ID: 1118686153

View in Genome Browser
Species Human (GRCh38)
Location 14:68293114-68293136
Sequence GAAACTGTAGAGGCTAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118686153_1118686158 13 Left 1118686153 14:68293114-68293136 CCAGCTCTAGCCTCTACAGTTTC 0: 1
1: 0
2: 0
3: 13
4: 187
Right 1118686158 14:68293150-68293172 CCAAATTGAACTTCCCCGTCTGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118686153 Original CRISPR GAAACTGTAGAGGCTAGAGC TGG (reversed) Intronic
900122466 1:1054679-1054701 GGAACTGCAGGGGCTACAGCGGG - Intronic
904887344 1:33750463-33750485 GTCACTGTAGATGATAGAGCTGG + Intronic
905263882 1:36738116-36738138 GAGACTGCAGAGGATGGAGCAGG + Intergenic
909430559 1:75582967-75582989 GACACTGTCAAGGCTAGAGGAGG - Intronic
910893712 1:92045072-92045094 GCAACTGTAGAGCCTGGAGTGGG - Intronic
911316744 1:96365148-96365170 GAAACTGTAAAGCCCAGGGCTGG + Intergenic
912563298 1:110565737-110565759 GAAACAGTGGAAGCCAGAGCTGG - Intergenic
912648872 1:111420735-111420757 GAAGATGAAGAGGGTAGAGCTGG + Intronic
917358416 1:174150555-174150577 GCTACTGTGGAGGCTACAGCAGG - Intergenic
917778072 1:178360219-178360241 GAAGTTGAAGAGGGTAGAGCAGG - Intronic
920127404 1:203704346-203704368 GAAAATGTAGAGGCAAGTGATGG - Intronic
921572558 1:216796604-216796626 GAAACAGTAGAGGCCAGTGAAGG - Intronic
922425169 1:225485538-225485560 GAAACCATAGAAGCTGGAGCTGG + Intergenic
922849416 1:228720079-228720101 GCAACTTTGGAGGCTAAAGCAGG + Intergenic
923085277 1:230698465-230698487 GACACTGAAGAGGCTGGAACTGG + Intergenic
923394004 1:233542993-233543015 GAAACTGTGGAGGCTGGGGGAGG - Intergenic
1063781307 10:9328250-9328272 GCAACTGGGGAGGCTGGAGCAGG + Intergenic
1065299732 10:24310580-24310602 AAAAATGTAGAGGCTAGAGATGG - Intronic
1067253325 10:44608681-44608703 GAAGATGTACAGGCTAGAGCTGG + Intergenic
1068392750 10:56419917-56419939 GAAACTGAAGAGGATAGAAGTGG + Intergenic
1070612164 10:77940801-77940823 GAAACTGAGGAGGCTAAAGGAGG + Intergenic
1071414710 10:85430227-85430249 GCTACTCTAGAGGCTAGGGCAGG - Intergenic
1071739971 10:88347079-88347101 GAAACAGTAAAGACTTGAGCTGG - Intronic
1075393386 10:122109620-122109642 GAATCTCTAAAGGCAAGAGCTGG - Intronic
1076387155 10:130065473-130065495 GAAGCTGTGGCGGCTGGAGCAGG + Intergenic
1076472754 10:130730124-130730146 GAAACTGCAGTGGACAGAGCTGG + Intergenic
1076581215 10:131513237-131513259 GAAACTGCAGAAGCCAGCGCAGG + Intergenic
1078324750 11:10370382-10370404 AAGATTGTAGAGGCTGGAGCTGG + Intronic
1078933686 11:15934062-15934084 GAAACCATAGAGAGTAGAGCGGG + Intergenic
1079821706 11:25139796-25139818 GAAACTGTAGATGTTGGACCTGG - Intergenic
1080280325 11:30549720-30549742 GAACCTCCAGAGACTAGAGCTGG - Intronic
1080940059 11:36906224-36906246 GAAACTGTGGAAGCTAGAAAAGG + Intergenic
1081655282 11:44853220-44853242 GAGACTGTGGAGGTTATAGCTGG + Intronic
1081980174 11:47261272-47261294 GAAACTGAAGCGGCAAGAGGAGG + Exonic
1082960340 11:58913362-58913384 TAAACTGTGGAGGCCAGAGAGGG + Intronic
1082980278 11:59114505-59114527 TAAACTGTGGAGGCCAGAGAGGG + Intronic
1083551404 11:63592850-63592872 AAAACTGTAGAAATTAGAGCTGG - Intronic
1084027619 11:66462012-66462034 GATACTGCAGAGGCTGAAGCAGG + Intronic
1085677943 11:78542785-78542807 GTAACTCTAGAGGCTGGAGTGGG + Intronic
1086989689 11:93289315-93289337 GAAAATCTAGAGGCTGGAGGTGG - Intergenic
1088895198 11:114073155-114073177 GGAACTGAGGAGGCCAGAGCTGG - Intronic
1091193127 11:133710830-133710852 TAGACTGTAGAGACAAGAGCAGG - Intergenic
1092123507 12:6060436-6060458 GGAAGTGTGGAGGCGAGAGCTGG - Intronic
1093678410 12:21971235-21971257 GACACTGAAGTGGTTAGAGCAGG - Intergenic
1093936178 12:25003044-25003066 GAAACTGCACTGGCTAGAACTGG + Intergenic
1096666550 12:53170135-53170157 GAAAATGCAGAGGGTAGAGCAGG + Intronic
1097866897 12:64566582-64566604 GAAAAAGTAGAGGATAGAGACGG + Intergenic
1098632321 12:72739180-72739202 GAAATTGTAGAGAATAAAGCAGG - Intergenic
1101451592 12:104784822-104784844 GAAACTTGAGAGGCCAGAACAGG - Intergenic
1101487678 12:105182135-105182157 GCTACTGGAGAGGCTGGAGCAGG - Intronic
1102591494 12:113959743-113959765 GAGACCGTAGAGGCTGGAGAGGG - Intronic
1102963908 12:117111851-117111873 GAGACTGTAGAGGTAAGAGGTGG + Intergenic
1108680077 13:52772438-52772460 GAAATTCTAGAAGCTAGAGTAGG - Intergenic
1110543896 13:76735532-76735554 GGAACTGTGGAGGTGAGAGCAGG + Intergenic
1114136659 14:19859874-19859896 GAAACTGGAGAGATAAGAGCAGG + Intergenic
1115245501 14:31290088-31290110 GAAACTGTAGAGGGCAGGCCAGG + Intergenic
1117930026 14:60831824-60831846 GAAACAATAGATGCTAGAGAGGG - Intronic
1118263299 14:64268615-64268637 GTAACTGCAGAGGACAGAGCTGG - Intronic
1118686153 14:68293114-68293136 GAAACTGTAGAGGCTAGAGCTGG - Intronic
1119940490 14:78635899-78635921 GAAACACTGTAGGCTAGAGCTGG + Intronic
1124550647 15:30678296-30678318 GAAACTGGAAAGCCTAGAACAGG + Intronic
1124680602 15:31727315-31727337 GAAACTGGAAAGCCTAGAACAGG - Intronic
1124873226 15:33564582-33564604 AAAACTGTAGAGGCTCTAGATGG - Intronic
1125786992 15:42327858-42327880 GAAACTGGAGAGGCCACATCTGG + Intronic
1126250233 15:46558895-46558917 GAGACTGGAAAGGGTAGAGCGGG - Intergenic
1126907619 15:53384671-53384693 GAAACAGGAGAGGTTAAAGCTGG + Intergenic
1129509725 15:76112368-76112390 GAAACTGTAGAGTCTGGGGAAGG + Intronic
1130335965 15:82957669-82957691 GAAACAGCAGGGGCTAGGGCTGG - Intronic
1132118422 15:99156138-99156160 GAAACTGAAGAAGGTAAAGCTGG - Exonic
1134533099 16:15000419-15000441 GACACTGTAGAGATCAGAGCAGG - Intronic
1135338703 16:21628187-21628209 TAAGCTGTAGATGCTGGAGCTGG + Intronic
1138096936 16:54219209-54219231 GAAACTGCAAAGGCTGGTGCTGG + Intergenic
1139270886 16:65681629-65681651 GCCAATGTAGAGGCGAGAGCAGG - Intergenic
1140468689 16:75202515-75202537 GCTACTGAAGAGGCTAAAGCAGG + Intergenic
1142394699 16:89825482-89825504 GATACTGGGGAGGCTAAAGCAGG - Intronic
1142747468 17:1967058-1967080 GAAACAGAAGAGGCTAAAGTGGG + Intronic
1143327293 17:6107754-6107776 GAAGCTGTAGAGGCCGGAGGTGG + Intronic
1144170214 17:12652674-12652696 GGAACTGTGGAGGCGAGAGGTGG - Intergenic
1145838793 17:27976275-27976297 GAAAAAGTGGAGGCTAGAGATGG - Intergenic
1146942200 17:36851077-36851099 TAAACTGTACAGGCTTGAGATGG - Intergenic
1148550741 17:48549612-48549634 AAAAGTGTGGAGGCTAGGGCAGG - Exonic
1149797780 17:59536736-59536758 GTCACTGTAGAGAATAGAGCAGG - Intergenic
1150611903 17:66739921-66739943 GAAATGGTAGAGGCTGGTGCAGG + Intronic
1151526464 17:74672401-74672423 GAAAATATAGGGGCTGGAGCAGG - Intronic
1152153479 17:78617482-78617504 GAAACTCCAGAAGCCAGAGCTGG + Intergenic
1152562591 17:81086021-81086043 GGAACTGCAGAGGCCAGAGAAGG - Intronic
1154460927 18:14584884-14584906 GAAACTGGAGAGATAAGAGCAGG + Intergenic
1155207375 18:23572081-23572103 GAAACTGTAGAGGCAGCTGCAGG + Exonic
1162459130 19:10803837-10803859 GAAACAGCAGGGGCTACAGCTGG - Intronic
1163107177 19:15131137-15131159 GCAACTCAAGAGGCTGGAGCAGG + Intergenic
1165293973 19:34911212-34911234 GACACTCGAGAGGCTAGAGCAGG + Intergenic
1166889452 19:45981614-45981636 GAAGATGTTGAGGCTGGAGCGGG - Intergenic
926488160 2:13489305-13489327 GAAACTTTATAAGCTAGAGATGG - Intergenic
926556931 2:14369033-14369055 GAAACTGTAGAGTTTATAGAAGG - Intergenic
926814719 2:16789044-16789066 GCTACTCTAGAGGCTGGAGCAGG - Intergenic
927492112 2:23527447-23527469 GAGACTGTGGAGCCCAGAGCAGG + Intronic
928048343 2:27962215-27962237 GAAACTTGAGAGGCTGAAGCCGG - Intronic
928057410 2:28071875-28071897 TAACCTGAAGAGGCTACAGCTGG - Intronic
929418074 2:41764100-41764122 GAGACCATGGAGGCTAGAGCAGG + Intergenic
930332262 2:50000178-50000200 GAAACAGTCAAGGCTAAAGCAGG + Intronic
931382871 2:61769684-61769706 GAAACTGTAGTGGGTAGGGAAGG + Intergenic
931876383 2:66517896-66517918 TAAACTGAAAAGGCTACAGCTGG + Intronic
932543090 2:72677477-72677499 GAAGCTGTAGAGGAAAGAGTTGG - Intronic
932749850 2:74364496-74364518 GTAACTGGGGAGGCTAGAACTGG + Intronic
935829487 2:106986146-106986168 GCTACTCTAGAGGCTGGAGCAGG - Intergenic
936501355 2:113069267-113069289 GTCACTGTAGATTCTAGAGCTGG + Intronic
937199836 2:120193871-120193893 GAAACTATGGAGGCCAGAGATGG + Intergenic
938126361 2:128675633-128675655 GCTATTGGAGAGGCTAGAGCAGG - Intergenic
940683825 2:156820897-156820919 GATAATGGAGAGGGTAGAGCCGG - Intergenic
943425767 2:187731767-187731789 GAATTTGTAGAGGCCAGAGCAGG + Intergenic
948452046 2:238081915-238081937 GAAACGGGAGAGGCCAGAGCTGG - Intronic
1169038275 20:2471062-2471084 GTGACTGTAGAGGAGAGAGCCGG - Intronic
1171933459 20:31249454-31249476 GAAACCTTATAGGCTAAAGCTGG - Intergenic
1172436240 20:34930820-34930842 GAAACTGGTGAGGCTGGAGGGGG - Intronic
1174739395 20:52997606-52997628 GAAACTCTAGAGGGTAGGGCTGG - Intronic
1178580277 21:33832206-33832228 GAAAGTGGAGAGGTTGGAGCTGG - Intronic
1178670106 21:34582605-34582627 GAATCTGGAGAGGGCAGAGCGGG + Intronic
1178911768 21:36680403-36680425 GAAAAAGTAGAGGCTAGAATGGG - Intergenic
1181485483 22:23228682-23228704 GAAACTATAGAGGCCAGAAGAGG - Intronic
1182733997 22:32518001-32518023 GAAAAGGTATAGGATAGAGCTGG - Intronic
1184866292 22:47203475-47203497 GAAACCGTGGAGGACAGAGCTGG + Intergenic
949239658 3:1855205-1855227 GAAAATATAGATGCTAGAGCTGG + Intergenic
952086528 3:29828725-29828747 GAAACTGTACAGTCTAGAGATGG + Intronic
953676841 3:45009351-45009373 GCAACTGCAGAGGCTAGGGGTGG - Intronic
953966597 3:47312194-47312216 GAAGCTGCTGAGGCTAGATCAGG - Intronic
954444156 3:50537683-50537705 GAAACTGAAGAGGCTCCAGCAGG - Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955040816 3:55316268-55316290 GACAATGTAAAGGGTAGAGCTGG - Intergenic
956666288 3:71645159-71645181 GAGAATTTAGAGGCCAGAGCGGG + Intergenic
961252998 3:125522275-125522297 GCTACTGCAGAGGCTAGGGCAGG + Intergenic
964465892 3:156992134-156992156 GATGCTGAAGAGGCGAGAGCCGG - Intronic
964623051 3:158734270-158734292 GCAAGTGCAGAGGCTAGGGCAGG + Intronic
966545202 3:181138475-181138497 GTAACTGTAGTGGCGAGGGCAGG - Intergenic
966746270 3:183280133-183280155 GAAACTGGAGAGGCTGGAAGTGG - Intronic
967900251 3:194442546-194442568 GACACTGTAGATGCGAGAGTAGG + Intronic
969331151 4:6473987-6474009 GAAAAGGTAGAGGCTGGAACAGG - Intronic
972285450 4:37643849-37643871 GAAGCTGAAGAGGCCACAGCTGG + Intronic
972337310 4:38118630-38118652 GAAAGTGTAGAGCCAAGGGCAGG - Intronic
972979134 4:44674459-44674481 GAAAGTGTATAGGGTAGAGGAGG - Intronic
973095903 4:46199469-46199491 GAAACTATAATGACTAGAGCAGG - Intergenic
975343955 4:73272982-73273004 GAAGTTGAAGAGGCTAGAGTTGG - Intergenic
975540674 4:75507687-75507709 GATACAGTAGAGCCTAGGGCAGG + Intronic
979073530 4:116241460-116241482 CAAGCTGTACAGCCTAGAGCTGG + Intergenic
980428866 4:132664207-132664229 CACACTGTAGAGGTTAGAGTTGG - Intergenic
981561043 4:146048738-146048760 GCAACTGTAGGGGCTAGAAAAGG - Intergenic
981813611 4:148803597-148803619 GAACCTGTAGAGGATGCAGCTGG - Intergenic
982247057 4:153363640-153363662 GAAAAGGAAGAGGCTAGAGAAGG + Intronic
983592933 4:169434982-169435004 GAAGCTGTATAGCCTAGTGCAGG - Intronic
988622671 5:32839614-32839636 AAAACTGGAGAGGCTAAAGCTGG + Intergenic
988699281 5:33657222-33657244 GAAACTGGAGAGGCCAGGCCTGG + Intronic
990387926 5:55286541-55286563 GAAGCTGTTGAGGGTAGTGCTGG - Intronic
998629244 5:143880258-143880280 GAAGCTGGAGAGACTGGAGCAGG + Intergenic
1001003331 5:168028357-168028379 GAAAGTGTAGAGGCTTGATATGG + Intronic
1002568313 5:180126572-180126594 AAAACGGTAGAGGGAAGAGCAGG - Intronic
1003875175 6:10429761-10429783 TAGACAGTAGAGGCTAGAACTGG + Intergenic
1005032465 6:21523787-21523809 GAAACTGCAGGAGCTGGAGCTGG + Intergenic
1006098288 6:31669826-31669848 GAAACCGTAGAGCCTAGGCCAGG - Exonic
1006515341 6:34542306-34542328 GAAGCTGGAGAGGCGACAGCAGG + Intronic
1007290089 6:40779080-40779102 GAAACTCTTGTGGCCAGAGCAGG - Intergenic
1008385493 6:50884963-50884985 GAGAATATAGACGCTAGAGCCGG + Intergenic
1009354320 6:62722742-62722764 AAAAGTGTAGAGGATAGATCTGG - Intergenic
1009459697 6:63897519-63897541 GAAACTGAAGAGGCAAGATATGG + Intronic
1011360174 6:86515709-86515731 CAAAAGGTAGAGGCTAGAACTGG - Intergenic
1018870442 6:167778518-167778540 GAAGCAGAAGAGGCTGGAGCAGG - Intergenic
1019690844 7:2410758-2410780 GAGACTGTTGAGGCTGGAGAGGG + Intronic
1019964854 7:4490517-4490539 GAAACTGTTGAAGCCAAAGCTGG - Intergenic
1020461582 7:8434486-8434508 GAAACTTAAGAGGCAAGAGAGGG - Exonic
1021088388 7:16451301-16451323 GCTACTGGAGAGGCTAAAGCAGG + Intergenic
1021499062 7:21309410-21309432 GCTACTCTAGAGGCTAAAGCAGG - Intergenic
1025217192 7:57068712-57068734 GAAACAGCAGATGCTAGAGAGGG + Intergenic
1025628116 7:63242358-63242380 GAAACAGCAGATGCTAGAGGGGG + Intergenic
1025654154 7:63501751-63501773 GAAACAGCAGATGCTAGAGAGGG - Intergenic
1029733108 7:102450653-102450675 GAAACTAGAAAGGCTGGAGCTGG - Exonic
1030206895 7:106959941-106959963 GCCACTCTAGAGGCTGGAGCTGG - Intergenic
1030850124 7:114473392-114473414 CAAACTGTAGAGGCCATAGTAGG + Intronic
1034479745 7:151310196-151310218 GAAACTGTAGACTCTAGATTTGG + Intergenic
1035948683 8:3994193-3994215 GAATGTGTAGAGGATAGAGAAGG - Intronic
1037882766 8:22580922-22580944 GCAACTGGGGAGGCAAGAGCCGG - Intronic
1038689717 8:29750048-29750070 GAATCTCCAGAGGCAAGAGCAGG - Intergenic
1038821430 8:30955630-30955652 GATACTGGAGAGGCTGGGGCAGG - Intergenic
1039552899 8:38456016-38456038 GAAGGTGCAGTGGCTAGAGCAGG - Intronic
1040459139 8:47630383-47630405 AAACCTGTAGAGACCAGAGCTGG - Intronic
1040507548 8:48063933-48063955 GAAAATGTAGAGGACACAGCTGG + Exonic
1041811217 8:61912728-61912750 GAAACTGCAGTGGATGGAGCAGG + Intergenic
1043504204 8:80886424-80886446 GAAACTGGAGAGGGTTAAGCAGG + Intergenic
1048693138 8:136989860-136989882 GAAACTGGAGAGGCCAGGGACGG + Intergenic
1050111169 9:2217910-2217932 CAGACTGTAGAGGCTTGAGGGGG - Intergenic
1051528867 9:18077791-18077813 GAAACTGTTGAGGCAGGAGAAGG + Intergenic
1052762561 9:32607533-32607555 AAAACTGTAGAAGATTGAGCTGG - Intergenic
1053119765 9:35537967-35537989 GAACCTGAGGAGGCTGGAGCAGG + Intronic
1053383966 9:37672373-37672395 GAAAGTGAAGAGGCTTGAGAGGG + Intronic
1055638360 9:78298951-78298973 GAAACAGAACAGACTAGAGCAGG - Intronic
1056856601 9:90134998-90135020 GGAGCTGCAGAGGCTCGAGCTGG + Intergenic
1057721979 9:97539473-97539495 GAGACTGGCCAGGCTAGAGCTGG - Intronic
1058906171 9:109484347-109484369 GAAACTCAGGAGGCTCGAGCAGG + Intronic
1061169869 9:128946433-128946455 GAAACTGAAGAAGCCAGAGCAGG + Exonic
1062081121 9:134623952-134623974 GAATCTGTAGAGGGCAGTGCAGG + Intergenic
1188984719 X:36758905-36758927 GAAACTGTCTAGCCTAGGGCAGG - Intergenic
1189063575 X:37781922-37781944 GACACTGTTGAGGAAAGAGCTGG + Intronic
1194053562 X:89102334-89102356 GAAACTATAGAGACTAAAGCAGG - Intergenic
1200729759 Y:6721619-6721641 GAAACTGTAGCTGTAAGAGCGGG - Intergenic