ID: 1118690237

View in Genome Browser
Species Human (GRCh38)
Location 14:68331603-68331625
Sequence AACTGGGTTCTGCAATTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118690232_1118690237 26 Left 1118690232 14:68331554-68331576 CCTGTGACTATAGTTTTCATGCA 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1118690237 14:68331603-68331625 AACTGGGTTCTGCAATTTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 188
1118690233_1118690237 2 Left 1118690233 14:68331578-68331600 CCACATATCTACTAATTAGCTCC 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1118690237 14:68331603-68331625 AACTGGGTTCTGCAATTTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118690237 Original CRISPR AACTGGGTTCTGCAATTTCC TGG Intronic
901644245 1:10708157-10708179 AACTGGGTCCTGGAGCTTCCAGG + Intronic
901771511 1:11532589-11532611 AACTGGTGTCTGCATTTGCCTGG - Intronic
902596330 1:17511991-17512013 ATCTAGGTTCTTTAATTTCCAGG - Intergenic
905542578 1:38772156-38772178 AACCTGGTTCTGCCACTTCCTGG - Intergenic
906206566 1:43990593-43990615 AAGTGGGTTCTGAAACTTCCAGG - Exonic
906910638 1:49944770-49944792 AACTGGGCTTTGCATTTTTCTGG - Intronic
907759600 1:57344145-57344167 AACTTGGTTCTGCCATTTACTGG - Intronic
907840248 1:58150179-58150201 ATCTTGGCTCTGCAACTTCCTGG - Intronic
908460326 1:64342638-64342660 TGCTGGGTCCTGCAAATTCCAGG + Intergenic
908928577 1:69288124-69288146 AGCTGGATTCTGCAGTTCCCTGG + Intergenic
909733198 1:78922391-78922413 AACTGGCTTCTACAAGTTTCTGG - Intronic
909800022 1:79795802-79795824 AACTGGGTTATCCAATTTGTTGG + Intergenic
909923148 1:81406479-81406501 AACTGGGTTGAGAAATCTCCTGG - Intronic
913128589 1:115816384-115816406 GACTGGATTCTCCACTTTCCTGG - Intergenic
913141214 1:115943064-115943086 GACTGGCTCCTGCAGTTTCCAGG + Intergenic
917976050 1:180239117-180239139 ACCTGAGTTCTGAAATGTCCAGG - Intronic
918407856 1:184228015-184228037 AACTGGTTTCTGCATTTTTGTGG - Intergenic
919037895 1:192339726-192339748 AACTTTGTTTTGCAATTTCAAGG + Intronic
921315360 1:213885344-213885366 AACCGGCTGCTGCAATTTTCTGG - Intergenic
922055736 1:222040819-222040841 AACTGTGTTCTGCTATTCCTGGG - Intergenic
923663372 1:235977988-235978010 AACTGATTTCTGCCTTTTCCAGG - Exonic
924124983 1:240840805-240840827 CACTGGAGTCTGAAATTTCCTGG + Intronic
1063273789 10:4541403-4541425 CCCTGGGATCTGGAATTTCCTGG + Intergenic
1064087190 10:12354022-12354044 AAGTCACTTCTGCAATTTCCAGG + Intronic
1064141243 10:12792407-12792429 AACTTGTTTCTGCAATTGCTAGG + Intronic
1065662312 10:28018642-28018664 AAAAGGATTCTGCAATTTCCAGG + Intergenic
1066330944 10:34421999-34422021 ATCTGGGTAAAGCAATTTCCAGG + Intronic
1068344952 10:55763946-55763968 AACTGGATTCTACAATTACTGGG + Intergenic
1070270695 10:74951853-74951875 AACTGGTTTCTCCAATTCACAGG - Intronic
1071249242 10:83799706-83799728 ATCTGGGTTTTTCAATTTACTGG + Intergenic
1071733756 10:88274935-88274957 GACTGTGTGCTCCAATTTCCAGG + Intronic
1071846585 10:89527002-89527024 AACTGTATTTTGCAAATTCCTGG - Intronic
1074054052 10:109906233-109906255 AACTTGGTTCTGCATGGTCCTGG - Intronic
1074711831 10:116184215-116184237 AACTGGCTTATGAAATCTCCAGG + Intronic
1077148302 11:1055752-1055774 ATGTGGTTTCTGCAGTTTCCTGG + Intergenic
1078104074 11:8347617-8347639 AAATGGCTTGTGCCATTTCCAGG - Intergenic
1079424491 11:20327152-20327174 AATTGGGTTCTCTAATTCCCCGG + Intergenic
1080142159 11:28934788-28934810 AACTTGTTTCAGCAATTTTCAGG - Intergenic
1081220758 11:40458026-40458048 AAGTGGTTTGTGCAACTTCCAGG + Intronic
1081637959 11:44733529-44733551 AAGTGGGTTCTGAAAGATCCTGG - Intronic
1085382544 11:76133516-76133538 AACTGGGCTCTACCAGTTCCTGG + Intronic
1088146575 11:106687656-106687678 TCCTGGGATCTGCTATTTCCTGG - Exonic
1089933294 11:122336490-122336512 ACCTGATTTCTGCATTTTCCAGG + Intergenic
1090651477 11:128810394-128810416 AACTGGGTTCTGCCTTCTCTGGG + Intronic
1091632355 12:2171495-2171517 CACAGGGTTCCGCCATTTCCTGG + Intronic
1095250609 12:39974508-39974530 TACTGGGTTCTGATATTTACAGG + Intronic
1097630045 12:62049825-62049847 ATCTTTGTTCTGCAATTTCTTGG - Intronic
1099956635 12:89357382-89357404 AACCTGGATCTGCAATTCCCAGG - Intergenic
1102653717 12:114462380-114462402 ATTTGGGTTCTGCCCTTTCCTGG - Intergenic
1103354337 12:120308610-120308632 ATCTGGTTTCTGCAAGTCCCAGG - Intronic
1104811562 12:131622853-131622875 AACTGTGGTCAGCACTTTCCAGG - Intergenic
1104953978 12:132454875-132454897 AAGTGGGTTCTGCATCTCCCGGG + Intergenic
1105768901 13:23588934-23588956 ATCTGGGTTCAGCCACTTCCGGG + Intronic
1107636569 13:42398254-42398276 AATTTGGCTCTGCCATTTCCTGG - Intergenic
1108475964 13:50817867-50817889 CACTGTATTCTGTAATTTCCTGG - Intronic
1109193533 13:59353403-59353425 AACTTGCTTCTTCCATTTCCAGG + Intergenic
1109327460 13:60885550-60885572 AACTGGGTCCTGCAAAGTGCTGG + Intergenic
1109341618 13:61068543-61068565 AACTGGGTTCCTCTATTTTCTGG + Intergenic
1109503324 13:63267140-63267162 TACTGGGTTTTGGACTTTCCAGG - Intergenic
1111522221 13:89420695-89420717 AAGTGGGGACTGCAACTTCCAGG + Intergenic
1111735684 13:92136286-92136308 AATTGGCATCTGCAATTTCATGG - Intronic
1112724353 13:102285462-102285484 AACTCGGTTCTTCAATAACCTGG + Intronic
1112854870 13:103756174-103756196 TACTGGGTTATCCAATTTACTGG - Intergenic
1113580754 13:111426961-111426983 ACCTGGGTTCTGCAATTACCTGG - Intergenic
1118138912 14:63058181-63058203 CACTGAGATCTGCAATTTACTGG - Intronic
1118690237 14:68331603-68331625 AACTGGGTTCTGCAATTTCCTGG + Intronic
1120487239 14:85129528-85129550 ATTTTGGTTCTGCAATTTTCTGG - Intergenic
1120530337 14:85623311-85623333 AACTGGTTTCTGTCATCTCCAGG - Exonic
1121398033 14:93644653-93644675 AACTGGATTCTGCAAACTCTTGG + Intronic
1202896533 14_GL000194v1_random:13682-13704 ACCTGGGTTCTGAAATTCACTGG + Intergenic
1128270031 15:66300972-66300994 ACCTGGGTTCTGCAAAATCCAGG + Intronic
1129135389 15:73544960-73544982 AACTGGGCTCCACATTTTCCAGG + Intronic
1130486405 15:84400756-84400778 ACCTGGGTTCTGTATTTCCCCGG - Intergenic
1130497057 15:84475109-84475131 ACCTGGGTTCTGTATTTCCCTGG - Intergenic
1130769367 15:86908968-86908990 ACCTGGCTTCTGCAGTTTTCTGG + Intronic
1131140277 15:89971662-89971684 AGCTGTGTTCTGCAATTTGGAGG + Intergenic
1131955816 15:97734973-97734995 ATCTTGGTTCTGCCATTTACAGG - Intergenic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1133459572 16:5975733-5975755 ATCTAGGTTCTGCCATTTGCTGG + Intergenic
1135831808 16:25780978-25781000 AACTGTGTTTTGCAACTTCCTGG - Intronic
1138149064 16:54638214-54638236 AACTGGGGTCTGTAATTTCCAGG + Intergenic
1146583254 17:34058952-34058974 ATCTTGGTTCTGCCATTTGCTGG - Intronic
1146687040 17:34848213-34848235 AAATGGTCTCTGCAACTTCCAGG - Intergenic
1148372835 17:47113779-47113801 AACTGAATTCTGCATTTTCAAGG + Intergenic
1152774235 17:82190070-82190092 TACTGGGATATGCAATTTACTGG - Intronic
1152903990 17:82960645-82960667 CACTGGGTGCTGCGATTCCCTGG + Intronic
1153685773 18:7543684-7543706 AACTGAATTCTAAAATTTCCTGG + Intergenic
1156234154 18:35184970-35184992 AACTGGGTTCTGAAATTGGATGG - Intergenic
1156973570 18:43188513-43188535 AGCTGGATTCTGCAATTTCTAGG + Intergenic
1157469120 18:47974591-47974613 AACTGGATCCTGCCATTTCCAGG + Intergenic
1158324057 18:56295091-56295113 AATTGGATTTTGCAATTTCATGG + Intergenic
1159129155 18:64260178-64260200 AAGTGGTTTCTTCAAGTTCCAGG - Intergenic
1160792336 19:928463-928485 AACAGGGGTCTGGAGTTTCCCGG - Intronic
1164048447 19:21563208-21563230 AACTGGTTTGTGCTATTTCTGGG + Intergenic
1164635461 19:29788042-29788064 AACTGGGTGCTGAGACTTCCTGG - Intergenic
1167097432 19:47381861-47381883 AACTGGGTTCTCCAAAGGCCAGG + Intronic
1168652294 19:58098863-58098885 AAATGGGTTCTACAGTTTCAAGG + Intronic
925626822 2:5849776-5849798 AACAGGGTACTGCATATTCCAGG + Intergenic
927065522 2:19467109-19467131 AGCTGGGTTCAGGGATTTCCAGG - Intergenic
928951567 2:36817727-36817749 AACTTGGCTCTGCAAACTCCTGG + Intergenic
929307306 2:40378230-40378252 ACATGGGAGCTGCAATTTCCTGG + Intronic
931409092 2:62011786-62011808 AACTGCCTTCTTCAACTTCCTGG - Intronic
933709956 2:85317554-85317576 AAATGGCATCTGCAATTTACTGG + Intergenic
933776051 2:85771912-85771934 AACTGAGCTCTGCCACTTCCTGG - Intronic
934156805 2:89208833-89208855 AACTGGGTTCTGCCAATACCAGG + Intergenic
934210516 2:89973919-89973941 AACTGGATTCTGCCAATACCAGG - Intergenic
935237304 2:101150112-101150134 CACTTGGTTCTGCGGTTTCCAGG + Intronic
935345978 2:102108779-102108801 GACAGGGTTCTCCATTTTCCTGG - Intronic
938643993 2:133312515-133312537 AAATGGTTTGTGCAATATCCAGG + Intronic
939292699 2:140216234-140216256 AACTGGATTCTGCCATCACCCGG + Intergenic
939329476 2:140738571-140738593 AAAGGGGTTCTGCATTTTTCAGG - Intronic
942315077 2:174690407-174690429 AACTGGGTTCACCCATTTCTTGG - Intergenic
943606552 2:189983691-189983713 CACAGGGTTCTGCAACTTCCTGG + Intronic
944114529 2:196172060-196172082 AACTGGGTTCTCCACTTACAGGG - Intronic
947059772 2:226150594-226150616 AACTGGATTGTCCAATGTCCAGG - Intergenic
948631638 2:239306661-239306683 ACCTGGGTTCTGCCATCACCTGG - Intronic
1168817522 20:750176-750198 ATCTAGGTTCTCCAATTTGCTGG - Intergenic
1170073299 20:12392054-12392076 AAAAGAGTTCTGCAATTTTCTGG - Intergenic
1170077947 20:12440216-12440238 AAGTGGTTTCTGCAGTTCCCTGG - Intergenic
1170133220 20:13045167-13045189 AACTGGGTGCTGGAATATGCAGG - Intronic
1170941414 20:20851285-20851307 AAGTGGGTTCTTCACATTCCAGG + Intergenic
1174675527 20:52350600-52350622 AGCTGGGTTCTGCAATTACAGGG - Intergenic
1176616218 21:9029678-9029700 ACCTGGGTTCTGAAATTCACTGG + Intergenic
1178984438 21:37290870-37290892 TACTGGGGTCCTCAATTTCCAGG + Intergenic
1180068314 21:45423848-45423870 AGCAGGGTTCTGCAGTGTCCTGG + Intronic
1180691643 22:17721316-17721338 AACAGGGCTCTGCTACTTCCTGG - Intronic
1184346147 22:43914497-43914519 TTCTGGGTTCTGTAACTTCCCGG - Intergenic
1184948309 22:47820134-47820156 CACTGGGTTCTGAATTTTCTCGG + Intergenic
949676058 3:6454723-6454745 AACTGGACTCTGCAGTTTTCAGG + Intergenic
950809668 3:15639120-15639142 AAATGGCTTCAGCAATTTTCTGG - Intronic
951792564 3:26502421-26502443 TACTGGGTTGTTCATTTTCCTGG + Intergenic
953274779 3:41484175-41484197 AATTGGGTTCTGTAAGTTCCCGG - Intronic
953552862 3:43917961-43917983 AACTGGGGTTTCCAATTTCTTGG - Intergenic
953584178 3:44184990-44185012 AAATGGGTTATACAATTGCCGGG + Intergenic
954702421 3:52457194-52457216 AACCTGGTTCTGCCATTTCCTGG - Intronic
955580525 3:60415140-60415162 ATCTGGGTTTTGCCATTTACAGG - Intronic
956342097 3:68236788-68236810 AACTGCTTCCTCCAATTTCCTGG + Intronic
956778449 3:72586015-72586037 AACTGGCCTCCCCAATTTCCTGG - Intergenic
956924261 3:73966740-73966762 AACTGGGTTGTGGAATAACCTGG - Intergenic
958888546 3:99756680-99756702 AACCAGGGTCTTCAATTTCCAGG + Intronic
961661196 3:128469632-128469654 CACGGGGCTCTGCAGTTTCCGGG + Intergenic
962541087 3:136382973-136382995 CACTGAGTTCTGAAATTTTCAGG - Intronic
963785488 3:149530369-149530391 AAGTTGAATCTGCAATTTCCAGG + Intronic
965177581 3:165355660-165355682 AACTGGGGTTTGCAATTTGCTGG - Intergenic
966014224 3:175121589-175121611 AACTGGATGTTGGAATTTCCTGG - Intronic
968797294 4:2715823-2715845 ATGTGAGTTCTGCAGTTTCCAGG + Intronic
969241462 4:5901429-5901451 ATCTGGGTTCTGCAAGTTATTGG - Intronic
970362930 4:15327970-15327992 AACTGGGTTCAGTAATGTCATGG + Intergenic
970851070 4:20603757-20603779 CTCTGGGTTGTGCAATTTACAGG + Intronic
971197978 4:24487367-24487389 AACTTGTTCCTGCATTTTCCTGG + Intergenic
974383376 4:61171992-61172014 AATTGGATTTTGGAATTTCCAGG - Intergenic
974911843 4:68132505-68132527 AACTGGATTCCACAAATTCCTGG + Intergenic
977982741 4:103344609-103344631 AAGTGAGGTGTGCAATTTCCAGG - Intergenic
981820895 4:148886448-148886470 ATCTGGTTTCTTGAATTTCCAGG - Intergenic
984507546 4:180638462-180638484 TACTGGCTTCTGCAAATTTCTGG + Intergenic
985397582 4:189560433-189560455 AACTGAGGCCTGCAATTTCAAGG + Intergenic
987432631 5:17855047-17855069 TACTGACTTCTGCAAATTCCTGG + Intergenic
989263638 5:39447434-39447456 AACTGGGTTTTGCAAAATCAGGG - Intronic
996189666 5:120523991-120524013 AACTTGGCTCTGCCTTTTCCAGG + Intronic
996303820 5:122023076-122023098 AACTGGTTTCTGCTACTTTCAGG - Intronic
999270458 5:150293824-150293846 GACTGGGTTCAGCAACCTCCAGG - Intergenic
1001941250 5:175741229-175741251 AACTCAGTTCTGCTCTTTCCTGG - Intergenic
1005098417 6:22143697-22143719 AAGAGGCTTCTGCAATTGCCTGG - Intergenic
1007316352 6:40992462-40992484 CCCAGGGTTCTGCATTTTCCAGG + Intergenic
1007355005 6:41308336-41308358 AAGTGGCTTCTGGAATTTCCTGG - Intergenic
1007823317 6:44578354-44578376 ATCTGGGCTCTGCAAATTTCTGG + Intergenic
1010174666 6:73014063-73014085 AAGTGAGTTCTCCTATTTCCAGG + Intronic
1012815869 6:104021252-104021274 GACTGGTTTCCCCAATTTCCTGG - Intergenic
1013355263 6:109340880-109340902 GACTTGATTCTGCAATTTGCAGG + Intergenic
1016719783 6:147282744-147282766 ATCTTGGTTTTGTAATTTCCTGG + Intronic
1016989502 6:149919623-149919645 TACTGGGTTCTGTGCTTTCCAGG + Exonic
1016993548 6:149945480-149945502 TACTGGGTTCTGTGCTTTCCAGG - Exonic
1017004784 6:150022050-150022072 TACTGGGTTCTGTGCTTTCCAGG + Exonic
1017065246 6:150522879-150522901 TAATGGGTTCTAGAATTTCCTGG - Intergenic
1017065560 6:150525991-150526013 AAATGGATTCTGTTATTTCCCGG + Intergenic
1018719832 6:166564137-166564159 AAATGGATTTTGCATTTTCCCGG - Intronic
1019207297 6:170373140-170373162 AACTGGTTTTTCCAGTTTCCTGG + Intronic
1021587613 7:22226434-22226456 AACTGTCTTCTGAATTTTCCTGG - Intronic
1023534700 7:41196118-41196140 AATTGGGTCCTGCAATTCTCTGG + Intergenic
1027571775 7:79877117-79877139 AACTGCATTGTGCAATTTACTGG + Intergenic
1028626279 7:92880925-92880947 AACTGGGTTGGGCAATCCCCAGG - Intergenic
1028791347 7:94856346-94856368 AACTTGGTTCTTCACATTCCAGG + Intergenic
1030351015 7:108487415-108487437 GACTGGGTTCTGCATTTTCAGGG + Intronic
1030650107 7:112108578-112108600 CACTGGGTTCTGCAAATTAAAGG - Intronic
1031209979 7:118811117-118811139 AACTGTCTTCTACAATGTCCTGG - Intergenic
1037493001 8:19413199-19413221 ATCCAGGTTCTGCCATTTCCAGG + Intronic
1038470625 8:27815230-27815252 AACTGGAATCTTCAATTTCCTGG - Intronic
1039190398 8:34967162-34967184 AACTGTGTCCTGCAATATCTTGG - Intergenic
1044854774 8:96464068-96464090 ATCTGGGTTCTGCAATCACATGG - Intergenic
1047316464 8:123738990-123739012 AAATGGGATATACAATTTCCAGG - Intergenic
1047536872 8:125727914-125727936 TACTGGGTTCTGAATTCTCCAGG + Intergenic
1047722326 8:127652616-127652638 ATCCTGGTTCTGCAATTTACTGG + Intergenic
1055198114 9:73621670-73621692 AATTAGGTTCTGTAATTTACAGG - Intergenic
1055924770 9:81498558-81498580 AACAGGGTTGTAGAATTTCCTGG - Intergenic
1057556163 9:96089558-96089580 AGCTGGGTTCTAGAACTTCCAGG - Intergenic
1058430587 9:104915148-104915170 AACTGAGTTATCCAATCTCCAGG + Intronic
1059722691 9:116976655-116976677 AAGTGGGTCCTGCACTGTCCTGG + Intronic
1061314440 9:129785967-129785989 ATCTGGGAGCTGCCATTTCCTGG + Intergenic
1187036797 X:15549163-15549185 ACCTGGGGACTGCAATTTCCTGG + Intronic
1188786387 X:34351807-34351829 ATCTGTGTTCCTCAATTTCCTGG + Intergenic
1189188270 X:39072703-39072725 AACTTGAGTCTGCCATTTCCCGG - Intergenic
1189959503 X:46310881-46310903 AACTGTGATCTTCATTTTCCTGG + Intergenic
1190217143 X:48487505-48487527 AACTGGGGTCTGGACATTCCTGG - Intergenic
1194520576 X:94914252-94914274 AACTGGGATCAGCAATTCTCTGG - Intergenic
1195788575 X:108556082-108556104 AGTTGGGTTGTGCTATTTCCTGG + Intronic
1199696958 X:150349395-150349417 AACTGGCTGCTTGAATTTCCAGG + Intergenic
1201149596 Y:11088402-11088424 ACCTGGGTTCTGAAATTCACTGG + Intergenic
1201949629 Y:19549818-19549840 ATCCAGGTTCTGCAATGTCCTGG + Intergenic