ID: 1118682224

View in Genome Browser
Species Human (GRCh38)
Location 14:68254346-68254368
Sequence ATGGATCTGCTGACTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118682224_1118682227 -7 Left 1118682224 14:68254346-68254368 CCCTCCACAGTCAGCAGATCCAT 0: 1
1: 0
2: 0
3: 10
4: 198
Right 1118682227 14:68254362-68254384 GATCCATGAATTTAGATGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118682224 Original CRISPR ATGGATCTGCTGACTGTGGA GGG (reversed) Intronic
900318868 1:2072733-2072755 ATGGCCCTGCTGACCCTGGAGGG - Intronic
900631277 1:3636945-3636967 GTTGTCCTGCTGACTGTGGAGGG - Intronic
901278997 1:8017303-8017325 GTAGAACAGCTGACTGTGGAAGG - Intronic
902283968 1:15394354-15394376 ATAAAATTGCTGACTGTGGATGG - Intronic
903220000 1:21864256-21864278 CTGGGTCTGCTGGCTGTGGGTGG - Intronic
905596824 1:39214738-39214760 AGGGATCTGTTCACAGTGGACGG + Intronic
905695040 1:39967794-39967816 ATGGCACTGCTGACTAGGGAAGG - Exonic
905767083 1:40610236-40610258 TTAGCTCTGCTGTCTGTGGATGG - Intergenic
906376405 1:45300162-45300184 TTGGCTCTTCTGACTGTGGTTGG + Intronic
906557497 1:46725120-46725142 AGGGCTCTTCTGACTGAGGAGGG + Intergenic
907293933 1:53437445-53437467 ATGGTTTTGGTGACTTTGGAGGG - Intergenic
909236886 1:73164226-73164248 TGGCATCTGCTGACTGAGGATGG + Intergenic
911147663 1:94568246-94568268 ATGGATCTGATGCCTTTTGATGG + Intergenic
913960508 1:143335144-143335166 GGGTTTCTGCTGACTGTGGATGG + Intergenic
914054863 1:144160716-144160738 GGGTTTCTGCTGACTGTGGATGG + Intergenic
914124283 1:144805645-144805667 GGGTTTCTGCTGACTGTGGATGG - Intergenic
915249110 1:154576087-154576109 TTGGAGCTGCTGTGTGTGGATGG - Exonic
919833844 1:201560392-201560414 AGGGATATGCTGATGGTGGAGGG - Intergenic
923350117 1:233096459-233096481 ATGGAGATGATGACTGTGTAGGG + Intronic
1063202137 10:3794137-3794159 ATGGTTTTGCTGAGTGTGGCAGG - Intergenic
1064973179 10:21086975-21086997 ATGGTTCTGCTGAGTGTAGATGG - Intronic
1066430588 10:35347413-35347435 ATAGACCTTCTGACTGTTGAAGG + Intronic
1067028939 10:42867399-42867421 GGGTTTCTGCTGACTGTGGATGG + Intergenic
1072202414 10:93172551-93172573 GTGGATCTGATGACTGGTGAGGG - Intergenic
1075779617 10:125008589-125008611 CTGGATCTCCCGTCTGTGGAAGG - Intronic
1078537341 11:12185592-12185614 ATGGATGAGCAGACTGTGGCTGG + Intronic
1083230426 11:61314331-61314353 ATGGATCTGCAGATAGTAGAGGG + Exonic
1087043061 11:93820401-93820423 ATGGAGTTGAGGACTGTGGATGG - Exonic
1087168716 11:95028753-95028775 ATGGTTCTGCAGGCTGTGCAGGG - Intergenic
1090155577 11:124434694-124434716 ATGGACTTGCTGTCTGTGAATGG - Intergenic
1090804143 11:130191979-130192001 GAGGCCCTGCTGACTGTGGAAGG - Intronic
1091069584 11:132550537-132550559 ATGGTTCTGCAGGCTGTGCAGGG - Intronic
1091127308 11:133111988-133112010 ATGGATCTACAGACACTGGATGG + Intronic
1092688539 12:11079471-11079493 ATGGCTCTGGTGACTGGAGACGG - Intronic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1096680822 12:53254087-53254109 ATGGCTCTGCTGGCAGTGGTGGG + Exonic
1098384671 12:69906358-69906380 ATGCGACTGCAGACTGTGGAAGG + Intronic
1099913029 12:88856708-88856730 ATGGATCAGCTGACTGAAGCTGG + Intergenic
1100225661 12:92553182-92553204 ATGGGTCTGCTGACTATGTAGGG - Intergenic
1101005204 12:100395094-100395116 ATGGACCAACTGATTGTGGAAGG + Intronic
1101337428 12:103808741-103808763 CTGGATCTGCTTACTGAAGAGGG + Intronic
1102726904 12:115073801-115073823 ATGGGTCTGCTGTGTGTGGCTGG + Intergenic
1102922201 12:116800150-116800172 ATGGTTCTGCAGACTGTAGGGGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1113303218 13:109045766-109045788 AGGGCTGTGCAGACTGTGGAAGG - Intronic
1115500053 14:34041691-34041713 ATGGATATGGTGACAGAGGAAGG + Intronic
1116053989 14:39840101-39840123 GTGGATCTGATGCCTGTGAAAGG - Intergenic
1116054004 14:39840187-39840209 GTGGATCTGATGCCTGTGAAAGG - Intergenic
1118469084 14:66057772-66057794 ATAGATGGGCTGACTGTGGTTGG + Intergenic
1118682224 14:68254346-68254368 ATGGATCTGCTGACTGTGGAGGG - Intronic
1122262372 14:100530779-100530801 AGGGATCTGCTGACAGGCGAGGG + Intergenic
1122910074 14:104823304-104823326 ATGGCTCTGTGGACTGGGGAGGG - Intergenic
1124208158 15:27740822-27740844 TCAGATCTGCTGACTGTGTAGGG - Intergenic
1124515531 15:30364361-30364383 TTGGGTCTGCTGACCTTGGAGGG + Intronic
1124722749 15:32124921-32124943 ACGGATCTGATGTCTGGGGAGGG - Intronic
1124727390 15:32166363-32166385 TTGGGTCTGCTGACCTTGGAGGG - Intronic
1126066342 15:44828920-44828942 ATGAAAGTGCTGCCTGTGGAGGG - Intergenic
1126093540 15:45071946-45071968 ATGAAAGTGCTGCCTGTGGAGGG + Intronic
1127285212 15:57526817-57526839 AGGGACCTGCTGGGTGTGGAAGG + Intronic
1128664050 15:69525422-69525444 AAGGGTCTGCTCACTGTGGTTGG - Intergenic
1129130567 15:73489786-73489808 AGGGAACTGCTGCCTGAGGAAGG - Intronic
1130963680 15:88681838-88681860 ATGGATCAGCAGCCTGTGGCCGG + Intergenic
1131321626 15:91399586-91399608 CTGGATGTGCTGACTGGTGAAGG - Intergenic
1131559327 15:93425570-93425592 ATGGAGCTGCTGACTCTGCTGGG + Intergenic
1132663878 16:1073030-1073052 ATGGAGCTGCTGGGAGTGGATGG - Intergenic
1133070900 16:3246300-3246322 ATGGAGCTGCAGACTGGGAAGGG - Intronic
1133113857 16:3564930-3564952 ATGGATCTGCTGGCTGGGAAGGG - Exonic
1135118389 16:19743317-19743339 CTGGATCTACTGCCTCTGGAGGG + Intronic
1136507675 16:30715899-30715921 AGGGATCTGCTGTCTGCTGAAGG - Intronic
1138926649 16:61599798-61599820 ATGGATATTCTGTCTGTTGAAGG + Intergenic
1141324004 16:83038507-83038529 AGGGCTCTCCTGTCTGTGGAAGG + Intronic
1143633171 17:8150279-8150301 ATGGAACTGCTGGGTGGGGATGG + Exonic
1144564577 17:16349454-16349476 ATGGCACTGCTGGCTGTGGAGGG - Intronic
1144655489 17:17032568-17032590 ATGGAGCTGCTGCCTGTTGTAGG + Intergenic
1146411598 17:32590364-32590386 AGGGATCTCCTGACTCTGGTAGG + Intronic
1147153639 17:38532505-38532527 TTTGGTCTGCTGGCTGTGGAGGG - Exonic
1147744893 17:42688938-42688960 ATGGAGCTGCTCAAGGTGGATGG + Exonic
1150229440 17:63542077-63542099 CTGGATGTGCTGGCTGTGGGTGG - Intronic
1150664781 17:67122997-67123019 ATGTACCTGCTGTCTATGGAGGG - Exonic
1151342415 17:73480476-73480498 GTGGATCTTTTGATTGTGGAAGG + Intronic
1151419864 17:73990176-73990198 ATGGAACACCTGACTGGGGAAGG + Intergenic
1152603569 17:81277739-81277761 ATGCGTCTGCTGCCTGTGCAGGG - Intronic
1153326157 18:3822483-3822505 GTGGATCTGGTGAATCTGGAGGG + Intronic
1153872038 18:9330647-9330669 AATGATCAGCTGACTGTGGCAGG - Intergenic
1157739584 18:50080573-50080595 AGGCTTCTGGTGACTGTGGATGG - Intronic
1158285281 18:55873921-55873943 ATGGACCTGCTGGGTGGGGATGG + Intergenic
1159266694 18:66089520-66089542 ATGGAATTGCTGAAAGTGGAAGG + Intergenic
1161292168 19:3500448-3500470 AGGGATTCGTTGACTGTGGATGG - Intronic
1163204373 19:15791631-15791653 ATGGAACAGCTGTCTGTGGTGGG - Intergenic
1166827140 19:45616627-45616649 ATGGAGCTGGGGACTGTTGAGGG - Intronic
1167066327 19:47188877-47188899 GTGGTTCTGCCAACTGTGGAGGG + Intronic
1167779289 19:51587167-51587189 ATGGATGTTCTGAATGTGGGGGG + Exonic
1202694344 1_KI270712v1_random:113395-113417 GGGTTTCTGCTGACTGTGGATGG + Intergenic
925904945 2:8534816-8534838 CGGGATCTGCAGGCTGTGGAAGG + Intergenic
926109156 2:10171047-10171069 CTGGGTCTGCTCAGTGTGGAGGG - Intronic
926309155 2:11662083-11662105 CTGGAGCTGCTGAGTGAGGAGGG - Exonic
926898325 2:17720229-17720251 GTGGATCTGCTGAATGTTAAAGG + Intronic
929640551 2:43574782-43574804 ATGCACCGGCTCACTGTGGAAGG - Exonic
933952217 2:87341173-87341195 GGGTTTCTGCTGACTGTGGATGG - Intergenic
934236459 2:90237511-90237533 GGGTTTCTGCTGACTGTGGATGG - Intergenic
935179317 2:100675900-100675922 AGGGCTCTGCTCACTCTGGAGGG + Intergenic
936329534 2:111535852-111535874 CTGCATCTGCTTACGGTGGAAGG + Intergenic
937095128 2:119230266-119230288 ATGTTTCTGCTGGCTGGGGATGG - Intronic
937806033 2:126146786-126146808 AAGTAGCTACTGACTGTGGAAGG - Intergenic
938097278 2:128471931-128471953 TGGGATCTGCTCACTGTGGTGGG + Intergenic
939884346 2:147665140-147665162 GTGGATCTGCTGACCATGGCTGG + Intergenic
943777195 2:191778948-191778970 AAGGAACTGTTGAGTGTGGAGGG + Intergenic
943957531 2:194211625-194211647 AGGGATCTGGGGACTGTGAAAGG - Intergenic
944853192 2:203741440-203741462 TTGCATCTGGTGACTGAGGAAGG + Intergenic
946087275 2:217186700-217186722 TTGGACCTGCTGAGTGTGGGAGG - Intergenic
946686696 2:222278296-222278318 ATGGATCTACTAGCTGTGGCTGG - Intronic
948740139 2:240041112-240041134 AGGGAGGTCCTGACTGTGGATGG + Intergenic
1170348192 20:15410507-15410529 ATGGACTTGATGACTGTTGATGG - Intronic
1170777445 20:19390329-19390351 CTGGATCAGCTGACTGGTGAAGG - Intronic
1173840215 20:46152127-46152149 ATTGATCTGCTGGCTGTGCCAGG - Intergenic
1176220293 20:63966438-63966460 ATGGGCCTGCTGACTGTGACAGG + Exonic
1176431564 21:6579335-6579357 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1179633139 21:42691009-42691031 ATGGGGCTGGTGACTTTGGATGG - Intronic
1179706958 21:43186797-43186819 GTCCATCTGCTGAGTGTGGAAGG - Intergenic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1180713279 22:17854546-17854568 ATGGATTTCCTGTCTGTGGACGG - Intronic
1181035728 22:20168940-20168962 AGTGATCTGCGGACTGGGGAGGG + Intergenic
1181307622 22:21925972-21925994 AAGGATCTGCTGTCTGTGTCGGG - Intronic
1182505964 22:30782654-30782676 ATTTATCTGTTGCCTGTGGATGG + Intronic
1182541391 22:31044594-31044616 GTGGAGCTGGTGAATGTGGAGGG + Intergenic
1182555869 22:31128019-31128041 ATGGAGCTGGTCACTGTCGATGG - Exonic
1182867274 22:33614651-33614673 TTGGATGGGGTGACTGTGGAAGG - Intronic
1182916532 22:34037983-34038005 ATGGATCTCCTGGCTGTATATGG + Intergenic
1183292489 22:37011259-37011281 ATGGACTTCCTGACTGAGGATGG - Exonic
1183331017 22:37221530-37221552 GTGGGTCTGCTGACTTAGGAGGG - Intergenic
1183512419 22:38243902-38243924 AGGGAGCTGCAGACTGTGGTGGG + Intronic
952606806 3:35157262-35157284 ATGGAGCTGCTGACTACTGAAGG - Intergenic
952750451 3:36820852-36820874 AAGGATCAGCTGTCTGTTGATGG + Intergenic
954681093 3:52346351-52346373 AGGGCTCATCTGACTGTGGAGGG - Intronic
959663150 3:108891768-108891790 AAGGATCTACTGATTGTGGTTGG + Intergenic
963534891 3:146514829-146514851 TTAGCTCTGCTGTCTGTGGACGG - Intergenic
966623103 3:181986901-181986923 GTGGATCTAGTGACTGTGTATGG + Intergenic
967788415 3:193521992-193522014 GTCCACCTGCTGACTGTGGAGGG - Intronic
967852708 3:194094077-194094099 AGGGATGAGCTGACTGTGGGAGG - Intergenic
968969749 4:3787711-3787733 ATGGGCCTGCTGTCTGGGGAGGG + Intergenic
971964203 4:33530680-33530702 ATGAATTTTCTGACTGTGAAAGG + Intergenic
972629711 4:40832761-40832783 ATGGAGCTGCAGAGTGTTGAGGG - Intronic
972899812 4:43669282-43669304 TTGGCTCTGCTAACTGTTGAGGG - Intergenic
976624734 4:87167590-87167612 ATGGTGCTGCTTCCTGTGGATGG - Intronic
976850497 4:89539810-89539832 ATGGAACTGCTGATTAGGGAAGG - Intergenic
976922689 4:90457874-90457896 ATGGGTCTGCAGGCTGTGGATGG - Intronic
982229152 4:153192689-153192711 TTGGATCTGCTGACTGTGATGGG - Intronic
982538289 4:156634843-156634865 ATGCATTTCCTGACTGTGGTCGG - Exonic
985821954 5:2166536-2166558 TGGGAGCTGCTGACTGTGGTGGG + Intergenic
986167288 5:5285684-5285706 AGGGATCATCTGACTGTAGATGG + Intronic
987076342 5:14385626-14385648 TTGGAACTGGTGACAGTGGAAGG + Intronic
989466681 5:41764766-41764788 ATGCAACTGCTAACTGTGGCTGG + Intronic
990136756 5:52654496-52654518 TTGGATCTGCTGAATGGGGTTGG + Intergenic
993839074 5:92853697-92853719 ATGGATCTCCTCACTGTCCAGGG + Intergenic
994692541 5:103035562-103035584 CTGCTTCTGCTCACTGTGGAGGG + Intergenic
996001887 5:118374288-118374310 CTGCAACTGCTGACTATGGAGGG + Intergenic
996650739 5:125873191-125873213 TTAGCTCTGCTGTCTGTGGATGG + Intergenic
996843239 5:127871242-127871264 ATTGATCTCCTCACTTTGGATGG - Intergenic
999866976 5:155711423-155711445 ATTGATCTGCTGTCTGTCCATGG + Intergenic
1001726102 5:173901972-173901994 AGGGATTTGCTGCCTGTGTAGGG + Intronic
1002195439 5:177498413-177498435 GTGGGTGTGATGACTGTGGATGG - Intergenic
1002309726 5:178307041-178307063 GGGGGTCTGCTGGCTGTGGAGGG + Intronic
1002669128 5:180850967-180850989 ATGAATGTGATGACTGTGGAGGG - Exonic
1003371954 6:5537279-5537301 ATGTCTGTGCTGTCTGTGGAAGG - Intronic
1005673402 6:28129862-28129884 ATGAATGTGATGAGTGTGGAAGG + Exonic
1006756080 6:36416812-36416834 ATGGAAGAGCTGACTGTGGCTGG + Intronic
1006771928 6:36560947-36560969 TAGGATCTGCTAACTGGGGAGGG - Intergenic
1010348361 6:74840310-74840332 ATGGTTCTGCTGGCTGTATAGGG - Intergenic
1011073149 6:83407818-83407840 CTGGATCTCCTGACTGTTGAAGG + Exonic
1011265569 6:85514532-85514554 ATGGAGGTGATGACTGTAGAAGG - Exonic
1011266216 6:85522191-85522213 ATGGCTCTGCAGAATGGGGAAGG - Intronic
1012039503 6:94186062-94186084 ATGGCTCTGCTGTCTGTACAGGG + Intergenic
1013942219 6:115678689-115678711 TTGGATTTGCTGGATGTGGAAGG + Intergenic
1020564524 7:9778638-9778660 TTAGTTCTGCTGTCTGTGGACGG + Intergenic
1021210706 7:17848496-17848518 TTAGCTCTGCTGTCTGTGGATGG - Intronic
1027479117 7:78672386-78672408 ATGGCTCTGCAGACTGTATAGGG - Intronic
1028169710 7:87581695-87581717 AAGGATCTGCTTACTGAAGAAGG + Intronic
1031657781 7:124379798-124379820 ATGGCTGTGCTGCCTGTGGCTGG - Intergenic
1034907026 7:154958260-154958282 ATGGAGATGCTGACTGTGGTAGG - Intronic
1036553002 8:9831648-9831670 ATGGTTCTGCAGGCTGTGCAAGG - Intergenic
1037509110 8:19563718-19563740 CTGGATCCGCTGACTTTGAAGGG - Intronic
1037770042 8:21793272-21793294 ATTGATCTGATGACTGTGTGAGG + Intronic
1038707169 8:29905393-29905415 ATGAATGAGGTGACTGTGGAGGG - Intergenic
1039568266 8:38566111-38566133 AGGGCTCTGGCGACTGTGGAAGG + Intergenic
1041099777 8:54384167-54384189 ATGGATCTTCTGTCTCTAGAGGG + Intergenic
1042210152 8:66371990-66372012 AAGGATGTGCTTACTCTGGATGG - Intergenic
1043023565 8:75037484-75037506 ATGGATATCCTGAAAGTGGATGG + Intergenic
1043778098 8:84295900-84295922 TTGCTTTTGCTGACTGTGGAAGG + Intronic
1047413751 8:124646665-124646687 ATGGCTCTGTTCTCTGTGGATGG - Intronic
1048369501 8:133765376-133765398 ATGGGTCTCCTCACTGAGGAAGG - Intergenic
1048448772 8:134513026-134513048 ATGGGGCAGCTGACGGTGGAAGG + Intronic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1050174217 9:2853072-2853094 ATCCATCTGCTGGCAGTGGAAGG + Intergenic
1055277752 9:74639127-74639149 ATAGCTCTGCTGATTGTAGATGG + Intronic
1055361595 9:75496830-75496852 ATGGATCAACTACCTGTGGAAGG + Intergenic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1056222652 9:84465573-84465595 TTGGATTTGATGACTTTGGAAGG + Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1061901486 9:133674417-133674439 ATGGAACTCCTGGCCGTGGATGG + Intronic
1061917151 9:133761139-133761161 AAGGAGCTGCTGCCTCTGGATGG + Intergenic
1062681462 9:137784241-137784263 ATGGACCTGCTCCCTGTGGGCGG - Intronic
1185529893 X:809265-809287 ATGAATCTGCTATCTGTGCAGGG + Intergenic
1187954205 X:24499886-24499908 ATGGATCTGTGAAGTGTGGAAGG + Intronic
1191837750 X:65482773-65482795 ATGGAACACGTGACTGTGGAAGG + Intronic
1194718167 X:97310715-97310737 ATGGATCTGCCGGGTGTGGTGGG + Intronic
1195290856 X:103430951-103430973 ATGGATCTGATGCCTTTTGATGG + Intergenic
1197309262 X:124883944-124883966 ATGCAGGTGCTGACTGTGGTCGG + Intronic
1199508490 X:148593038-148593060 ATCGCTCTGCTGACCCTGGAGGG + Intronic
1201326398 Y:12764978-12765000 ATGGATTTTCTGACTTTGTAGGG - Intronic