronic
1071876437 10:89848355-89848377 AAGAAAGTAAAGAAAATCTCAGG + Intergenic
1072187817 10:93059424-93059446 AAGAATTATATGTACATCTCTGG + Exonic
1072312663 10:94171582-94171604 CAGAATGAAATGAACACATCAGG - Intronic
1072641400 10:97213761-97213783 CAGAATATAAAGAACAGCTCTGG + Intronic
1073671774 10:105598833-105598855 AAGAATGAAAAGAATGGCTTAGG + Intergenic
1073692485 10:105825668-105825690 AAGAATGAAACGAAGAACTCAGG - Intergenic
1074502105 10:114035163-114035185 AAGAGTTAAAAAAACATCCCTGG - Intergenic
1074665434 10:115717537-115717559 AAAAAAAAAAAGAACATTTCAGG - Intronic
1074665478 10:115717852-115717874 AAGCTAGAAAAGAACATTTCAGG - Intronic
1074714793 10:116208275-116208297 ATGAATGAAGAAAATATCTCAGG - Intronic
1074750884 10:116585996-116586018 GATAAGGAAAAGAACATCCCGGG - Intergenic
1075115442 10:119622558-119622580 AATAAATAAAAGAACATTTCAGG - Intergenic
1076069542 10:127476187-127476209 GAGAATAAAAAGATAATCTCTGG - Intergenic
1076209025 10:128625846-128625868 AAGAAAGAAAAGAAAATCTGGGG + Intergenic
1077120174 11:903787-903809 AAAAAAGAAAAGAACATGCCAGG + Intronic
1077909690 11:6563326-6563348 AAGGAAGAACAGAACATCTCAGG + Intronic
1078018031 11:7632154-7632176 AAGAAAGGAAAGAACATTACAGG - Intronic
1078887348 11:15516972-15516994 AAGAAAGAAAAAAAAATCACTGG - Intergenic
1079250921 11:18787037-18787059 AACAATGAAAATAACATTTTTGG - Intronic
1079477462 11:20846341-20846363 AGGAATGAAATGAATATATCAGG - Intronic
1079744994 11:24114902-24114924 AAGAATGAGAAGCACTTCTAAGG + Intergenic
1080272108 11:30461398-30461420 AAAAATGAAAAGAATATATTAGG + Intronic
1080390206 11:31838723-31838745 AAGAATGAAAAGTACAATCCTGG - Intronic
1080738454 11:35040639-35040661 AAAAATGAAATGAATGTCTCTGG - Intergenic
1081016392 11:37886986-37887008 ATGAAAGAAAAGAACATTTGAGG - Intergenic
1081139390 11:39478742-39478764 TAGAATGAAAATAACATAACAGG + Intergenic
1081346254 11:41990453-41990475 TAGAATGAAAATAACATTTCAGG + Intergenic
1083350662 11:62026474-62026496 AATAATAAAAAGAACCTCTGAGG + Intergenic
1084632021 11:70359068-70359090 AAAAATAAAAAGATCCTCTCAGG - Intronic
1086209047 11:84296422-84296444 AAAAATCATAAGTACATCTCTGG - Intronic
1086595314 11:88563698-88563720 AAGACTGAGAAGCACAACTCAGG + Intronic
1087030296 11:93697023-93697045 TAGAATCACAAGAACATCTAAGG + Exonic
1088208202 11:107419766-107419788 AAAAATGAAAAGAGCATCAGAGG + Intronic
1088301733 11:108365197-108365219 AAGAATGCAAACGAAATCTCAGG + Exonic
1088405224 11:109468719-109468741 AACAAAGAAAAGAAAATTTCAGG + Intergenic
1088606629 11:111540003-111540025 AAGAATGAAACTATTATCTCAGG - Intergenic
1090169479 11:124586928-124586950 AAGAAAGAAATGAAAATCTGAGG + Intergenic
1090379395 11:126315256-126315278 AAAAATAAAAAGAATATTTCTGG + Intronic
1090902324 11:131043957-131043979 AAGAATGAGAGCAACATCTCAGG + Intergenic
1091513052 12:1149692-1149714 AAAAATGAAAAAAAGATGTCTGG - Intronic
1091961460 12:4698523-4698545 AAAAAAGAAAAGAAAATCTCAGG + Intronic
1092551947 12:9512205-9512227 AATAATGTAAAGAATTTCTCTGG + Intergenic
1092710613 12:11333312-11333334 AAGAAAAAAAAGAAAATCACTGG - Intergenic
1093165578 12:15801638-15801660 AAGAAAGAAAAAAAAATCTGAGG + Intronic
1093236571 12:16615774-16615796 AAGACTCAAGAGAACATTTCTGG + Intergenic
1093520128 12:20040507-20040529 AAGAAAAAAAAAAACAACTCTGG + Intergenic
1094167072 12:27453863-27453885 AAGAATGAAAAGAAAACTGCAGG + Intergenic
1094520174 12:31178418-31178440 AATAATGTAAAGAATTTCTCTGG - Intergenic
1094609552 12:31980091-31980113 AAAAAGGAAAAGAAAATTTCTGG - Intronic
1094704351 12:32899719-32899741 AAAAAAGAAAAGAGGATCTCTGG - Intergenic
1095290477 12:40474051-40474073 AAGAGTAAAAAGCACATCCCTGG - Intronic
1095470711 12:42534172-42534194 AAGAAAGAAAAGAGCAGATCCGG + Intronic
1095761532 12:45843359-45843381 AAAAAAGAAGAAAACATCTCAGG - Intronic
1096130581 12:49155829-49155851 CAGAATGAAAAGAACAAGCCAGG + Intergenic
1096934184 12:55252982-55253004 AAAAATGTAAAATACATCTCAGG + Intergenic
1097131486 12:56814086-56814108 AAAAATACAAAGAACATCTCTGG + Intergenic
1097526974 12:60749157-60749179 AAAAATAAAAAGAAAATTTCAGG + Intergenic
1097944860 12:65356033-65356055 AAGCATGAAAAGAAGTTCACTGG - Intronic
1098095521 12:66951345-66951367 GGGAATGAGAAGAACATTTCAGG + Intergenic
1098395467 12:70012170-70012192 AAGAATGAAAGGAAAAATTCTGG + Intergenic
1098447301 12:70579375-70579397 AAGAAAGGAAAGAAAATATCAGG + Intronic
1098489375 12:71057924-71057946 AAGAAAGAAAAGATAGTCTCTGG - Intronic
1098855100 12:75643846-75643868 ATGAATCAAAATACCATCTCAGG + Intergenic
1099492401 12:83303422-83303444 AAGAAAAAAAAGAAAATTTCAGG + Intergenic
1099516070 12:83597992-83598014 AAGAAAAAAAAGAAAATTTCAGG + Intergenic
1099570904 12:84316988-84317010 AAGAAAGAAAAGAAAATCATCGG - Intergenic
1099793400 12:87364211-87364233 GAGAATGAAAGGAAAATCTGGGG - Intergenic
1099899639 12:88692211-88692233 AAGAATAAAAAGGAAATCTTAGG + Intergenic
1100205865 12:92348733-92348755 ATGAAAGAAAAGAAAATCTGAGG - Intergenic
1100251610 12:92830569-92830591 AGGAATAAAAAGAATATTTCAGG + Intronic
1100476622 12:94941119-94941141 AAGAAGGACATGAACATCTATGG - Intronic
1101057327 12:100931978-100932000 AAAAAAAAAAAGAACACCTCCGG - Intronic
1102322329 12:111947676-111947698 AAGAATGAAAACAATAACTGAGG - Intronic
1104120905 12:125798678-125798700 AACAATGAAAAAAACACTTCAGG - Intergenic
1104266526 12:127238408-127238430 AAGACTGAACAGCACATCTTAGG + Intergenic
1104659704 12:130601982-130602004 AAGAAAGAAAGAAAAATCTCTGG - Intronic
1105550651 13:21392559-21392581 ATGAATGAAAACAGCTTCTCTGG + Intronic
1105856510 13:24377217-24377239 AATAATGAATAGAACAACTAAGG + Intergenic
1106111343 13:26780212-26780234 AAGAAAAAAAAAAACCTCTCAGG - Intergenic
1106893694 13:34274946-34274968 AAGAAAAAAAAAAAAATCTCAGG - Intergenic
1106923486 13:34589127-34589149 AAGAATAAAAAGAAAAGCTCTGG + Intergenic
1107021484 13:35756748-35756770 AAGAAAGAAAAGAGTATCTGGGG - Intergenic
1107220824 13:37977878-37977900 GAGAGTGAAAAGAATATTTCTGG + Intergenic
1108239998 13:48454335-48454357 TAGCATGAAAATGACATCTCTGG - Intronic
1108275315 13:48803365-48803387 AACAAAGAAAAGAAAATATCTGG + Intergenic
1108817509 13:54309737-54309759 AGCAATGTAAAGCACATCTCAGG - Intergenic
1108896776 13:55339048-55339070 AAGAAGGAATAGAATATCTGAGG - Intergenic
1108967056 13:56321538-56321560 AAGAAGGAAGAGAAAATGTCTGG - Intergenic
1109947626 13:69458559-69458581 AAGAAAGAAAATAAAATCTATGG - Intergenic
1110378659 13:74823825-74823847 AAAATTTAAAAGAACATCCCAGG + Intergenic
1110454040 13:75669926-75669948 AAGGGTGTAGAGAACATCTCTGG + Intronic
1110585070 13:77180299-77180321 CAGAGTGAAGAGAATATCTCAGG - Exonic
1110668449 13:78146288-78146310 AAGAATTAAATGAACATATGTGG - Intergenic
1110728182 13:78850258-78850280 CTGAGTGAAAAGAACATTTCTGG + Intergenic
1112491211 13:99865928-99865950 AAGAAGGAAAAAAATATATCAGG + Intronic
1112828210 13:103416913-103416935 AACAATTAAATTAACATCTCTGG - Intergenic
1113246044 13:108396692-108396714 AAGAATGAAAAGAAAATCCATGG + Intergenic
1113485225 13:110647997-110648019 AAGAATAAAAAGAGCCTATCTGG + Intronic
1113523507 13:110956537-110956559 GACAATGAAAAGCACATCTTCGG + Intergenic
1113701760 13:112393698-112393720 GACAATGAAAAGCACATCTTCGG - Intronic
1114105866 14:19426867-19426889 AAGAAAGAAAAAAACAACTGAGG + Intronic
1114774910 14:25470788-25470810 GAGAATGAATTGAACATATCTGG + Intergenic
1114798418 14:25742876-25742898 AAAAATTAAAAGAAAATCTAAGG + Intergenic
1115126882 14:30006527-30006549 AAGAATGCCAAGGACACCTCTGG - Intronic
1115804549 14:37036190-37036212 AAAAAGGAAAAAAAAATCTCTGG - Intronic
1116139021 14:40965326-40965348 AAGAAAGAAAAGAAAATCATAGG + Intergenic
1116294660 14:43091547-43091569 AAGAAAAAAAAGAAAACCTCAGG - Intergenic
1116359499 14:43975598-43975620 AAGAATGGAAATAACATGTGTGG + Intergenic
1116603796 14:46963586-46963608 ACCAAAGGAAAGAACATCTCAGG - Intronic
1116775994 14:49181364-49181386 AACAAAAAAAAGAAAATCTCAGG + Intergenic
1116889637 14:50255559-50255581 GAAAAAGAAAAGAAAATCTCAGG + Intronic
1117294946 14:54370706-54370728 AAGAATGAAAAGAAAATCTGGGG + Intergenic
1118452861 14:65919626-65919648 AAGCATGACAAGAGCCTCTCAGG + Intergenic
1118678191 14:68211375-68211397 AAGAATGAAAAGAACATCTCAGG + Intronic
1118702065 14:68443125-68443147 AATAAAGAAAAGAAAATCCCAGG + Intronic
1119068403 14:71554519-71554541 AAGAATGCTGAGAACATCTTCGG - Intronic
1119128065 14:72146720-72146742 AAGAATGAAAAAAGCATGTTTGG - Intronic
1119159418 14:72440779-72440801 AAAAATGACAAAAACAGCTCAGG - Intronic
1119689958 14:76663817-76663839 AAGAATGGGAAGGACATCCCAGG - Intergenic
1120151188 14:81036054-81036076 AAGAATAAAAAGAACAACCAAGG + Intronic
1120401257 14:84035133-84035155 AAGCAAGAAAAGATCATCTACGG - Intergenic
1120808985 14:88783105-88783127 AAGAAAGAAAAGAAAATGCCTGG + Intronic
1123924756 15:25097009-25097031 AGGAATGAAGAGAACATCTTAGG + Intergenic
1124436486 15:29653289-29653311 AAGAAAGAAAAGAAAATTTGTGG - Intergenic
1124464308 15:29922141-29922163 AAGAATGAAAAGAAAAAGTCCGG - Intronic
1125429278 15:39580047-39580069 AAAAATGAAAAGAACGTTTAGGG + Intergenic
1126430594 15:48579578-48579600 AATAATGAGGAGAACATTTCTGG + Intronic
1126459836 15:48903311-48903333 ACCAATGAAAAGACTATCTCTGG + Intronic
1127060305 15:55175713-55175735 AATAATTAAATGAAAATCTCTGG - Intergenic
1127351460 15:58157083-58157105 AAGCATTAAAAGAGCATCTGTGG - Intronic
1127838731 15:62811655-62811677 AAGGATGAAATGAGCATGTCTGG + Intronic
1128724316 15:69976491-69976513 AAGAATGAAAACAGTAGCTCGGG - Intergenic
1129959180 15:79667724-79667746 GAGAAAGAAAAAAATATCTCTGG - Intergenic
1130359041 15:83163645-83163667 ATGAATGGAAAAAACTTCTCTGG + Intronic
1130445148 15:83993824-83993846 AAGAAAGAAAAGCTCATCTGGGG + Intronic
1131482006 15:92790334-92790356 AAGAATGCAAATAACCTGTCCGG - Intronic
1133249250 16:4469471-4469493 AAGAATCAAAAAGACCTCTCAGG + Intronic
1133528308 16:6628020-6628042 AAGTGTGCAAAGGACATCTCTGG + Intronic
1133695999 16:8263408-8263430 AACACTGCAAAGAACATCTTTGG + Intergenic
1133754202 16:8750395-8750417 GAGAAAGAAAAGACCAACTCAGG - Intronic
1135291893 16:21246954-21246976 CAGATTGAAAAGAACTTCACTGG - Intronic
1135804067 16:25525990-25526012 AAGAAAGAAAGAAACATCTGTGG + Intergenic
1135909609 16:26547150-26547172 CAGAATGAAAAGAAAATGCCAGG + Intergenic
1138363021 16:56449028-56449050 AAAAATTTAAAGAACATCCCCGG + Intronic
1138529456 16:57627212-57627234 AAGAATGAATGGAACGTCTCGGG - Intronic
1139001651 16:62518186-62518208 AAGTATGAAATTAACATCACTGG - Intergenic
1139133499 16:64174523-64174545 AATAATGAAAGGAAAATCCCTGG + Intergenic
1139631343 16:68233848-68233870 TAGAAGGAGAAGAACATGTCGGG + Exonic
1139816883 16:69681933-69681955 AAGAAAGAAAAGAAAATCTAGGG + Intronic
1139996879 16:70989469-70989491 AAGAAATAAAAGTCCATCTCAGG + Intronic
1140131411 16:72165394-72165416 AAGAAAGAAAAGAAAAGCACTGG - Intronic
1140716529 16:77731022-77731044 CAGAATGAAAAGACAATCTGTGG - Intronic
1141333239 16:83131370-83131392 AAAAATGGAAAGAAAATCACAGG - Intronic
1142341934 16:89529110-89529132 AAGAGTAAAAAGCAAATCTCAGG - Intronic
1142936382 17:3336722-3336744 AAGAGTTAAGAGGACATCTCAGG - Intergenic
1143806063 17:9427861-9427883 AAGAAAGGAAAGAACCTCACAGG - Intronic
1144613842 17:16750716-16750738 AAAAATGAACAAAACATCTGAGG - Intronic
1144735104 17:17551196-17551218 AAGGCTGCAGAGAACATCTCAGG + Intronic
1144898870 17:18564950-18564972 AAAAATGAACAAAACATCTGAGG + Intergenic
1145133506 17:20380768-20380790 AAAAATGAACAAAACATCTGAGG - Intergenic
1146194245 17:30798077-30798099 AACAATAAAAAGAAAATGTCAGG + Intronic
1146355491 17:32130366-32130388 AAAAATGAAAAGATCGTCACAGG + Intergenic
1146477552 17:33175284-33175306 AAGAAGGAGAAAAGCATCTCAGG - Intronic
1146750480 17:35373935-35373957 AAGAAAGAGAAGAACTTCCCAGG + Intergenic
1147809349 17:43156254-43156276 AAGAATCATAAGAAAAGCTCGGG + Intergenic
1147967885 17:44203556-44203578 AAGAATGAAAAAAAAAAATCAGG + Intergenic
1148585111 17:48772433-48772455 AAGAATTAAAAGAATATGGCTGG + Intronic
1148834211 17:50457092-50457114 AAAAATGAAAAAAAGACCTCTGG + Intronic
1149314235 17:55423222-55423244 AAGCATGGAAAGCACCTCTCTGG - Intergenic
1149595850 17:57864233-57864255 AAGGCTGAAAAGAAAATCTTGGG + Intronic
1149728665 17:58923305-58923327 AAGAAAGAAAAGAAAATATTAGG + Intronic
1149823496 17:59803557-59803579 GAGAATGAAACTATCATCTCAGG + Intronic
1150504244 17:65681978-65682000 AAGAAAGAAAAGAAAAATTCAGG - Intronic
1153223975 18:2883939-2883961 AAGAAAGAAAGAAACATCCCTGG - Intronic
1153357330 18:4151721-4151743 CAGAATGAAAAGAACCACTCTGG - Intronic
1154074387 18:11185236-11185258 AAAAAGGAAAAGAATATTTCTGG - Intergenic
1154205680 18:12334783-12334805 AATGATGAAAAGATCATTTCAGG - Intronic
1155281265 18:24242351-24242373 AAGAAAGAAAAGAAAAGCACTGG + Intronic
1155346447 18:24862071-24862093 AGGGAAGAAAAGAACATCTTAGG + Intergenic
1156231934 18:35162007-35162029 AAAAAGGCAAATAACATCTCAGG - Intergenic
1156626168 18:38911881-38911903 AAGAGAGAATATAACATCTCTGG + Intergenic
1156983086 18:43315394-43315416 AGGAAATAAAAGAACTTCTCAGG + Intergenic
1156993139 18:43434591-43434613 AAGAAAGAAAAGCAGATTTCGGG + Intergenic
1157532318 18:48431406-48431428 AAGAATGAAAAGCAAAGATCAGG + Intergenic
1157535424 18:48453829-48453851 AAGAAGGAAAATAATATATCTGG + Intergenic
1158333257 18:56386078-56386100 AGGAAAGAAAAGAAAATCTAGGG + Intergenic
1158815745 18:61093877-61093899 AATATTGAAAAGAATATCTAAGG + Intergenic
1159318672 18:66816364-66816386 AACAATGAGTAAAACATCTCTGG - Intergenic
1159617843 18:70601929-70601951 AAGAATGAAAAGAAGACCCAAGG - Intergenic
1160133426 18:76250184-76250206 AAGAATGAATAGAACAAAGCTGG + Intergenic
1161046965 19:2140168-2140190 AAGAACAAAAAGACCATCCCAGG + Intronic
1162366633 19:10253487-10253509 AAGAAAGAAAAGAAAATGTAGGG + Intronic
1162677196 19:12308068-12308090 TTGAATTAACAGAACATCTCAGG + Intergenic
1163067446 19:14809184-14809206 CAGAATGTAAGAAACATCTCTGG + Intronic
1163708254 19:18830093-18830115 AAAAATAAAAATAACATTTCGGG + Intergenic
1164328235 19:24222449-24222471 AAAAATGGAAAGAACCTTTCTGG - Intergenic
1164585323 19:29467032-29467054 AGGAATGGAAAGAATATCGCTGG + Intergenic
1166435582 19:42764352-42764374 AGGACTGAAGAGAACTTCTCAGG - Intronic
1167917986 19:52757775-52757797 AAGAAAGAAAAGAAAATCTGGGG - Intergenic
1168716871 19:58534072-58534094 AGCAAAGAACAGAACATCTCTGG - Intronic
925578217 2:5382219-5382241 AAGAATGAAAGGAATATCAGAGG + Intergenic
926410745 2:12599648-12599670 AAGAAGGAAAAGGAAATCTCTGG - Intergenic
926537371 2:14129595-14129617 AATAATGAAAAGAATATGTGGGG + Intergenic
927253113 2:21016378-21016400 AATAATGAAAAGAACCACCCAGG + Intronic
927395905 2:22651015-22651037 AAGAAAGAGAAGCACATCTTTGG - Intergenic
928504331 2:31934226-31934248 AAGTCTGAAAAGAAGATCTAAGG - Intronic
929326112 2:40613288-40613310 GAGAGTGAAAAGGACATCCCAGG - Intergenic
929570515 2:43019929-43019951 AAAAATGAAATTAACTTCTCAGG + Intergenic
930711026 2:54551300-54551322 TAAAAGGAAAAGAACATCTGAGG - Intronic
931138543 2:59431694-59431716 AACAATAAAAAGAAAATTTCAGG + Intergenic
931526533 2:63161457-63161479 AATAGTGAAAAGGACATTTCTGG + Intronic
931801585 2:65764096-65764118 AACAATGCAATGAACATCTTTGG - Intergenic
932255412 2:70281702-70281724 AAATTTGAAAAGAACAACTCAGG + Intronic
933468558 2:82689282-82689304 AAAAATAAAAAGAACATGACAGG - Intergenic
934029991 2:88035484-88035506 TAGAATAAAAAGAAAATGTCTGG + Intronic
934624809 2:95836962-95836984 GAGAATGATAACGACATCTCAGG - Intronic
934808765 2:97264452-97264474 AAGAATGATAACGACATCTCAGG + Exonic
934828740 2:97492710-97492732 AAGAATGATAACGACATCTCAGG - Intronic
935243567 2:101198770-101198792 AAAAATGAAAATAAAATTTCAGG - Intronic
936386409 2:112033522-112033544 AAGAAAGAAAATAAAATCTAAGG - Intergenic
936407921 2:112224278-112224300 CAGAATAAAAAGAAAAACTCTGG + Intronic
936872399 2:117148290-117148312 AAGAATGAAAAGAACAGAATTGG - Intergenic
937284898 2:120744065-120744087 AAGTCTGAAAAGACCATCACAGG - Intronic
937530967 2:122827213-122827235 AGGAAGGAAAAGAAGAGCTCAGG + Intergenic
937653784 2:124351196-124351218 AAGAATGCAAAGAATATCTTTGG - Intronic
937764601 2:125645226-125645248 AAGAATTTTAAGAACAGCTCAGG - Intergenic
938608410 2:132921077-132921099 AAGGATGAGAAGATCCTCTCTGG - Intronic
938851943 2:135269558-135269580 AAGCAAGAAAACAACGTCTCTGG + Intronic
939147651 2:138435354-138435376 AAAAAAGAAAAGAAAAGCTCTGG + Intergenic
939277848 2:140024148-140024170 AAGAATGAAAAGAACAGAACAGG + Intergenic
939540802 2:143491579-143491601 AAGAATAAATAGCACACCTCAGG + Intronic
939780062 2:146435070-146435092 TAGAATGATAAGATCATCTAGGG + Intergenic
940144774 2:150534204-150534226 AAAAAAGAAAAAAAAATCTCAGG - Intronic
940864188 2:158800834-158800856 AAAAAAGAAAAGAAGATCTTTGG - Intronic
941126202 2:161586510-161586532 AAGAACGAAAAAAAGATCTCTGG + Intronic
941311228 2:163934643-163934665 AAGAATCAAAAGAACAGCTTGGG + Intergenic
942053787 2:172164064-172164086 AAAAAAGAAAAGAAAATCTTGGG - Intergenic
942286905 2:174427549-174427571 AAGAATGAAATGAAATTCTTTGG - Intronic
942608395 2:177715843-177715865 AAGAATGAAAAGACCACCAAAGG - Intronic
942872461 2:180751552-180751574 ACAAATGAAAAGTACATCTGTGG - Intergenic
942908294 2:181209182-181209204 AAGAATGAACACAATAACTCTGG + Intergenic
943004498 2:182373109-182373131 TAGAATGAAAAATACATCACAGG + Intronic
943470070 2:188283897-188283919 AAAAATAAAAAGAAAATCTGGGG + Intergenic
943691727 2:190876217-190876239 GAGAATGAAAACAACCTCTGTGG - Intergenic
944758475 2:202788459-202788481 AAGAGGAAAAAGAACAGCTCTGG - Intronic
944895810 2:204163089-204163111 AAGAAAGAAAGAAAAATCTCTGG + Intergenic
945040600 2:205740796-205740818 ATGAATGAAAAGACAAACTCTGG - Intronic
945381749 2:209148502-209148524 AATAATGAAAAGCACATCATTGG + Intergenic
945722513 2:213435966-213435988 AAGAATAAAAGGAATATCTGGGG - Intronic
946807920 2:223490611-223490633 AAGAAATAAAAGGACTTCTCTGG + Intergenic
946957272 2:224944705-224944727 CAAAATGAAAAGCACATCTCAGG + Intronic
947081877 2:226407671-226407693 AAGAATGAAAGGAACATTGCTGG + Intergenic
948160705 2:235821741-235821763 GAGATTAAAAAGAACATTTCAGG - Intronic
948534789 2:238637808-238637830 CAGATTGAAAAGGACATCACTGG + Intergenic
1168858758 20:1029649-1029671 AGGAATAAAAAAAACATTTCAGG - Intergenic
1169351540 20:4872197-4872219 AAGACTGAAAAGCACTGCTCAGG + Intronic
1169528502 20:6457166-6457188 CAGAATGAAAAGACAATCTATGG + Intergenic
1169528882 20:6462235-6462257 AATAATATAAAGAACATATCTGG + Intergenic
1169732805 20:8804610-8804632 AAGAATGCAAAAAACATTTGGGG - Intronic
1170114321 20:12840093-12840115 AACAATGTAAAGAACATGCCTGG - Intergenic
1170232201 20:14062220-14062242 AAGACTGAAGGGAACATGTCAGG - Intronic
1170555336 20:17510381-17510403 AAAAATAAAAGTAACATCTCTGG + Intronic
1170656583 20:18292480-18292502 AACTTTGAAAAGAACATCTAGGG - Intronic
1171116631 20:22530647-22530669 AACATTGTAATGAACATCTCTGG + Intergenic
1171747971 20:29018119-29018141 AAGAAAGAAAAGAAAACTTCAGG + Intergenic
1172110398 20:32541398-32541420 ATGAATGAAACCAAGATCTCAGG + Intronic
1172934412 20:38609504-38609526 AATAATAAAAAGAATGTCTCTGG + Intronic
1174105016 20:48155739-48155761 AAGAAAGAAAAGAACAACCCTGG + Intergenic
1174300307 20:49577191-49577213 AAGAAAGAAAGAAACATCTTAGG + Intergenic
1174325189 20:49773288-49773310 AAAAAGGAAAAGAAAATCACTGG - Intergenic
1174783894 20:53414681-53414703 AAAAATGAAAAGAACAAGCCAGG + Intronic
1175450826 20:59065401-59065423 AAGAAAAAAAATAAGATCTCGGG - Intergenic
1175640803 20:60628725-60628747 AAGAATAAAATGACCATGTCCGG - Intergenic
1175977490 20:62718381-62718403 AACAACGAAAAGCACGTCTCTGG - Intronic
1176317555 21:5261565-5261587 AAGAAAGAAAAGAAAACTTCAGG - Intergenic
1176981394 21:15385215-15385237 AAGATTGAATATAACATTTCAGG - Intergenic
1177473418 21:21587787-21587809 AAGAATGAAAAGGACATGAATGG + Intergenic
1177610037 21:23434796-23434818 AAAAAAAAAAAGAAAATCTCAGG - Intergenic
1178025937 21:28466888-28466910 AAAAATGTAAAAAACATCTTTGG - Intergenic
1178590695 21:33907204-33907226 AAAAATGAAACAAACATCCCAGG + Intronic
1178791071 21:35700731-35700753 AAGGAAGAAAAGAACATCAGGGG - Intronic
1180395226 22:12325976-12325998 AAGAAAGAAAAGAAAACTTCAGG - Intergenic
1180404516 22:12538775-12538797 AAGAAAGAAAAGAAAATTTCAGG + Intergenic
1180475168 22:15697473-15697495 AAGAAAGAAAAAAACAACTGAGG - Intronic
1181380879 22:22502771-22502793 AAGAATGAAAGGAATATAGCAGG + Intronic
1181745273 22:24951790-24951812 GAGAAAGAAAAGGACATCACAGG - Intergenic
1181850980 22:25749720-25749742 AAGAAGGAAAAGAACGTCCCAGG - Intronic
1182909911 22:33974031-33974053 CAGAATGAAAAGACAATCTATGG + Intergenic
1182952297 22:34388804-34388826 AAACATAAAAAGAACATTTCAGG - Intergenic
1183900250 22:41000180-41000202 AAGTGTGAAAGGAAGATCTCTGG - Intergenic
949486773 3:4547219-4547241 AAGAATAAAAATAAAATGTCAGG - Intronic
950354909 3:12399072-12399094 AAGGATGGAAAGGACATGTCTGG - Intronic
951074435 3:18372457-18372479 AAAAATGAACAGAAGATCTCTGG - Intronic
951342616 3:21507493-21507515 AATAATAAAAAGAAAATTTCTGG - Intronic
952521792 3:34167889-34167911 AAAAATGAACAGAACCTCTGAGG - Intergenic
953550290 3:43897099-43897121 AAAAATGAAGAGATCTTCTCAGG + Intergenic
953645259 3:44747647-44747669 AAGGATGGTAAGCACATCTCAGG + Intronic
954025465 3:47780128-47780150 AAGAAAGAAATGATCATTTCTGG + Intronic
954581344 3:51704425-51704447 AAGAATGGAAGGAACATGGCAGG + Intergenic
956143752 3:66171789-66171811 ACAATTGAAATGAACATCTCAGG - Intronic
956180635 3:66514975-66514997 ATGAATGAAAACAAAATCACTGG + Intergenic
956735769 3:72236928-72236950 AGGAATGAAAAGATCATCAGAGG - Intergenic
956980606 3:74633057-74633079 CAGAATGAAAAGGAGATCTAAGG + Intergenic
957032338 3:75256128-75256150 AAGAATGAAATGACTTTCTCCGG + Intergenic
957217242 3:77336288-77336310 CAGAGTGAAAAGGACCTCTCAGG + Intronic
958069416 3:88590717-88590739 AGGAATGAAAAGAACACATTTGG - Intergenic
958506962 3:94992118-94992140 AAGAATGTAAAGAACAGTGCAGG + Intergenic
958513717 3:95084345-95084367 ATAAAGGAAAAGAACATTTCTGG + Intergenic
958882054 3:99683373-99683395 AAGAAGGAAAAGAAAATCACAGG + Intronic
959316081 3:104808834-104808856 TTTAATGAAAACAACATCTCTGG - Intergenic
959730386 3:109594514-109594536 AAGGGTGAAAATACCATCTCTGG + Intergenic
960363089 3:116737484-116737506 AAGAAGGAAAACAAAAGCTCAGG + Intronic
960690793 3:120344199-120344221 CAGAAAGATAAGAACATCTGTGG + Intronic
961684526 3:128620463-128620485 GAGAATGAGAAGCTCATCTCAGG - Exonic
961849893 3:129805630-129805652 AACAATTAAAAGAACATTTCTGG + Intronic
962048375 3:131785492-131785514 AAGAATGGAAATAGCAGCTCTGG - Intronic
962135669 3:132729289-132729311 AAGAATGAAATATACATGTCAGG - Intergenic
962685611 3:137845005-137845027 ATGAATGAGAAGCACATCTGGGG - Intergenic
962703284 3:138019657-138019679 AATAATTAAATGAAAATCTCTGG + Intronic
962821619 3:139054064-139054086 AAGAATCAAAAGAACAATTCAGG - Intronic
963159054 3:142131703-142131725 AAGAATTAAAAACACATGTCTGG + Intronic
963395140 3:144722627-144722649 AAGAAAGAAAGAACCATCTCTGG - Intergenic
963451510 3:145487294-145487316 AAGAATTAAAAGCACATGGCAGG - Intergenic
963726503 3:148927955-148927977 AAAAATGAAAAAAAAATCTTTGG - Intergenic
964028289 3:152104821-152104843 AAGAAAGAAAAGAAAAGCTTTGG + Intergenic
964151732 3:153533543-153533565 AAAAATGAAAAGAAAACCACAGG + Intergenic
964234136 3:154505679-154505701 AGGAATAAAAAGGACTTCTCTGG - Intergenic
964264107 3:154874974-154874996 AAGAAAGAAAAGAAGACCTTGGG + Intergenic
964551864 3:157893690-157893712 CAGAAGGAAAATAAAATCTCTGG - Intergenic
964553490 3:157910757-157910779 AAGAAAGAAAATAGTATCTCAGG + Intergenic
965068309 3:163881659-163881681 ATGAGTGATAAGAACATTTCTGG - Intergenic
965142487 3:164856890-164856912 AAAAATGGAAAGATTATCTCAGG + Intergenic
965190238 3:165518490-165518512 AAGCATGAAAAGAAAGCCTCAGG + Intergenic
965280302 3:166743009-166743031 AAGAAAGAAAAGAAAAAGTCAGG - Intergenic
965898789 3:173613397-173613419 ACAAATTAAAAGAACTTCTCAGG - Intronic
966443177 3:179970101-179970123 AAGAAAGAAAAGAAAAGCTTTGG + Intronic
966485656 3:180466449-180466471 AAGAATAAAGAAAACATCACTGG + Intergenic
966750936 3:183321709-183321731 AGGCATGTAAAGAATATCTCTGG + Intronic
967271090 3:187733628-187733650 AAGGTTGAGAAGAACATCACTGG + Exonic
967632481 3:191761484-191761506 AAGGATAAAAAGAACATTACAGG + Intergenic
968316543 3:197730465-197730487 GAGAATGAAAACAACACATCTGG + Intronic
968400312 4:289732-289754 AAGAAAGAAAATGAGATCTCAGG + Intronic
968418961 4:466677-466699 AAGAAAGAAAGTGACATCTCAGG + Intronic
968449294 4:667584-667606 AAGAATGAGCAGAACAGCTCAGG - Intronic
969946514 4:10788849-10788871 AAAAATGAAAAGACTAGCTCTGG + Intergenic
969967219 4:11009557-11009579 ATGAATGAACAAAACATCTATGG - Intergenic
971188956 4:24408644-24408666 AAGCATGGAAAGACCATCTGTGG + Intergenic
971292339 4:25355516-25355538 AAGAGAGAGCAGAACATCTCAGG - Intronic
971816183 4:31493013-31493035 AAGAATGAAAAGGCAATCTTTGG + Intergenic
972109452 4:35539209-35539231 AAGAATCAAAAGAAAGTCACAGG + Intergenic
972185009 4:36518187-36518209 AAGAAGGAAAAGAACAAAACTGG - Intergenic
972363692 4:38352928-38352950 AACAAAGAAAAGAAAATTTCAGG + Intergenic
972501544 4:39682688-39682710 AAGCATGAAAATAGCATCTCTGG + Intergenic
973167448 4:47094977-47094999 AAGAAAGAAAACAAAATGTCAGG + Intronic
973697998 4:53509727-53509749 AAGCATGAAAAGAGCATCTTAGG - Intronic
973721745 4:53731046-53731068 AAGAAAGAAAATAAAATCCCAGG - Intronic
974117848 4:57602382-57602404 AAGAAAGAACAGAAAATCACTGG + Intergenic
974569160 4:63622399-63622421 AAAACTAAAAAGAACATATCTGG - Intergenic
975102164 4:70525909-70525931 GAGAAGGAAAAGAAAGTCTCTGG + Intronic
975261162 4:72301332-72301354 AAGAATGAAAAGACAACCTATGG + Intronic
975363950 4:73506084-73506106 ACCAATGAATAGAACATATCTGG + Intergenic
976572277 4:86626173-86626195 AAGAATAAGAAGAAAAACTCTGG - Intronic
977204179 4:94151286-94151308 AATAAAGAAAAGAAAATTTCAGG + Intergenic
977857489 4:101911385-101911407 AATAATGAAAAGAGTATCTGAGG - Intronic
978131585 4:105204567-105204589 AAAATTGAAAAGAATATCTGTGG + Intronic
978342391 4:107732383-107732405 AAGAAAGAAAAGAACAGTCCAGG + Intergenic
978367833 4:108001132-108001154 AATAATGGATAGAACATTTCTGG + Intronic
978650428 4:110997266-110997288 AAGAAAAAAAAAAAAATCTCTGG + Intergenic
978758396 4:112328806-112328828 AAGAATCAACAAAACATCCCAGG - Intronic
978831013 4:113085044-113085066 GATAATGAAAAGAACATTACAGG - Intronic
978879121 4:113679409-113679431 AAGAAAGAAAAGAAAATGGCTGG - Intronic
979001117 4:115221047-115221069 AAGAAAGAGAAGAAAATTTCAGG - Intergenic
979036356 4:115724428-115724450 AATAATAAAAAGAACAAATCTGG + Intergenic
980539853 4:134178859-134178881 AAGACTGAATAAAACATCTGAGG + Intergenic
980966857 4:139530137-139530159 AAGAAAGAAAGAAACATCTCTGG - Intronic
981157169 4:141452054-141452076 CAGCATGAAAAGAACATTTCTGG - Intergenic
982039545 4:151382762-151382784 AACAATTAAATGAAAATCTCTGG - Intergenic
982483769 4:155942166-155942188 GACAATGAAAAGAGAATCTCTGG - Intronic
982995111 4:162334115-162334137 GAAAAAGAAAAAAACATCTCTGG - Intergenic
984426434 4:179592985-179593007 AAGAATCAAAAGAACATTTTAGG - Intergenic
984454997 4:179954743-179954765 AAAAATGATATTAACATCTCTGG - Intergenic
986651497 5:9967606-9967628 AAGAAAGAAAAGAAAATTACAGG + Intergenic
986908744 5:12527540-12527562 AAGAAAAAAAAGAATATCACTGG - Intergenic
987778465 5:22400047-22400069 AAGATTGAAAAGAAGCTCTCTGG - Intronic
987916108 5:24216849-24216871 AAGAATGGACAGCACATCCCTGG + Intergenic
988947295 5:36218371-36218393 AAAAATTTAAATAACATCTCTGG + Intronic
989271133 5:39534234-39534256 AATGATGAAAAAAACATTTCTGG - Intergenic
990201130 5:53376096-53376118 AAGAAAGAAAAGAAAAACCCAGG + Intergenic
990211006 5:53481287-53481309 AAGAAAGAAAAGAAAACCTGGGG + Intronic
992005512 5:72473595-72473617 GTCAATGAAAAGAACATTTCTGG - Intronic
992821628 5:80503586-80503608 AGCAAAGAAAAGAAAATCTCAGG + Intronic
993653421 5:90550404-90550426 AAGAAAGAAAAGAAAAGCTGGGG - Intronic
993909675 5:93665901-93665923 AACAGAGAAAAGAACGTCTCTGG - Intronic
994044214 5:95289977-95289999 AAGCACGAAAACAACATTTCTGG + Intergenic
994121268 5:96115903-96115925 AAGAAAGAAATGACCATGTCAGG - Intergenic
994182821 5:96786188-96786210 AAGAATGGCAACTACATCTCTGG + Intronic
994403108 5:99307615-99307637 AATAGTCAAAAGAAAATCTCTGG - Intergenic
994830563 5:104776956-104776978 AAGAATGAGAATAAAATATCAGG - Intergenic
995251561 5:109999112-109999134 AAGGATCAAAATAACAGCTCCGG + Intergenic
995283547 5:110361515-110361537 ATGAATGAAGAGGACCTCTCAGG + Intronic
996055375 5:118976878-118976900 AACAAAAAAAAGAACATTTCAGG + Intronic
996060388 5:119026584-119026606 AACAAAAAAAAGAACATTTCAGG - Intergenic
997088564 5:130829334-130829356 AAAAATAAGAAAAACATCTCTGG - Intergenic
997173555 5:131750461-131750483 AAGATAAAAAAGAACCTCTCTGG + Intronic
997212591 5:132086273-132086295 AATAATGAAAACAACAGCCCTGG - Intergenic
997749590 5:136331341-136331363 AAAAATGAATAGAGCATCTAGGG + Intronic
997896667 5:137724802-137724824 AATTAAGAAAAGAACATCTGAGG + Intronic
997958282 5:138297800-138297822 AAGGATGAAAAGAAAAACACAGG + Intronic
998486704 5:142509296-142509318 AAAATTGAAAAGCACATTTCCGG + Intergenic
998712593 5:144843701-144843723 CAGTAGGAGAAGAACATCTCAGG - Intergenic
999126017 5:149246452-149246474 AAGACAGAAAAGATCAGCTCCGG - Intronic
999235125 5:150086023-150086045 AAGTATGAAAAGCACTGCTCTGG + Intronic
1000022407 5:157329551-157329573 AAAATTTAAAATAACATCTCTGG - Intronic
1000632080 5:163602126-163602148 AGAAATGAAAAAGACATCTCAGG - Intergenic
1000777233 5:165435188-165435210 CAGAGTGAAAAGAAAATCTATGG - Intergenic
1002971278 6:2023094-2023116 AAAAATGCCCAGAACATCTCTGG - Intronic
1004559210 6:16731291-16731313 AAGAATGAAAAGAAGATTCTGGG + Intronic
1004878814 6:19984827-19984849 AAGAAAGAAAAGAAAAACTCTGG - Intergenic
1005626642 6:27668826-27668848 AAAAATGAAAAGAACAGGCCGGG + Intergenic
1005902775 6:30232650-30232672 AAAAAAAAAAAGAACACCTCTGG - Intergenic
1006885005 6:37374277-37374299 AAAAAAGAAAAGCACATTTCTGG + Intronic
1006936284 6:37720747-37720769 CAGAATGAAGAGACCATCACAGG + Intergenic
1008390014 6:50939402-50939424 AAAAATAAAAATAACATCTTTGG + Intergenic
1008503537 6:52207079-52207101 AAGAATGAAAATAACTTGGCCGG - Intergenic
1008516917 6:52327231-52327253 AAGAAGGAAAAGAAAATCTGGGG - Intergenic
1008558209 6:52695893-52695915 AAAAAAAAAAAGAACATTTCAGG + Intergenic
1009264742 6:61539062-61539084 AAAAATGAAAAGAAAATCTTAGG - Intergenic
1009536282 6:64890557-64890579 AAAAATGAATATAACATATCGGG - Intronic
1009709067 6:67294538-67294560 AAGAAAGAAAAGAGAATTTCGGG - Intergenic
1010019340 6:71141011-71141033 AACAAAGATAAGAAAATCTCTGG + Intergenic
1010189048 6:73175885-73175907 AAGAAAGAAAAGAAGAAATCTGG + Intronic
1010585707 6:77656172-77656194 AAGAATGAAAACAACACATTAGG + Intergenic
1011553401 6:88550046-88550068 AATAATGAAATGAAGGTCTCAGG - Intergenic
1011970497 6:93216516-93216538 ACGAATGGAAAAAACATCCCAGG - Intergenic
1012072254 6:94637615-94637637 TAGAAAGAAAAGAATATCTCAGG + Intergenic
1012817351 6:104040807-104040829 AAGAAAGAAAAGAAAACCACAGG + Intergenic
1013824125 6:114190871-114190893 AACAATGACAAGAGCTTCTCTGG + Intronic
1013912978 6:115300144-115300166 AAGAAAGAAAAGAAAAAGTCAGG + Intergenic
1014060142 6:117062696-117062718 AAGAATCAGAAAAACATATCAGG - Intergenic
1014575034 6:123059140-123059162 ATGAAGGAAAAGAACATTCCAGG - Intronic
1014748896 6:125232640-125232662 TATAATGAAAAGAAAATCTATGG + Intronic
1014795257 6:125717510-125717532 AAGAATGCAAAGAAGGTCTGTGG + Intergenic
1015769496 6:136754276-136754298 AAAAAAGAAAAGAAAATCCCAGG + Intronic
1016260278 6:142160867-142160889 AAGAATAAAAAGATAATCACTGG - Intronic
1016467375 6:144339204-144339226 ATGGAAGAAAAGAACATTTCTGG + Intronic
1016488345 6:144567818-144567840 TTTAATGAAAAGAGCATCTCAGG - Intronic
1017099678 6:150836831-150836853 AAAAAAGAAAAGAAAAGCTCAGG + Intronic
1017173263 6:151477697-151477719 AAAACTGAAACGAACATCTTCGG + Intergenic
1018001760 6:159585484-159585506 AAGAATGAGAAGAGCCTCCCAGG - Intergenic
1018601268 6:165544870-165544892 ACAAATGAAAATAAGATCTCTGG + Intronic
1018660071 6:166077450-166077472 AAGCAAGAGGAGAACATCTCTGG + Intergenic
1018719536 6:166562437-166562459 ATGAATGTAATGACCATCTCTGG + Intronic
1018880949 6:167879663-167879685 AAGAAACAAAAGAAAATGTCAGG + Intronic
1019873212 7:3786553-3786575 AAAAATGCAAAGAACAGCACTGG + Intronic
1019893478 7:3965278-3965300 AAGAACCCAGAGAACATCTCTGG + Intronic
1020558875 7:9704030-9704052 AAAAATGAAAACAACAACACAGG - Intergenic
1021036506 7:15806466-15806488 AAGAATGAAAAGAAGACATATGG - Intergenic
1021076919 7:16316239-16316261 AAGAATGAACAAAATCTCTCTGG + Intronic
1021166294 7:17346634-17346656 AAGAATGAAAACATTTTCTCAGG - Intergenic
1021335669 7:19398927-19398949 AAGATTGAAAAGACAAGCTCTGG + Intergenic
1022046261 7:26624829-26624851 AAAAATGAAAACAGCATCTGTGG + Intergenic
1022737695 7:33091287-33091309 AAGACTGAAAAGAAAATCTTGGG - Intergenic
1023700955 7:42891416-42891438 AAAAAGAAAAAGAAAATCTCTGG + Intergenic
1024227792 7:47340565-47340587 AAGAAAAAAAAGAAAATCCCAGG - Intronic
1024402690 7:48943662-48943684 AAGAAAGAAAAGAAAGACTCCGG - Intergenic
1024433705 7:49323549-49323571 AAAATTGAAAAGAAAAGCTCAGG + Intergenic
1024490607 7:49978489-49978511 CAGAAGGAAAAGAACAAATCTGG + Intronic
1026076296 7:67172769-67172791 AAGACTGAAGAGAAAATCTGTGG - Intronic
1026150626 7:67785394-67785416 GAGAGTGGAAAGAACAGCTCAGG - Intergenic
1027714832 7:81657338-81657360 AAGACTGACAAAAACATCACAGG + Intergenic
1027791714 7:82643740-82643762 AAGAAGGAAAAGACCCTTTCCGG + Intergenic
1028268161 7:88754405-88754427 AAGAATGAAAAGATCAACCATGG + Intergenic
1028310207 7:89322616-89322638 AAGAATAAAAAGAAAATTTTTGG + Intronic
1028798658 7:94935226-94935248 AAGTATGAAAAGAAGATTGCAGG + Intronic
1029441342 7:100588426-100588448 AAGAATTAAAATTCCATCTCAGG + Intronic
1029660596 7:101958463-101958485 AAAAAAGAAAAGAAAATCTCAGG - Intronic
1029701788 7:102251781-102251803 AAGAATGAAAAGAAGTTAACAGG + Exonic
1031030798 7:116732595-116732617 AAGAATGACAATAGCATCTATGG + Intronic
1031063731 7:117081271-117081293 AAGAATGAGAAGAAGTTCTTAGG - Intronic
1031382048 7:121099005-121099027 AAAAATTAAAAAAACACCTCAGG - Intronic
1031494749 7:122432664-122432686 AAAAAAGAAAAGAAAACCTCTGG + Intronic
1031739717 7:125415064-125415086 AAGAATAAAAAAAAAATCTTGGG - Intergenic
1032146248 7:129383700-129383722 CAGAGTGAAATGAACATCTCGGG - Intronic
1032811639 7:135425157-135425179 AAGAAAGAAAAGAAAAAATCTGG + Intronic
1033226389 7:139566515-139566537 AAGATTAAAAATCACATCTCAGG + Exonic
1033845651 7:145428677-145428699 AAAAAAGAAAAGAAAATGTCGGG + Intergenic
1033889861 7:145998485-145998507 AAGATTAAAAAGGACATTTCTGG + Intergenic
1034828398 7:154287833-154287855 AAAAATGGCAGGAACATCTCAGG - Intronic
1035410926 7:158640699-158640721 AAGCATTAAAAGAAGTTCTCTGG + Exonic
1035972921 8:4271576-4271598 AAAAAGGCAAAGAAAATCTCAGG + Intronic
1036498152 8:9288517-9288539 AAGAATTAAAAGCAGAACTCAGG - Intergenic
1036689869 8:10938425-10938447 AAGTATGAAAAGAACTGCTGGGG - Intronic
1037064586 8:14561819-14561841 AATAATGTAAATAACATTTCTGG + Intronic
1037221243 8:16524856-16524878 CATATTGAAAAGAAAATCTCAGG + Intronic
1037664216 8:20954262-20954284 AAGAATGAAGAGAGTATCCCAGG + Intergenic
1037923695 8:22828360-22828382 AAAGAAGAAAAGAACATTTCAGG - Intronic
1038506911 8:28092574-28092596 TGGAAGGAAAATAACATCTCGGG - Intronic
1038927910 8:32160404-32160426 AAGAATGAAAATAACAACAATGG - Intronic
1039007247 8:33053325-33053347 AAGAAAGAAAAGAAAATTTCAGG + Intergenic
1039937573 8:42059740-42059762 AAGAATGAAAAATACATGCCAGG + Intergenic
1041152626 8:54952674-54952696 ACCAAAGAAAAGTACATCTCAGG - Intergenic
1041339997 8:56834964-56834986 AAGCATGGAAAGAACTTCTTTGG + Intergenic
1041435462 8:57835188-57835210 ATTAATGGATAGAACATCTCGGG - Intergenic
1041639547 8:60181733-60181755 AAGAAAGAAAAAAACATTACTGG + Intergenic
1042182807 8:66108905-66108927 CTCAATGAAAAGAAAATCTCAGG - Intergenic
1042697673 8:71574505-71574527 AAAAAGGAAAAGCACATCTGAGG - Intronic
1043165104 8:76893683-76893705 AAGAATGAACAAAATATTTCAGG + Intergenic
1043263596 8:78232818-78232840 AAGTAAGAATAAAACATCTCAGG - Intergenic
1044087894 8:87963889-87963911 AAGAAATAAAAGAACAGCTCTGG - Intergenic
1044165952 8:88984276-88984298 AATAAAGAAAATAATATCTCAGG + Intergenic
1044199446 8:89415905-89415927 AAGGATGAAAAGGAAATCTTAGG - Intergenic
1044519523 8:93182378-93182400 AAGAAAGAAAACAAAATCTTTGG + Intergenic
1045493042 8:102684944-102684966 ATGAATGAAAAAAACAACACAGG - Intergenic
1045540566 8:103080487-103080509 ATGCATAAAATGAACATCTCAGG + Intergenic
1045795962 8:106044782-106044804 AAGAATAAAAAGTACATCAGTGG - Intergenic
1045853154 8:106727713-106727735 AAGAATGAACAGAACTTGGCTGG - Intronic
1045859633 8:106801326-106801348 AAGAAAGAAGAGATCTTCTCTGG + Intergenic
1046201271 8:110931132-110931154 TAGAAAGGAAAGAACATCACTGG + Intergenic
1046538208 8:115544057-115544079 AGAAATGTAAAGAACATTTCAGG + Intronic
1046576057 8:116030362-116030384 GAGAATGAATAGTTCATCTCTGG + Intergenic
1046662080 8:116958824-116958846 AAAAATGAAAAGAGCATCAGTGG - Intronic
1046678377 8:117138285-117138307 AAAAAAGAAATGAAAATCTCTGG + Intronic
1047063326 8:121252139-121252161 AAGGAAGAAAAGAAAATATCTGG - Intergenic
1049061896 8:140282863-140282885 AAGAAAGAAAAAGAAATCTCAGG - Intronic
1051446574 9:17146172-17146194 ATCAATGAAAAGAAAATCTTAGG - Intronic
1052555217 9:30004675-30004697 CAGAATGAAAAGACAATCTATGG - Intergenic
1052614065 9:30815523-30815545 AAGAGAGAAAAGAAAGTCTCTGG + Intergenic
1053217048 9:36280239-36280261 CAGAATAAAAATAACAGCTCAGG - Intronic
1053561129 9:39195092-39195114 AAGAGTGAAATGATTATCTCTGG - Intronic
1053825226 9:42015329-42015351 AAGAGTGAAATGATTATCTCTGG - Intronic
1054135990 9:61423855-61423877 AAGAGTGAAATGATTATCTCTGG + Intergenic
1054605341 9:67172030-67172052 AAGAGTGAAATGATTATCTCTGG + Intergenic
1055256953 9:74383132-74383154 AAGAAGGAAAAGAAATTGTCAGG - Intergenic
1055546708 9:77382630-77382652 AAGAAGGAAAAGCAAAACTCAGG + Intronic
1055547972 9:77401183-77401205 AAGAATGAGAAGAACTACTCTGG - Intronic
1056021951 9:82447038-82447060 AAGAATAAAAAGAAAATCCAAGG + Intergenic
1056022938 9:82460093-82460115 AAGAAAGAATAGAATATTTCTGG - Intergenic
1056368387 9:85929350-85929372 AAGAGTGAAGAGAAAATCTCTGG + Intergenic
1057006674 9:91566950-91566972 AAGAAAGAAAAGAAAAACCCAGG - Intronic
1057241004 9:93409058-93409080 CAAAATGAAAAGAAAATCTATGG - Intergenic
1057242623 9:93425111-93425133 AAGAATGAAAAGGCAATCTATGG - Intergenic
1057962239 9:99467956-99467978 AACAAGGAAAAGAACAACTCTGG + Intergenic
1058142522 9:101372328-101372350 AAGAATGAGAATAAAATCTTTGG + Intronic
1058889158 9:109345918-109345940 AAGAATGAAAATAACCTGCCAGG - Intergenic
1059037506 9:110772271-110772293 AAGATTAGAAAGAACATCTGTGG - Intronic
1059109009 9:111536881-111536903 AAGAAAGAAAATAACATTTACGG + Intronic
1059619423 9:115987172-115987194 AAGCATAAAAAGAACATTGCTGG + Intergenic
1059648963 9:116296696-116296718 AAAAATGGAAAGCACATTTCAGG + Intronic
1059651630 9:116320877-116320899 AGGAATGAAGAGAAGATCTCAGG + Intronic
1060343800 9:122799886-122799908 AAAAAAGAAAAGAAAATCTAAGG + Intronic
1061207210 9:129171645-129171667 AAGAAAGAAAAGAAAATCCCAGG - Intergenic
1062368484 9:136223829-136223851 AAGAAGGGAAAGAACATCACTGG + Exonic
1203410857 Un_KI270579v1:1022-1044 AAGAAAGAAAAGAAAACTTCAGG - Intergenic
1203410172 Un_KI270581v1:686-708 AAGAAAGAAAAGAAAACTTCAGG + Intergenic
1185505797 X:631488-631510 GAAAATGAAAAAGACATCTCAGG - Intronic
1185589168 X:1262428-1262450 AAGAAAGAAAAATAAATCTCTGG + Intergenic
1186133638 X:6496063-6496085 AAGACTGAGAAGAACATATGGGG - Intergenic
1186223850 X:7376380-7376402 ATGGATGAAAAGACCATCTGAGG - Intergenic
1186819695 X:13274762-13274784 AAAAATGAAAAGCAATTCTCTGG - Intergenic
1187004596 X:15219704-15219726 AAGGAGGAAAAGCCCATCTCAGG + Intergenic
1187134798 X:16537038-16537060 AGGAAAGTAAAGAAAATCTCTGG - Intergenic
1187664014 X:21583840-21583862 AAGTTTGAACAGAACATCTGTGG + Intronic
1187980793 X:24754678-24754700 AAGAATGACAAAACCAACTCTGG - Intronic
1188311499 X:28622359-28622381 AAAAATGAAATGACCTTCTCTGG + Intronic
1188821043 X:34775552-34775574 AAGAAAGAAAAGGACATCTGAGG - Intergenic
1189648872 X:43166547-43166569 ATGAAAGAAAAGAACATTGCTGG - Intergenic
1190446123 X:50526197-50526219 AAGAATAAAAAAAACATTCCAGG + Intergenic
1190574930 X:51825835-51825857 AAGAATGAAAGGAAAAGCTGAGG - Intronic
1190847242 X:54205281-54205303 AACAAAAAAAAGAACATTTCTGG + Intronic
1191115202 X:56845030-56845052 AAAACTAAAAAGTACATCTCTGG - Intergenic
1191666348 X:63706520-63706542 AAGGATGAACTGAACTTCTCAGG + Intronic
1191763872 X:64674932-64674954 AAGAAAGAAAAAAACAACCCAGG + Intergenic
1191954224 X:66626064-66626086 AAGAACCAAAAAAACAACTCTGG + Intronic
1192183129 X:68928786-68928808 AAGAATAAACAGAAAATCGCTGG - Intergenic
1192357056 X:70413874-70413896 AAGCATCAGAAGAACATTTCAGG + Intronic
1194380498 X:93184919-93184941 AAGAAGAAAAAGAAAATCTGGGG + Intergenic
1194444416 X:93970119-93970141 AATAATGTAAAGACGATCTCTGG + Intergenic
1194515001 X:94841655-94841677 AACAACAAAAAGAAAATCTCAGG - Intergenic
1194598272 X:95887228-95887250 AGGAAAGAAAATAAAATCTCAGG - Intergenic
1194716936 X:97297394-97297416 AAGAAAGAAAACAATATGTCAGG - Intronic
1195608898 X:106841374-106841396 TGGAATGAAAAGAACATGCCAGG + Intronic
1195770943 X:108350547-108350569 AAGAATGAAAAAACCAATTCAGG + Intronic
1196792593 X:119477775-119477797 AAGAAAGAAAAGGACATTTTTGG + Intergenic
1196932861 X:120698069-120698091 AAGAAGGAGAAGAACATAACGGG + Intergenic
1197616237 X:128694957-128694979 AAGAAGAAAAAGAACATCAAGGG - Intergenic
1197665130 X:129215274-129215296 AGGACTAAAAAGAAGATCTCAGG - Intergenic
1197742323 X:129904847-129904869 AAGAATGAAAAGAACGGGCCGGG + Intergenic
1199397688 X:147358872-147358894 AGGTATGGAAAGAACATTTCAGG - Intergenic
1199756917 X:150873592-150873614 AAAAATGAAAAGTCCATTTCAGG + Intronic
1200282744 X:154792011-154792033 AAGAATGAAAAGACAATTTTGGG + Intronic
1200692610 Y:6321978-6322000 AAGAATGGAAAGAAAAACACTGG - Intergenic
1200712826 Y:6504495-6504517 AAGAATGGAAAGAAAAACACTGG + Intergenic
1201021088 Y:9657545-9657567 AAGAATGGAAAGAAAAACACTGG - Intergenic
1201042662 Y:9852748-9852770 AAGAATGGAAAGAAAAACACTGG + Intergenic
1201856609 Y:18551428-18551450 AAAAATGAAAAGAATAACTTGGG + Intronic
1201876712 Y:18768952-18768974 AAAAATGAAAAGAATAACTTGGG - Intronic