ID: 1118689950

View in Genome Browser
Species Human (GRCh38)
Location 14:68328748-68328770
Sequence GAATTTGGCCGAGCCTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118689944_1118689950 9 Left 1118689944 14:68328716-68328738 CCGAAGCTGAGCATGTGAGAATC 0: 1
1: 0
2: 0
3: 26
4: 188
Right 1118689950 14:68328748-68328770 GAATTTGGCCGAGCCTTCTGGGG 0: 1
1: 0
2: 3
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118689950 Original CRISPR GAATTTGGCCGAGCCTTCTG GGG Intronic
900563372 1:3319699-3319721 GACCTGGGCTGAGCCTTCTGGGG - Intronic
909647782 1:77936828-77936850 GAATTTGGGAGGGCCTTCAGAGG + Intronic
913163934 1:116168331-116168353 GCAGCGGGCCGAGCCTTCTGCGG + Intergenic
913591494 1:120332374-120332396 GAAGTTGGCAGAGCCCTCTCTGG - Intergenic
913651866 1:120922728-120922750 GAAGTTGGCAGAGCCCTCTCTGG + Intergenic
914169236 1:145206335-145206357 GAAGTTGGCAGAGCCCTCTCTGG - Intergenic
914524356 1:148450301-148450323 GAAGTTGGCAGAGCCCTCTCTGG - Intergenic
914599317 1:149185575-149185597 GAAGTTGGCAGAGCCCTCTCTGG + Intergenic
914642048 1:149616839-149616861 GAAGTTGGCAGAGCCCTCTCTGG + Intergenic
916514015 1:165498375-165498397 GAAGTTGGCTGAGCTGTCTGGGG - Intergenic
918229650 1:182515907-182515929 GCATTTGGCCCAGCCATCAGAGG - Intronic
1063394033 10:5670004-5670026 GAATTCTGCTGAGCCTTCTTTGG + Intergenic
1076402727 10:130194314-130194336 GATTTGGGCCGAGCCGTGTGTGG + Intergenic
1079926972 11:26506117-26506139 GAATTTAACTGTGCCTTCTGTGG + Intronic
1080044733 11:27797109-27797131 AAATTTGGCTCAGCTTTCTGAGG + Intergenic
1082142277 11:48623064-48623086 GAATTTGGCCCAGTCTTCTAAGG - Intergenic
1084392182 11:68884635-68884657 GAATATGGACGATTCTTCTGAGG + Intergenic
1090880908 11:130830714-130830736 GAATCTGGCCGAGCCTCCTGTGG - Intergenic
1098758222 12:74390892-74390914 GCATTTGGCCCAGCCATCAGAGG - Intergenic
1105668870 13:22590006-22590028 TAATGGGGCAGAGCCTTCTGTGG + Intergenic
1107778903 13:43878480-43878502 GAATTTGGAAGAGCCCTCTGGGG - Intronic
1108102642 13:46973732-46973754 GAATTTTCCAGAGGCTTCTGAGG + Intergenic
1113196347 13:107811728-107811750 GAATATGGCCCAGACATCTGGGG + Intronic
1117534854 14:56694101-56694123 GAAACTGGCCTCGCCTTCTGGGG + Intronic
1118689950 14:68328748-68328770 GAATTTGGCCGAGCCTTCTGGGG + Intronic
1121368985 14:93339659-93339681 GATTTGGGCAGAGCCTTCAGAGG - Intronic
1122187639 14:100013476-100013498 GAATTTGCCCAAGGCTTCTCAGG + Intronic
1128306443 15:66601912-66601934 GATTTGGGCAGAGCCTTCAGCGG - Intronic
1130379139 15:83356935-83356957 GAATTTGGCCAAACTTTCTATGG - Intergenic
1131250931 15:90829582-90829604 GCATTTTGCAGAGCCTCCTGAGG + Intergenic
1133466534 16:6032509-6032531 TAATTTGGTGGAGCCTACTGGGG + Intronic
1138813364 16:60176404-60176426 GAATTTGGAAGAGCCTTCTGGGG + Intergenic
1140747948 16:77997740-77997762 GATTTTGGCAGAGAATTCTGGGG - Intergenic
1141476240 16:84275308-84275330 GAAGCTGGAAGAGCCTTCTGGGG - Intergenic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1144081037 17:11764094-11764116 GACTTTGGTCCAGCCTTCTCTGG - Intronic
1151239641 17:72747662-72747684 AAACTTAGCTGAGCCTTCTGGGG + Intronic
928633196 2:33215467-33215489 AAACTTAGCTGAGCCTTCTGTGG + Intronic
929460760 2:42101043-42101065 GAATCAGGCCCTGCCTTCTGGGG - Intergenic
937710946 2:124979213-124979235 CAATTTGGCAGAGGATTCTGGGG + Intergenic
939719198 2:145626362-145626384 GAATTTGCCTGGGCTTTCTGAGG - Intergenic
941069071 2:160935975-160935997 GATTTTAGCCGAGCCATGTGTGG + Intergenic
1169689675 20:8316535-8316557 GAGATTGGCCGAGACTTCTATGG + Intronic
1176743598 21:10630915-10630937 GAGTTTGTCCGGGACTTCTGAGG - Intergenic
1177201716 21:17964450-17964472 TAATTTGGCAGAGGCTTCAGTGG + Intronic
1182067737 22:27442504-27442526 GAAGTTGGCCGGTCCTTCTTGGG + Intergenic
950103596 3:10374478-10374500 GAAATTGGCAGAGCCTCCAGAGG - Intronic
961343616 3:126246755-126246777 GCATTTGGCCTAGCCATCAGAGG - Intergenic
961887243 3:130104274-130104296 GAGTGTGACCGAGCCTTCCGAGG + Intronic
965168749 3:165232482-165232504 GAATTAGGCCTAGCATTCTGAGG - Intergenic
974875378 4:67697886-67697908 GAATTTGGACTACCCTTCAGTGG + Intronic
976285872 4:83370648-83370670 GAATGTGGCAGAGCCTCCTGGGG - Intergenic
984987114 4:185342068-185342090 GAAACTCGCTGAGCCTTCTGGGG - Exonic
989984140 5:50676480-50676502 GAAGTTGGCAGAGCCCTCTCTGG + Intronic
990969156 5:61484103-61484125 GAATTTGGTCCAGTCTTCTGTGG - Intronic
991971901 5:72149538-72149560 GACTCTGGCCCAGCCTTCTAAGG + Intronic
992295177 5:75320472-75320494 GAAATTTTCAGAGCCTTCTGGGG - Intergenic
997436811 5:133881602-133881624 AAATCTGGCCCAGCCTCCTGTGG + Intergenic
998578137 5:143340427-143340449 GACTTTGGCCCTGCCTTCTGGGG + Intronic
1005237505 6:23782235-23782257 GAATTTTGCTCATCCTTCTGAGG + Intergenic
1007623723 6:43230327-43230349 GATTTGGGCAGAGCCTTCAGAGG + Intergenic
1019486295 7:1290933-1290955 GATTTTTCCCGAGCTTTCTGGGG + Intergenic
1019812689 7:3175970-3175992 GCATTTGGGCGAGCTTTCTCAGG - Intergenic
1021526730 7:21596318-21596340 GACTTTGGCAGAGCCTTCTGAGG - Intronic
1032851536 7:135799434-135799456 GAACTTGGCAGAGGCTTCTGTGG + Intergenic
1036941746 8:13058535-13058557 GGATTTGGATGAGCCCTCTGAGG + Intergenic
1038328763 8:26591445-26591467 GAGTTGGGCAGAGACTTCTGAGG + Intronic
1047511159 8:125516747-125516769 GAATATGACAGAGCCATCTGTGG - Intergenic
1055249779 9:74290105-74290127 GCATGTGGCTGAGCCTTCTGGGG - Intergenic
1056872131 9:90291814-90291836 GACATTGGCCTAGCCTCCTGGGG - Intergenic
1061715699 9:132517589-132517611 GAAGCTGGAGGAGCCTTCTGAGG - Intronic
1186524754 X:10238279-10238301 GAAATGGGCCTAGCCTGCTGGGG + Intergenic
1188237258 X:27745845-27745867 GAACATGTCCGAGGCTTCTGTGG - Intronic